Add files using upload-large-folder tool

.gitattributes

@@ -1929,3 +1929,5 @@ medical/pdf/PMC10358526.pdf filter=lfs diff=lfs merge=lfs -text
 medical/pdf/PMC5096761.pdf filter=lfs diff=lfs merge=lfs -text
 medical/pdf/PMC5197590.pdf filter=lfs diff=lfs merge=lfs -text
 medical/pdf/PMC4883813.pdf filter=lfs diff=lfs merge=lfs -text
+medical/pdf/PMC8931378.pdf filter=lfs diff=lfs merge=lfs -text
+medical/pdf/PMC10168206.pdf filter=lfs diff=lfs merge=lfs -text

medical/md/PMC10197906.md

@@ -0,0 +1,263 @@
+ORIGINAL R**ESEARCH**
+Association Between Neutrophil Density and Survival in Trauma Patients Admitted to the Intensive Care Unit; a Retrospective Cohort Study Mohebat Vali1, Shahram Paydar2, Mozhgan Seif3, Maryam Hosseini2, Pardis Basiri5, Golnar Sabetian6, Haleh Ghaem3∗
+1. Student Research Committee, Shiraz University of Medical Sciences, Shiraz, Iran.
+
+2. Trauma Research Center, Shahid Rajaee (Emtiaz) Trauma Hospital, Shiraz University of Medical Sciences, Shiraz, Iran. 3. Non-Communicable Diseases Research Center, Department of Epidemiology, School of Health, Shiraz University of Medical Sciences, Shiraz, Iran. 4. Trauma Research Center, Shahid Rajaee (Emtiaz) Trauma Hospital, Shiraz University of Medical Sciences, Shiraz, Iran.
+
+5. Department of Computer Science and Engineering and IT School of Electrical Engineering and Computer, Shiraz University, Shiraz, Iran.
+
+6. Anesthesiology and Critical Care Trauma Research Center, Shiraz University of Medical Sciences, Shiraz, Iran.
+
+Received: January 2023; Accepted: February 2023; Published online: 3 April 2023
+
+![0_image_0.png](0_image_0.png)
+
+Abstract: Introduction: Altered immune responses, in particular neutrophil changes, are perceived to play a key role in immune responses to trauma. This study aimed to evaluate the association of neutrophil changes with patients' survival in severe trauma cases. **Methods:** The current retrospective cohort study was conducted using data from patients admitted in the intensive care unit (ICU) of a trauma center in Shiraz, Iran, between 2016 and 2021. Patients were divided into three groups (i.e., normal, neutropenia, and neutrophilia) based on neutrophil count at the time of ICU admission, and the association of neutrophil count with in-hospital mortality was analyzed. **Results:** 2176 patients with the mean age of 37.90 ± 18.57 years were evaluated (84.04% male). The median trauma severity based on injury severity score (ISS) in this series was 9 (4 -17). Patients were divided in to three groups of neutrophilia (n = 1805), normal (n = 357), and neutropenia (n = 14). There were not any significant differences between groups regarding age distribution (p = 0.634), gender (p = 0.544), and trauma severity (p = 0.197). The median survival times for the normal, neutropenia, and neutrophilia groups were 49 (IQR: 33 -47) days, 51 (IQR: 8- 51) days, and 38 (IQR: 26 - 52) days, respectively (p = 0.346). The log-rank test showed a statistically significant difference between the three groups adjustment for ISS (p ≤ 0.001). For each unit increase in ISS, the hazard ratio increased by 2%. In ISS 9-17, the hazard ratio increased by 11% compared to ISS<4. Also, in ISS>17, the hazard ratio increased by 76% compared to ISS<4 in ICU-hospitalized patients. **Conclusion:** In general, the findings of the present study showed that the survival rate of patients in the normal group after ISS adjustment was higher than the other two groups. Also, the Cox model showed that the mortality risk ratio in the neutropenia group was 15 times higher than the normal group.
+
+Keywords:Neutrophils; Survival; Neutropenia; Wounds and Injuries; Multiple trauma; Trauma Severity Indices Cite this article as: Vali M, Paydar S, Seif M, Hosseini M, Basiri P, Sabetian G, Ghaem H. Association Between Neutrophil Density and Survival in Trauma Patients Admitted to the Intensive Care Unit; a Retrospective Cohort Study. Arch Acad Emerg Med. 2023; 11(1): e29.
+
+https://doi.org/10.22037/aaem.v11i1.1990.
+
+∗**Corresponding Author:** Haleh Ghaem; Department of Epidemiology, School of Health, Shiraz University of Medical Sciences, Shiraz, Iran. Tel: +98 71 37256007, Email: ghaemh@sums.ac.ir, ORCID: https://orcid.org/0000-00019564-392X.
+
+## 1. Introduction
+
+Recently, WHO has estimated that trauma accounts for 5.8 million mortalities, annually (1, 2). In recent years, traumacaused mortalities have substantially declined owing to advances in treatment approaches, particularly in patients under blood clot and blood loss treatments. However, secondary complications such as sepsis, multiple organ failure (MOF), and nosocomial infections may harm trauma patients or even cause death (3). Neutrophils constitute 60-70% of circulatory leukocytes in the body, playing a key role in innate immunity and host defense against invading pathogens, as well as eliciting inflammation-induced tissue damage (4). In healthy individuals, circulatory neutrophils are primarily naïve cells, which are subsequently activated by recognizing damage-associated molecular patterns (DAMPs) through their pathogen-associated molecular patterns (PAMPs),
+thereby maintaining the immune system homeostasis (5).
+
+Upon inflammation, neutrophils properly respond to microenvironmental signals and obtain distinct functional phenotypes, commonly referred to as neutrophil heterogeneity (6, 7). Besides, trauma can affect neutrophils (8). Indeed, neutrophils are the first line of defense against microbial pathogens and trauma and commence inflammatory responses. Trauma-induced modulations in neutrophils, ultimately lead to post-traumatic complications e.g., multiple organ failure and acute respiratory distress syndrome (8). At a wide range of time points after traumatic injury, ex vivo studies have reported significant changes in many neutrophil functions (9-14) that probably contribute to the development of secondary complications.
+
+Experimental studies indicate a direct relationship between trauma severity and the consequent tissue impairment and/or neutrophil dysfunction (15). In addition, depending on the stage of injury, neutrophils can contribute to repair mechanisms or exacerbate the pathophysiology of trauma
+(16).
+
+A retrospective study (17) explored neutrophils' involvement in severe trauma to uncover the link between trauma severity and neutrophils' phenotype/function. However, given that we only obtained the basic blood test information on neutrophils' percentage from patients at the time of admission, we were encouraged to investigate the impact of neutrophil density on trauma patients' survival. For this purpose, we attempted to evaluate neutrophil counts in patients with adjusted injury severity to determine neutrophils' overall effects.
+
+As mentioned, there is an important balance between proinflammatory and anti-inflammatory systems in the immune response to trauma. The imbalance between these systems plays an important role in the post-injury outcomes of critically ill patients (18, 19). Understanding the link between neutrophil dysfunction (neutropenia, or neutrophilia) and patients' survival may yield appropriate early biomarkers for clinical applications and treatment of trauma patients.
+
+Therefore, this study aimed to evaluate the association of neutrophil changes with patients' survival in severe trauma cases admitted to intensive care unit (ICU).
+
+## 2. Methods 2.1. Study Design And Setting
+
+The current retrospective cohort study was carried out using data from trauma patients admitted to ICU of Shahid Rajaee Hospital (Imtiaz), Shiraz, Iran, between 2016 and 2021.
+
+Patients were divided into three groups (i.e., normal, neutropenia, and neutrophilia) based on neutrophil count at the time of ICU admission and the association of neutrophil count with in-hospital mortality were analyzed. The Ethics Committee approved this study at Shiraz University of Medical Sciences (IR.SUMS.SCHEANUT.REC.1400.006). This information was collected for the purpose of research by the Trauma Research Center of Shahid Rajaei Hospital using the patients' files; therefore, due to the nature of the research, informed consent was obtained from the patients themselves or their legal guardians upon the arrival of the patients. In addition, the private medical information of the patients remained confidential, and the researchers were not provided with the name, surname, and national code for the confidentiality of the patients' information
+
+## 2.2. Participants
+
+All trauma patients over 18 years old, who presented to the ICU of the mentioned hospital were enrolled. Patients who were transferred to another hospital or whose final outcomes regarding in-hospital mortality or survival was not available were exclude. Additionally, all women regardless of pregnancy status were included in the study, but those who died in the emergency department and patients who died within 6 hours of hospital admission were excluded from the study.
+
+Also, patients were followed for the duration of their hospital stay or at subsequent hospital visits, but were not specifically followed for post-discharge trauma deaths.
+
+## 2.3. Data Gathering
+
+The variables included the demographic information (age and gender), hospitalization information (date and time of ICU admission and discharge), patients' outcome at the time of discharge from ICU (in-hospital mortality), injury mechanism (accidents or others), patients' consciousness status at the time of ICU admission (Glasgow coma scale (GCS), Pupil 1 and 2), the injury severity score )ISS), patients' vital signs
+(heart rate [HR], respiratory rate [RR], systolic blood pressure
+[SBP], and diastolic blood pressure [DBP]), and arterial blood gas analysis (blood acidity [PH], arterial blood carbon dioxide
+[PCO2], arterial blood oxygen [PAO2] levels and using artificial respiration device, FiO2), as well as laboratory information (blood sugar [BS], blood urea nitrogen [BUN], creatinine [Cr], sodium [Na], potassium [K], prothrombin time PT], partial thromboplastin time [PTT], international normalized ratio [INR], hemoglobin, lymphocyte, fibrinogen, white blood
+
+| Table 1: Patients' baseline characteristics Characteristic                                                                                                                                                                                                                                                                           | Neutropenia N = 14   | Normal N = 357     | Neutrophilia N =1805   | P a    |
+|--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|----------------------|--------------------|------------------------|--------|
+| Age (year) Mean ± SD                                                                                                                                                                                                                                                                                                                 | 33.50 ± 15.35        | 38.21 ± 18.43      | 38.26 ± 18.68          | 0.634  |
+| Gender Female                                                                                                                                                                                                                                                                                                                        | 1 (0.29)             | 61 (17.63)         | 284 (82.08)            | 0.544  |
+| Male                                                                                                                                                                                                                                                                                                                                 | 13 (0.71)            | 296 (16.17)        | 1521 (83.11)           |        |
+| Cause of injury Accidentsd                                                                                                                                                                                                                                                                                                           | 10 (0.61)            | 261 (16.00)        | 1360 (83.38)           | 0.610  |
+| Othere                                                                                                                                                                                                                                                                                                                               | 4 (0.74)             | 96 (17.71)         | 442 (81.55)            |        |
+| Length of stay, Median (IQR) ICU                                                                                                                                                                                                                                                                                                     | 3 (0.75 - 8.25)      | 3 (1 - 9)          | 6 (2 - 12)             | 0.0001 |
+| Hospital                                                                                                                                                                                                                                                                                                                             | 2.5 (1.75 - 6.25)    | 7 (2 - 17)         | 10 (4 - 38)            | 0.0001 |
+| Vital signs on arrival, Median (IQR) O2 saturation (%)                                                                                                                                                                                                                                                                               | 93 (90.75 - 96.25)   | 93 (89 - 96)       | 93 (90 - 96)           | 0.917  |
+| SBP (mmHg)                                                                                                                                                                                                                                                                                                                           | 116.5 (103 - 137.75) | 123 (107 - 138.75) | 127 (110 - 139)        | 0.037  |
+| DBP (mmHg)                                                                                                                                                                                                                                                                                                                           | 75 (59.5 - 87.5)     | 78 (65.5 - 87)     | 80 (70 - 88)           | 0.063  |
+| GCS                                                                                                                                                                                                                                                                                                                                  | 13 (7 - 15)          | 13 (7 - 15)        | 12 (7 - 15)            | 0.318  |
+| RR (/minute)                                                                                                                                                                                                                                                                                                                         | 19.5 (17.75 - 21.25) | 20 (17 - 22)       | 20 (17 - 22)           | 0.974  |
+| PR (/minute)                                                                                                                                                                                                                                                                                                                         | 104.14 (21.73)       | 104.04 (23.64)     | 101.45 (24.42)         | 0.174  |
+| Pupils (first hour) Responsive                                                                                                                                                                                                                                                                                                       | 13 (0.71)            | 314 (17.05)        | 1515 (82.25)           | 0.314  |
+| Unresponsive                                                                                                                                                                                                                                                                                                                         | 0 (0.00)             | 24 (14.04)         | 147 (85.96)            |        |
+| ISS Median (IQR)                                                                                                                                                                                                                                                                                                                     | 9 (8 - 16.5)         | 9 (4 - 17.25)      | 12 (5 - 18)            | 0.197  |
+| Intubated Yes                                                                                                                                                                                                                                                                                                                        | 4 (0.54)             | 113 (15.13)        | 630 (84.34)            | 0.863  |
+| No                                                                                                                                                                                                                                                                                                                                   | 8 (0.71)             | 175 (15.57)        | 941 (83.72)            |        |
+| a: comparison of the three groups (One-way ANOVA or Kruskal–Wallis) or Chi square d: Traffic accidents and accidents include: pedestrian accident, motorcyclist accident, and car accident. e: Others include: falling from a height, being hit by a sharp object, being hit by a bullet, assault, falling to the ground, continuing |                      |                    |                        |        |
+
+Table 2: Multiple Cox regression of survival in trauma patient
+
+| Variable                                                                                                         | Hazard ratio   | 95% CI         | P value   |
+|------------------------------------------------------------------------------------------------------------------|----------------|----------------|-----------|
+| Injury severity score                                                                                            | 1.02           | (1.00,1.05)    | 0.042     |
+| pH                                                                                                               | 0.42           | (0.21,0.82)    | 0.011     |
+| O2 saturation                                                                                                    | 0.990          | (0.982,0.999)  | 0.044     |
+| Groups Normal (Ref )                                                                                             | -              | -              | -         |
+| Neutropenia                                                                                                      | 15.06          | (1.809,125.40) | 0.012     |
+| Neutrophilia                                                                                                     | 0.92           | (0.42, 2.00)   | 0.843     |
+| CI: confidence interval. Test of proportional hazards assumption based on Schoenfeld residuals (phtest) = 0.726. |                |                |           |
+
+count [WBC], and neutrophils count) based on patients' profile. Patients were divided into three groups based on their circulatory neutrophil count. For neutrophils, 45-75% of WBC was considered normal, while less than 45% and more than 75% were considered neutropenia and neutrophilia, respectively. To determine the final status of the patients as our preferred outcome, the patients were followed up until the last day of hospitalization and if the patients were discharged from the hospital alive, we considered them "alive" and if the doctor diagnosed and issued a death certificate, we considered them "dead". In addition, we excluded the patients who were transferred to another treatment center due to the inability to follow up their condition. MV, in collaboration with Trauma Research Center, was responsible for data gathering.
+
+![3_image_0.png](3_image_0.png)
+
+## 2.4. Statistical Analysis
+
+We analyzed the data normality using the KolmogorovSmirnov test and related graphs. For quantitative variables with normal distribution, mean and standard deviation (SD)
+were employed, and for non-normal data, the median and percentiles were reported. Besides, for qualitative variables, frequency and percentage were utilized. Analysis of variance
+(ANOVA) or Kruskal–Wallis test was also exploited to compare quantitative variables between the normal, neutropenia, and neutrophilia groups. Furthermore, Sidak post hoc or Mann–Whitney U test was used for subsequent comparison between the groups. In addition, the Chi-square test was utilized to compare qualitative variables between the groups. To draw graphs. In addition, for survival analysis, Kaplan-Meier adjusted for the ISS and log-rank were employed to compare the groups. Finally, both simple and multiple Cox regression analyses were utilized to explore factors associated with the survival of ICU-hospitalized trauma patients. Then, the proportional hazards assumption test based on the Schoenfeld residuals (phtest) was utilized to determine the proportional hazards assumption. All analyses were performed using STATA 12 software with a significance level of P ≤ 0.05.
+
+## 3. Results 3.1. Baseline Characteristics Of Studied Cases
+
+Data was collected from 3782 trauma patients hospitalized in the intensive care unit. After the exclusion of patients under 18 years of age, patients transferred to another hospital, patients whose final status (death or aliveness) was not known, and patients with missing data, 2176 patients were finally evaluated. Table 1 depicts the participants' characteristics. Patients' average age was 37.90±18.57 (range 18-100)
+years (84.04% male). The Median trauma severity based on ISS in this series was 9 (4 -17) and the main cause of hospitalization in more than 70% of the patients was traffic accidents
+(pedestrian, motorcyclist, and car accidents).
+
+Patients were divided in to three groups of neutrophilia (n
+= 1805), normal (n = 357), and neutropenia (n = 14) based on total neutrophil count at the time of admission to ICU.
+
+There were not any significant differences between groups regarding age distribution (p = 0.634). gender (p = 0.544), and trauma severity (p = 0.197).
+
+In laboratory data, a statistically significant difference was observed between the groups only regarding the amount of K (p = 0.002), PTT (p = 0.0022), WBC (p ≤ 0.001), Hb (p =
+0.0026), and lymphocytes (p ≤ 0.001).
+
+## 3.2. Survival Analysis
+
+The median overall survival time was 40 (IQR: 22-51) days. Also, the median survival time for the normal, neutropenia, and neutrophilia groups was 49 (IQR: 33 -47) days, 51 (IQR: 8- 51) days, and 38 (IQR: 26 - 52) days, respectively (p
+= 0.346). Figure 1 shows the Kaplan-Meier diagram for the groups adjusted for the ISS. Also, the log-rank test did not exhibit a statistically significant difference between the normal and neutropenia groups (p = 0.581). Likewise, no statistically significant difference was shown between the normal and neutrophilia groups (p = 0.437). However, the log-rank test showed a statistically significant difference between the three groups despite adjustment for ISS (p ≤ 0.001). Multiple Cox analysis results are shown in Table 2. As the table depicts, for each unit increase in ISS, the hazard ratio increased by 2%. In ISS 9-17, the hazard ratio increased by 11% compared to ISS<4. Also, in ISS>17, the hazard ratio increased by 76% compared to ISS<4 in ICU-hospitalized patients. In addition, for each unit increase in blood pH, the hazard ratio decreased by 58%. In this sense, neutropenia had 15.06 times higher hazard ratio than the normal group.
+
+## 4. Discussion
+
+This retrospective study evaluated trauma patients' survival rate based on their neutrophil count (i.e., normal, neutropenia, and neutrophilia). Our findings denoted that after adjustment for ISS, the normal group's survival rate is greater than the neutropenia and neutrophilia groups. Furthermore, the Cox model revealed that each unit increase in the ISS increases the hazard ratio. Consistently, this model revealed that neutropenia increases the hazard ratio up to 15 times.
+
+Neutrophils play a major role in inflammatory responses upon the occurrence or following traumatic injuries. Ensuing the trauma, neutrophils undergo significant functional changes, causing a rapid efflux of neutrophils from the bone marrow into the circulation (20). In compliance with previous studies, we showed that neutrophilia is more prevalent in the first 24 hours' post-trauma compared to neutropenia. Indeed, neutrophilia is the first post-trauma event due to the endogenous release of cortisol and catecholamine, resulting in neutrophil production and subsequent release from the bone marrow (21, 22). However, numerous studies have proposed that the increased release of neutrophils into the circulation may lead to the emergence of immature and dysfunctional neutrophil s(21-25), ultimately, resulting in peripheral tissue damage and multiple organ dysfunctions (MODS) (26-29). Hence, neutrophilia might not be correlated with the improved survival of traumatic patients as it was revealed that the normal group patients lived much longer than the neutrophilia group patients. On the other hand, neutropenia increased mortality more than 15 times in critical trauma patients. The low survival of neutropenia patients could be attributed to neutrophil dysfunction, thereby enhancing hospitalized trauma patients' sen5 **Archives of Academic Emergency Medicine. 2023; 11(1): e29**
+sitivity to healthcare-associated infections (30). Also, in a previous review study, by investigating the effect of trauma on neutrophil phenotype with the main purpose of using this knowledge to investigate the predictive potential of neutrophil changes on secondary complications in patients with traumatic injuries, they came to the same conclusion that changes in the markers and functions of neutrophils may be potential biomarkers that predict the outcome of trauma patients (17). In this sense, manipulating neutrophil frequency to improve patients' survival might be controversial. However, boosting neutrophils' germicidal and anti-infective capacity could be quite appealing. Of note, uncontrolled neutrophil hyperactivation may lead to significant tissue impairment, thereby contributing to development of acute respiratory distress syndrome (ARDS) and MOF. On the contrary, suppressing neutrophils' inflammatory response shortly after a traumatic insult to reduce immunity-induced tissue impairment may predispose patients to microbial infections.
+
+Therefore, developing strategies to create an equilibrium between these issues is urgently required to assist patients' recovery by modifying the immune response.
+
+## 5. Limitations
+
+The current study has several strengths such as including a large number of trauma patients. In addition, this study was conducted in the largest trauma center in southern Iran, which is a specialized center for trauma. Taking potential confounders into account (e.g., the ISS), as well as using laboratory information and ABG are other advantages of the current study. Nonetheless, the shortcomings of the current study should not also be neglected. For example, the retrospective design of study has its limitations. In this regard, we suggest the prospective investigation of neutrophils' effects on patients' survival in future studies. Also, we were not able to study neutrophil phenotypes, therefore, investigating their phenotypes is encouraged. Furthermore, our data on neutrophils was based on WBC percentages, hence, we suggest these data to be analyzed based on WBC number/L. Also, we reported neutrophils' normal range from different sources, which might have affected the results. However, we chose neutrophils' normal range based on hospital kits, which are used for correcting differential reports. Also, for neutrophil measurement, we did not have data on neutrophil counts at different time points after trauma, which should be taken into account in future studies. Finally, neutrophil changes in ICU-hospitalized patients also require further investigation.
+
+## 6. Conclusion
+
+Overall, the findings of the current study revealed that patients' survival rate in the normal group after adjustment for ISS was higher than the neutropenia and neutrophilia groups. Also, the Cox model showed that the hazard ratio in the neutropenia group was 15 times higher than that of the normal group. Hence, fixing neutrophil disorder may plummet the hazard ratio in trauma patients. Indeed, one of the core findings of the current review is that the survival rate can be predicted using neutrophil count, which can be measured using a simple blood sample. In addition, neutrophil count could have a predictive value for the risk assessment of trauma patients. Moreover, we suggest neutrophil changes during patients' ICU hospitalization to be further investigated.
+
+## 7. Declarations 7.1. Acknowledgments
+
+This article was a part of Mohebat Vali's Ph.D. thesis, approved and financially supported by the Research Vice-chancellor of Shiraz University of Medical Sciences
+(grant No. 1400-10-5-23391). The Ethics Committee approved this study at Shiraz University of Medical Sciences
+(IR.SUMS.SCHEANUT.REC.1400.006). We would also like to express our special thanks to the efforts and cooperation of the staff of Rajaei Hospital, including Mrs. Mrs. Saadat Jo, Mrs. Shayan, and Mrs. Mohammadi who helped us a lot in collecting data.
+
+## 7.2. Competing Interests Statement
+
+The authors of this study declared no competing interests.
+
+## 7.3. Fundings And Supports
+
+This article was a part of Mohebat Vali's Ph.D. thesis, approved and financially supported by the Research Vicechancellor of Shiraz University of Medical Sciences (grant No.
+
+1400-10-5-23391).
+
+## 7.4. Authors' Contribution
+
+HG is the lead author and guarantor and contributed to interpreting the data and revising the manuscript. MV and SHP planned the study and led the drafting and revising of the manuscript. MV, MS, MH, SHP, PB and GS contributed to interpreting the data and drafting and revising the manuscript. All authors approved the submitted version of the manuscript. All authors have contributed to the preparation of the manuscript, have read, and approved the submitted manuscript. All authors listed meet the authorship criteria according to the latest guidelines of the International Committee of Medical Journal Editors and agree with the manuscript. The work is original and not under consideration by any other journal.
+
+## 7.5. Data Availability
+
+The data that support the findings of this study are available from the corresponding author, [HGH], upon reasonable request.
+
+## 7.6. Ethics Approval And Consent To Participate
+
+The Ethics Committee approved this study at Shiraz University of Medical Sciences
+(IR.SUMS.SCHEANUT.REC.1400.006). Informed consent was obtained from all subjects or their legal guardians to use their data for research.
+
+## References
+
+1. Lord JM, Midwinter MJ, Chen Y-F, Belli A, Brohi K, Kovacs EJ, et al. The systemic immune response to trauma:
+an overview of pathophysiology and treatment. Lancet.
+
+2014;384(9952):1455-65.
+
+2. Rossaint R, Bouillon B, Cerny V, Coats TJ, Duranteau J,
+Fernández-Mondéjar E, et al. Management of bleeding following major trauma: an updated European guideline.
+
+Crit Care. 2010;14:R52.
+
+3. Glance LG, Stone PW, Mukamel DB, Dick AW. Increases in mortality, length of stay, and cost associated with hospital-acquired infections in trauma patients. Arch Surg. 2011;146(7):794-801.
+
+4. Kobayashi SD, DeLeo FR. Role of neutrophils in innate immunity: a systems biology-level approach. Wiley Interdiscip Rev Syst Biol Med. 2009;1(3):309-33.
+
+5. Borregaard N. Neutrophils, from marrow to microbes.
+
+Immunity. 2010;33(5):657-70.
+
+6. Hellebrekers P, Hietbrink F, Vrisekoop N, Leenen LPH,
+Koenderman L. Neutrophil functional heterogeneity:
+identification of competitive phagocytosis. Front Immunol. 2017;8:1498.
+
+7. Tak T, Wijten P, Heeres M, Pickkers P, Scholten A, Heck AJR, et al. Human CD62Ldim neutrophils identified as a separate subset by proteome profiling and in vivo pulsechase labeling. Blood. 2017;129(26):3476-85.
+
+8. Hazeldine J, Hampson P, Lord JM. The impact of trauma on neutrophil function. Injury. 2014;45(12):1824-33.
+
+9. Junger WG, Rhind SG, Rizoli SB, Cuschieri J, Shiu MY, Baker AJ, et al. Resuscitation of traumatic hemorrhagic shock patients with hypertonic saline-without dextran-inhibits neutrophil and endothelial cell activation. Shock. 2012;38(4):341.
+
+10. Junger WG, Rhind SG, Rizoli SB, Cuschieri J, Baker AJ,
+Shek PN, et al. Pre-hospital hypertonic saline resuscitation attenuates the activation and promotes apoptosis of neutrophils in patients with severe traumatic brain injury. Shock. 2013;40(5):366.
+
+11. Kanyilmaz S, Hepguler S, Atamaz FC, Gokmen NM, Ardeniz O, Sin A. Phagocytic and oxidative burst activity of neutrophils in patients with spinal cord injury. Arch Phys Med Rehabil. 2013;94(2):369-74.
+
+12. Kinoshita M, Miyazaki H, Ono S, Inatsu A, Nakashima H,
+Tsujimoto H, et al. Enhancement of neutrophil function by interleukin-18 therapy protects burn-injured mice from methicillin-resistant Staphylococcus aureus. Infect Immun. 2011;79(7):2670-80.
+
+13. Kurihara T, Jones CN, Yu Y-M, Fischman AJ, Watada S,
+Tompkins RG, et al. Resolvin D2 restores neutrophil directionality and improves survival after burns. FASEB J.
+
+2013;27(6):2270.
+
+14. Liao Y, Liu P, Guo F, Zhang Z-Y, Zhang Z. Oxidative burst of circulating neutrophils following traumatic brain injury in human. PloS one. 2013;8(7):e68963.
+
+15. Wang X, Li Z-Y, Zeng L, Zhang A-Q, Pan W, Gu W, et al. Neutrophil CD64 expression as a diagnostic marker for sepsis in adult patients: a meta-analysis. Crit Care.
+
+2015;19:245.
+
+16. Morganti-Kossmann MC, Rancan M, Stahel PF, Kossmann T. Inflammatory response in acute traumatic brain injury: a double-edged sword. Curr Opin Crit Care.
+
+2002;8(2):101-5.
+
+17. Mortaz E, Zadian SS, Shahir M, Folkerts G, Garssen J, Mumby S, et al. Does neutrophil phenotype predict the survival of trauma patients? Front Immunol.
+
+2019;10:2122.
+
+18. Robertson CM, Coopersmith CM. The systemic inflammatory response syndrome. Microbes Infect.
+
+2006;8(5):1382-9.
+
+19. Tschoeke SK, Hellmuth M, Hostmann A, Ertel W, Oberholzer A. The early second hit in trauma management augments the proinflammatory immune response to multiple injuries. J Trauma. 2007;62(6):1396-404.
+
+20. Botha AJ, Moore FA, Moore EE, Peterson VM, Goode AW. Base deficit after major trauma directly relates to neutrophil CD11 b expression: a proposed mechanism of shock-induced organ injury. Intensive Care Med 1997;23(5):504-9.
+
+21. Hazeldine J, Naumann DN, Toman E, Davies D, Bishop JRB, Su Z, et al. Prehospital immune responses and development of multiple organ dysfunction syndrome following traumatic injury: A prospective cohort study. PLoS
+Med. 2017;14(7):e1002338.
+
+22. Spijkerman R, Hesselink L, Bongers S, van Wessem KJP,
+Vrisekoop N, Hietbrink F, et al. Point-of-Care Analysis of Neutrophil Phenotypes: A First Step Toward ImmunoBased Precision Medicine in the Trauma ICU. Crit Care Explor. 2020;2(7):e0158.
+
+23. Finlay LD, Conway Morris A, Deane AM, Wood AJ. Neutrophil kinetics and function after major trauma: A systematic review. World J Crit Care Med. 2021;10(5):260-77.
+
+24. Hesselink L, Spijkerman R, de Fraiture E, Bongers S, Van Wessem KJP, Vrisekoop N, et al. New automated analysis to monitor neutrophil function point-of-care in the intensive care unit after trauma. Intensive Care Med Exp.
+
+2020;8:12.
+
+25. Hesselink L, Spijkerman R, van Wessem KJP, Koenderman L, Leenen LPH, Huber-Lang M, et al. Neutrophil heterogeneity and its role in infectious complications after severe trauma. World J Emerg Surg. 2019;14:24.
+
+26. Hazeldine J, Hampson P, Lord JM. The impact of trauma on neutrophil function. Injury. 2014;45(12):1824-33.
+
+27. Lord JM, Midwinter MJ, Chen YF, Belli A, Brohi K, Kovacs EJ, et al. The systemic immune response to trauma:
+an overview of pathophysiology and treatment. Lancet.
+
+2014;384(9952):1455-65.
+
+28. Botha AJ, Moore FA, Moore EE, Sauaia A, Banerjee A, Peterson VM. Early neutrophil sequestration after injury:
+a pathogenic mechanism for multiple organ failure. J
+Trauma. 1995;39(3):411-7.
+
+29. Visser T, Pillay J, Koenderman L, Leenen LP. Postinjury immune monitoring: can multiple organ failure be predicted? Curr Opin Crit Care. 2008;14(6):666-72.
+
+30. Papia G, McLellan BA, El-Helou P, Louie M, Rachlis A,
+Szalai J-P, et al. Infection in hospitalized trauma patients:
+incidence, risk factors, and complications. J Trauma.
+
+1999;47(5):923.

medical/md/PMC10245687.md

@@ -0,0 +1,356 @@
+
+## Effects Of Junk-Food On Food-Motivated Behavior And Nac Glutamate Plasticity; Insights Into The Mechanism Of Nac Calcium-Permeable Ampa Receptor Recruitment
+
+Tracy L. Fetterly, Amanda M. Catalfio, and Carrie R. Ferrario∗
+Department of Pharmacology, University of Michigan, Ann Arbor, MI, 48109, USA
+In rats, eating obesogenic diets increase calcium-permeable AMPA receptor (CP-AMPAR) transmission in the nucleus accumbens (NAc) core, and enhances food-motivated behavior. Interestingly these diet-induced alterations in NAc transmission are pronounced in obesity-prone (OP) rats and absent in obesity-resistant (OR) populations. However, effects of diet manipulation on food motivation, and the mechanisms underlying NAc plasticity in OPs is unknown. Using male selectively-bred OP and OR rats, we assessed food-motivated behavior following ad lib access to chow (CH), junkfood (JF), or 10d of JF followed by a return to chow diet (JF-Dep). Behavioral tests included conditioned reinforcement, instrumental responding, and free consumption. Additionally, optogenetic, chemogenetic, and pharmacological approaches were used to examine NAc CP-AMPAR
+recruitment following diet manipulation and ex vivo treatment of brain slices. Motivation for food was greater in OP than OR rats, as expected. However, JF-Dep only produced enhancements in food-seeking in OP groups, while continuous JF access reduced food-seeking in both OPs and ORs.
+
+Reducing excitatory transmission in the NAc was sufficient to recruit CP-AMPARs to synapses in OPs, but not ORs. In OPs, JF-induced increases in CP-AMPARs occurred in mPFC-, but not BLA-to-NAc inputs. Diet differentially affects behavioral and neural plasticity in obesity susceptible populations. We also identify conditions for acute recruitment of NAc CP-AMPARs; these results suggest that synaptic scaling mechanisms contribute to NAc CP-AMPAR recruitment. Overall, this work improves our understanding of how sugary, fatty food consumption interacts with obesity susceptibility to influence food-motivated behavior. It also extends our fundamental understanding of NAc CP-AMPAR recruitment; this has important implications for motivation in the context of obesity as well as drug addiction.
+
+## I. Introduction
+
+As obesity rates continue to rise globally (Swinburn et al., 2011), it is increasingly important to understand the neural and behavioral consequences of over-consuming calorie-dense palatable foods. In humans, consumption of obesogenic diets (i.e., calorie dense, high-fat/high-sugar) alter the function of brain reward centers including the Nucleus Accumbens (NAc; Small, 2009; Horstmann et al., 2011; Stice et al., 2013; Volkow et al., 2013). Furthermore, greater activations in the NAc in response to food cues are observed in obesity-susceptible people before weigh gain (Demos et al., 2012; Murdaugh et al., 2012).
+
+These data highlight interactions between diet and obesitysusceptibility that contribute to over-eating and weight gain. However, our understanding of neurobehavioral differences in obesity-prone and -resistant populations is limited, and relatively little is known about how obesogenic diets affect NAc function and food-seeking behaviors.
+
+In rodents, consuming obesogenic diets produces a number of alterations in neuronal function (Ferrario et al.,
+2016), including enhancements in NAc dendritic spine density and excitatory transmission (Tukey et al., 2013; Counotte et al., 2014; Dingess et al., 2017), and decreases in dendritic spine density in the prefrontal cortex (PFC;
+Dingess et al., 2017). Furthermore, obesity-susceptible rats show enhanced diet-induced NAc glutamatergic plasticity, including potentiation of NAc glutamate synapses (Brown et al., 2017) and increased calcium-permeable AMPA receptor (CP-AMPAR) transmission (Oginsky et al., 2016; Alonso-Caraballo et al., 2021; Nieto et al., 2023). This suggests that that food-seeking and feeding behaviors that rely on the NAc may also be altered by obesogenic diets.
+
+Consistent with this, consumption of obesogenic foods enhances cue-triggered food-seeking (Dingess et al., 2017; Derman and Ferrario, 2018a). Activity of NAc CPAMPARs is required for the expression of cue-triggered food-seeking (Crombag et al., 2008; Derman and Ferrario, 2018b) and increases in NAc CP-AMPAR expression are associated with enhancements in this behavior in obesityprone, but not obesity-resistant rats. However, results describing how eating obesogenic foods alter the willingness to work for food are mixed, with both enhancements and reductions reported (Finger et al., 2012; MatikainenAnkney et al., 2023). Thus, there is a need to further tease apart factors that influence food motivated behavior in states of over-abundance and obesity. In addition, despite established differences in NAc function and incentivemotivation in obesity-prone vs -resistant populations, how obesity susceptibility interacts with diet to alter food motivation and NAc glutamatergic plasticity is unclear.
+
+Here we examined how eating a sugary, fatty "junkfood" (JF) diet affects several key aspects of food-seeking and feeding behavior. This was done both while rats were maintained on this diet, and after a brief JF "deprivation" period (JF-Dep) during which rats only have access to ad lib standard lab chow. Additionally, to further our understanding of the mechanisms underlying CP-AMPAR recruitment during JF-Dep, we investigated the conditions that permit increases in NAc CP-AMPAR transmission.
+
+Given that the medial PFC (mPFC) and basolateral amygdala (BLA) send direct glutamatergic projections to the NAc and are both involved in food-seeking behavior (Cardinal et al., 2002; Holland and Petrovich, 2005; Christoffel et al., 2021), we also determined the input specificity of CP-AMPAR upregulation.
+
+## Ii. Methods
+
+Animals: Male obesity-prone (OP) and obesityresistant (OR) rats bred in house (50-60 days old at the start of each study) were used (Levin et al., 1997).
+
+Rats were singly housed for behavior experiments and pair-housed for electrophysiology experiments (reverse 12h light/dark cycle). Procedures were approved by The University of Michigan Committee on the Use and Care of Animals in accordance with AAALAC guidelines.
+
+Food and Weight: Rats were weighed daily unless otherwise specified and home cage food intake was measured throughout. Chow (CH) controls were maintained on standard lab chow (Lab Diet 5L0D: 4 kcal/g; 13.6% fat, 28.9%
+protein, 57.5% carbohydrates; % of caloric content), while experimental junk-food (JF) groups were given free access to JF made in house (Oginsky et al., 2016; Robinson et al.,
+2015; 4.5 kcal/g; 19.6% fat, 14% protein, and 48% carbohydrates). This JF diet was a mash of Ruffle potato chips
+(40g), Chips Ahoy (130g), Nesquik (130g), Jiff peanut butter (130g), powdered Lab Diet 5L0D (200g) and 180mL of water. JF Deprivation (JF-Dep) consisted of removing JF
+from the home cage and returning rats to free-access standard lab chow.
+
+Behavior: All behavioral testing was conducted in standard operant boxes within sound attenuating chambers
+(Med Associates; one session/day). A general description of each experiment is given first followed by details of each behavioral approach.
+
+Experiment 1: Effects of junk-food and junk-food deprivation in OP rats. OP rats were food restricted (85-90%
+free-feeding bodyweight) and given 12 Pavlovian Conditioning sessions. Rats were then assigned to chow, JF and JF-Dep groups counterbalanced by behavior during the final three conditioning sessions; they had ad lib access to food for the remainder of the study. Next, rats underwent a single conditioned reinforcement test session followed by instrumental training and testing. Finally, rats underwent free-consumption testing (see timeline Fig. 1A).
+
+Experiment 2: Effects of junk-food and junk-food deprivation in OP vs OR rats. OP and OR rats were assigned to diet groups counterbalanced by starting weight within strain and had ad lib access to food throughout. Following diet manipulation, rats underwent instrumental training and testing (see timeline Fig. 2A).
+
+Pavlovian Conditioning: Procedures were adapted from
+(Holland et al., 2002 and Petrovich et al. 2002). A
+white nose and a tone were used, counter-balanced across CS+/CS- assignment. Rats first underwent two sessions where presentation of one cue (CS+, 10s, 8 presentations/session) was followed by delivery of two food pellets (45 mg, Bioserv, \#F0059, banana; 6.3% fat, 20.2% protein, 52% carbohydrates; % of caloric content). Next rats were given ten discrimination sessions where presentation of a second cue (CS-, 10s) that was never paired with food pellets was interspersed with CS+ presentations (4 CS+, 4 CS-, 8 presentations total; inter-trial-interval [ITI] 2-6 min, 32 min/session). Entries into the food cup during CS presentations and the ITI were recorded throughout.
+
+Conditioned Reinforcement Test: Conditioned reinforcement for the CS+ was assessed in a single session (30 min, Robinson et al., 2015). Responses in one nosepoke port
+(active) resulted in CS+ presentation (3s), but no food pellets. Responses in the other port (inactive) produced no outcome. Active and inactive responses were recorded throughout.
+
+Instrumental Training and Testing: Rats were trained to press one lever (active) to obtain the same food pellet used above (fixed ratio 1; FR1, 30 min/session). A second lever (inactive) was present but had no consequences.
+
+Rats had three FR1 training sessions followed by three progressive ratio (PR) testing sessions. During each PR
+session the number of active lever presses required to obtain each subsequent food pellet delivery increased exponentially (5e(delivery\#X0.2)-5), adapted from Richardson and Roberts (1996). The PR session ended when rats did not meet the next ratio requirement within 30 min (i.e.,
+breakpoint).
+
+Free Pellet Consumption: Rats underwent two free pellet consumption tests (30 min/session). During each test, rats were placed in the operant box and allowed to freely consume food pellets that had been placed in the food cup.
+
+The first test occurred under ad lib fed conditions, whereas the second occurred following a 4.5h home-cage food restriction period (no food in cage). The total number of pellets consumed during each session was measured.
+
+Electrophysiology: Surgeries and Viral Microinjection: Rats were anesthetized with isoflurane and injected intracranially with AAV constructs expressing either Chronos or hM4D(Gi)-DREADD (500 nL/hemisphere; 1µL/min). The analgesic carprofen (2.5 mg/kg, i.p.) was administered at the time of surgery and once every 24h for 48h following surgery. For optical stimulation experiments, pAAV-Syn-Chronos-GFP (Addgene viral prep 59170- AAV1; http://n2t.net/addgene:59170; RRID:Addgene 59170; gifted by E. Boyden) was infused into either the mPFC or BLA (mPFC: AP +3.00, ML +/- 0.60, DV -3.0; BLA: AP -2.28, ML +/- 5.00, DV -7.2). For DREADD
+experiments, pAAV-Syn-hM4D(Gi)-mCherry (Addgene viral prep 50475-AAV8; http://n2t.net/addgene:50475; RRID:Addgene 50475; gifted by B. Roth) was infused into the mPFC. Controls for DREADD studies were injected with either the pAAV-Syn-Chronos-GFP or pAAV-SynmCherry. Electrophysiological recordings were made from these rats 3-4 weeks after surgery.
+
+Whole-Cell, Voltage-Clamp Recordings: All reagents were purchased from Millipore Sigma unless otherwise noted. Brain slices containing the NAc (bregma +0.962.52) were prepared as previously described (Oginsky et al., 2016; Fetterly et al. 2021). Briefly, coronal sections (300 µ) were prepared using a vibratome (Lecia Biosystems).
+
+Slices recovered in oxygenated artificial cerebrospinal fluid
+(aCSF; in mM: 122.5 NaCl, 25 NaHCO3, 12.5 Glucose, 1 NaH2PO4, 1 L-ascorbic acid, 2.5 KCl, 2.5 CaCl2, 1 MgCl2; 295-305 mOsm, pH 7.45) at 37ºC for 30 min.
+
+Established whole-cell patch-clamping approaches were used (Oginsky et al., 2016, Alonso-Caraballo et al., 2021).
+
+All recordings were made using Clampex 10.7-11.1 and analyzed using Clampfit 10.7-11.1 (Molecular Devices).
+
+Patch pipettes were pulled from 1.5 mm borosilicate glass capillaries (WPI; 3-7 MΩ resistance) and filled with a solution containing (in mM): 140 CsCl, 10 HEPES, 2 MgCL2, 5 Na+-ATP, 0.6, Na+-GTP, 2 QX314; 285 mOsm; pH 7.3.
+
+Whole-cell voltage-clamp recordings of AMPA receptormediated EPSCs were made at -70 mV in the presence of picrotoxin (50 µM). Electrically evoked EPSCs (eEP-
+SCs) were elicited by local stimulation (0.05 to 0.30 mA
+square pulses, 0.1 ms, delivered every 20s) using a bipolar electrode placed 300 µm lateral to recorded neurons. Optically evoked EPSCs (oEPSCs) were elicited under the control of a CoolLED pE-300ultra and passed through a LEDFITC-A-OMF filter cube to produce blue wavelength light
+(0.2 ms, delivered every 20s). Epifluorescent images were used to confirm injection sites prior to recording (Olympus, BX43 with X-Cite LED). The minimum amount of current or light intensity needed to elicit a synaptic response with <15% variability in amplitude was used. Cells for which access resistance changed by >20% across the recording were discarded. EPSCs were recorded before and after application of the CP-AMPAR selective antagonist Naspm (200µM; as in Conrad et al., 2018; Oginsky et al., 2016) to measure CP-AMPAR mediated transmission, or Clozapine-N-Oxide (CNO; 10µM; as in Fetterly et al., 2019) to activate DREADDs. For ex vivo studies of CP-AMPAR recruitment, slices were incubated in oxygenated aCSF containing either CNO (10µM) or the NMDAR antagonist (2R)-amino-5-phosphonovaleric acid
+(APV; 50µM) for at least two hours before recordings began. All stock drug solutions were diluted in ddH2O, except for picrotoxin and CNO (diluted in DMSO).
+
+Statistical Analysis: One-tailed or two-tailed t-tests, one-way, two-way, or three-way ANOVAs were used.
+
+Sidak's multiple comparisons were used for post-hoc analysis (GraphPad Prism 9). Comparisons were made between OP, OR and diet groups within each experiment. All Ns are given in the figure captions. Data in all figures are shown as average ± SEM.
+
+## Iii. Results A. Effects Of Junk-Food And Junk-Food Deprivation In Op Rats.
+
+After Pavlovian conditioning rats were separated into chow (CH), junk-food (JF), and JF-deprivation (JF-Dep)
+groups (Figure 1A). Rats discriminated between the CS+
+and CS-, making more entries into the food cup during CS+ vs CS- presentations (Figure 1B; main effect of cue, F(1,76)=102.4, p<0.0001; session X cue interaction, F(9,684)=25.06, p<0.0001). Rats were then given a single conditioned reinforcement test after 10 days of JF, or 10 days of JF plus 24h of JF-Dep; controls remained on chow throughout (Figure 1A). All groups showed conditioned reinforcement, responding more in the active vs inactive port to receive a presentation of the CS+ (data not shown:
+main effect of port, F(1,72)=38.72, p<0.0001). To simplify comparisons, the magnitude of conditioned reinforcement (active responses - inactive responses) was compared across groups (Figure 1C). All groups showed similar motivation to work for presentations of the CS+ alone (no effect of diet group, F(2,36)=1.46, p=0.24).
+
+We next evaluated instrumental responding in these same rats (Figure 1D). During training, all groups responded preferentially on the active vs inactive lever and inactive responses were low and stable throughout (Figure 1D; main effect of lever, CH: F(1,24)=247.9, p<0.0001, JF: F(1,24)=83.67, p<0.0001, JF-Dep: F(1,24)=111.3, p<0.0001). In addition, the magnitude of active responding differed across groups, with JF rats responding the least and JF-Dep responding the most across all three sessions (Figure 1D; active responses: main effect of diet group, F(2,36)=12.44, p<0.0001). Motivation to work for the food pellets was assessed in three PR testing sessions. Behavior was stable across these tests (Figure 1E; no effect of session, F(1.724,62.06)=0.99, p=0.36). Similar to FR1 training, breakpoint was reduced in JF vs both CH and JF-Dep groups (Figure 1E; main effect of diet group, F(2,36)=8.57, p=0.0009; no group X session interaction, F(4,72)=0.59, p=0.67). Interestingly, during the first PR session the number of food cup entries was greater in the JF-Dep group compared to the CH group (Figure 1F; main effect of diet group, F(2,36)=10.95, p=0.0002; post-test: CH vs JF-Dep, p=0.05), even though breakpoints were similar across these groups. Thus, rats in the JF-Dep group show greater instrumental responding during FR1 testing, and increased food-seeking (i.e., food cup entries) during the first PR session.
+
+Figure 1G shows pellet consumption during free access testing when rats were fed ad lib or following a 4.5hr food restriction period. Pellet consumption did not robustly differ across diet groups when rats were tested in the ad lib state. Thus, lower responding during FR1 and PR sessions in the JF group is not likely due to reductions in value of the food pellets per se. Food restriction increased pellet consumption in CH and JF-Dep groups (Figure 1G;
+main effect of state, F(1,36)=32.53, p<0.0001; diet group x state interaction, F(2,36)=9.78, p=0.0004; post-test ad lib vs. restricted: CH, p=0.0013; JF-Dep, p<0.0001). However, no such effect of food restriction was found in the JF
+group (post-test ad lib vs fasted: p=0.99). In addition, the JF-Dep group consumed significantly more pellets than either the CH or JF-Dep group when tested following food restriction (post-test: CH vs JF-Dep, p=0.015; JF vs JFDep, p<0.0001). These results are consistent with greater instrumental responding in the JF-Dep group when effort is relatively low (Figure 1D) and with enhanced food cup entries during the first PR test (Figure 1F).
+
+## B. Effects Of Junk-Food And Junk-Food Deprivation In Obesity-Prone Vs Obesity-Resistant Rats
+
+We next compared effects of JF and JF-Dep on instrumental responding in OP and OR rats. After two days of JF-Dep, all rats began instrumental training (Figure 2A). All groups responded preferentially on the active vs inactive lever and inactive responses were low and stable throughout (Figure 2B-D; main effect of lever, CH:
+F(1,22)=25.42, p<0.0001, JF: F(1,22)=13.44, p=0.0014, JFDep: F(1,22)=16.65, p=0.0005). The OP-CH group made more active responses than OR-CH (Figure 2B; session X
+strain interaction, F(6,132)=2.43, p=0.029). Although active responding was generally lower in JF groups, the pattern of greater responding in OP vs OR groups persisted
+(Figure 2C: session X strain interaction, F(6,132)=3.03, p=0.0083). This pattern was disrupted by JF-Dep, with increased active responding in earlier sessions, and less separation between OPs and ORs (Figure 2D). Within session active responses during the initial acquisition period for OR (A-D) and OP (E-H) groups are shown in Figure 3. For OR rats, elevations in active made available under aCC-BY-NC 4.0 International license.
+
+![3_image_0.png](3_image_0.png)
+
+![3_image_1.png](3_image_1.png) 
+
+4
+
+![4_image_0.png](4_image_0.png) 
+
+responding begin to emerge by the fourth training session, with visually greater responding in OR-CH and ORJF-Dep groups as compared to OR-JF (Figure 3D). Active responding in OR-CH and OR-JF-Dep groups was similar and remained fairly stable throughout the session (Figure 3D, Session 4: no time X diet interaction, F(10,165)=1.18, p=0.31). In contrast, increased responding in the OP-JF-Dep group was present even during the first session compared to OP-CH and OP-JF groups (Figure 3E: main effect of diet F(2,33)=3.45, p=0.044, main effect of time, F(2.757,90.98)=3.26, p=0.028, time X diet interaction, F(10,165)=2.22, p=0.019). This same general pattern is seen in sessions two and three (Figure 3F,G). In addition, active responding in the OP-JF-Dep group was greater early vs late within training sessions two through four. Indeed, by session four, responding is fairly consistent across time in OP-CH and OP-JF groups (similar to the OR rats),
+while responding in the OP-JF-Dep group was significantly greater early in the session, and declined across time (Figure 3H: main effect of time, F(2.08,68.65)=7.63, p=0.00009, time X diet interaction, F(10,165)=2.33, p=0.013). Thus overall, OPs with a history of JF-Dep showed greater active lever responding than OP-CH and OP-JF groups, an effect that was not seen in the ORs.
+
+Figure 4 shows food intake (A,B) and weight gain (C,D)
+for rats in Experiment 1 (upper graphs) and Experiment 2 (lower graphs). The dotted line indicates when rats in the JF-Dep group were placed back on ad lib chow. For both experiments, rats given free access to JF consumed more food than those given free access to chow (Figure 4A:
+main effect of diet, F(2,36)=6.81; Figure 4B: main effect of diet, OR: F(2,33)=13.50, p<0.0001, OP: F(2,33)=16.53, p<0.0001). In addition, there were no differences in food intake between OP-JF and OR-JF groups across 10 days of JF exposure (Figure 4B: no effect of strain, CH:
+F(1,22)=0.51, p=0.48, JF: F(1,22)=0.13, p=0.72, JF-Dep: F(1,22)=0.086, p=0.77), and food intake dropped briefly when rats in the JF groups were placed back on ad lib chow. In regard to weight gain, for both experiments, rats in the JF group gained significantly more weight than those in the chow groups (Figure 4C: main effect of diet group, F(2,36)=6.65, p=0.0035; diet group X time interaction, F(46,828)=10.17, p<0.0001; Figure 4D: main effect of diet group, OR: F(2,33)=10.70, p=0.003, OP: F(2,33)=16.65, p<0.0001; main effect of time, OR: F(1.378,45.46)=810.2, p<0.0001, OP: F(1.435,47.37)=937.0, p<0.0001; diet group X time interaction, OR: F(36,594)=7.61, p<0.0001, OP: F(36,594)=13.06, p<0.0001 ). As expected, weight gain in the OP-JF-Dep group was similar to OP-CH controls by the end of the study (Figure 4C: Sidak's post-test; Day 35, CH vs. JF-Dep, p=0.13), whereas the OP-JF group gained more weight than OP-CH (**=Sidak's post-test, Day 35, CH vs JF, p=0.0013). Finally, in Experiment 2, OP rats gained more weight than OR rats, regardless of diet group (Figure 4D: main effect of diet, CH:
+F(1,22)=13.00, p=0.0016, JF: F(1,22)=12.56, p=0.0018, JFDep: F(1,22)=6.02, p=0.023; Sidak's post-test Day 18: OPCH vs OP-JF: p<0.0001), although the OR-JF group did 5 gain more weight than the OR-CH group (Sidak's post-test Day 18: OR-CH vs OR-JF p=0.0024). Overall, differences in food-intake and weight gain did not correspond to behavioral differences between experimental groups and chow controls, or between OP and OR rats.
+
+## C. Recruitment Of Nac Cp-Ampars And Input Specificity
+
+The same JF-Dep manipulation used above results in increases in NAc CP-AMPAR transmission in OP but not OR rats, and a JF deprivation period is necessary for this increase (Oginsky et al., 2016; Alonso-Caraballo et al.,
+2021). Synaptic recruitment of CP-AMPARs can be induced by prolonged reductions in excitatory transmission via synaptic scaling mechanisms in other neuronal systems
+(Turrigiano et al., 1998; Ju et al., 2004; Sutton et al., 2006).
+
+Therefore, we next determined whether incubating slices containing the NAc in the NMDAR antagonist APV was sufficient to recruit CP-AMPARs to synapses (Figure 5A).
+
+In slices from OP rats, APV incubation increased the sensitivity to Naspm in both chow and JF groups (Figure 5BC: main effect of slice treatment, F(1,38)=11.76, p=0.0015; no main effect of group, F(1,38)=0.33, p=0.57; no group X treatment interaction, F(1,38)=0.00024, p=0.99). In contrast, APV incubation of slices from ORs did not alter Naspm sensitivity (Figure 5D-E: t(13)=0.26, p=0.79).
+
+Thus, dampening excitatory transmission was sufficient to increase NAc synaptic CP-AMPAR transmission in OP but not in OR rats; this effect was similar in slices from OP-CH
+and OP-JF groups.
+
+We next identified which synaptic inputs CP-AMPAR
+transmission is enhanced in by comparing the effects of JF-Dep in mPFC or BLA inputs to the NAc using optogenetics combined with Naspm sensitivity (Figure 6A). Figure 6A shows an example of viral expression within mPFC
+and BLA. Figure 6B,C show data from oEPSCs in mPFCto-NAc inputs. Naspm sensitivity of mPFC-to-NAc inputs was increased only in the OP-JF-Dep group (Figure 6B-C: main effect of strain, F(1,32)=8.64, p=0.0061; OPCH vs OP-JF-Dep: t(22)=2.25, p=0.017, OR-CH vs ORJF-Dep: t(10)=0.61, p=0.28, based on a priori planned comparisons). Figure 5D,E show data from oEPSCs in BLA-to-NAc inputs. Interestingly, no effects of JF-Dep were found in BLA-to-NAc inputs (Figure 6E: no effect of strain, F(1,24)=0.012, p=0.91, no effect of diet group, F(1,24)=0.31, p=0.58, no group X strain interaction, F(1,24)=1.30, p=0.27).
+
+Given that CP-AMPAR increases occur in mPFC-toNAc synapses following JF-Dep in OPs, and that reducing excitatory transmission was sufficient to increase NAc CP-AMPAR transmission, we next determined whether reducing activity of mPFC terminals within the NAc was sufficient to recruit CP-AMPARs. This was accomplished by expressing a Gi-coupled DREADD (hM4D(Gi)) in the mPFC and bath applying the agonist CNO to coronal slices containing the NAc and mPFC terminals. Figure 7A shows an example of viral expression within mPFC. Slices from one hemisphere were incubated in CNO while slices from the opposite hemisphere of the same rat were incubated in vehicle aCSF. This allowed for comparison of CNO effects within the same set of slices. CNO incubation increased Naspm sensitivity of the eEPSC amplitude compared to vehicle aCSF (Figure 7B: t(5)=4.14, p=0.0045), suggesting that reducing activity of mPFC terminals within the NAc is sufficient to increase synaptic CP-AMPAR transmission.
+
+To verify that CNO does not alter eEPSC amplitude on its own, and that activating hM4D(Gi) receptors on mPFC
+terminals in NAc slices decreases synaptic activity, control recordings in slices with and without hM4D(Gi)-expression were conducted. Acute CNO wash-on produced small, but significant reductions in eEPSC amplitude in slices expressing hM4D(Gi), but not in control slices (Figure 7C: main effect of time, F(3.648,47.42)=2.72, p=0.045, time X viral injection interaction, F(9,117))=2.43, p=0.014).
+
+## Iv. Discussion
+
+We examined interactions between susceptibility to obesity and diet-induced neuronal and behavioral plasticity using established OP and OR models. Continuous junkfood access reduced food-seeking in both OPs and ORs, whereas consumption of junk-food followed by a period of deprivation (JF-Dep) enhanced food-seeking only in OPs.
+
+The persistence of behavioral effects beyond the removal of junk-food is consistent with long-lasting diet-induced neuroplasticity. Furthermore, we found that NAc CP-AMPAR
+increases induced by JF-Dep occur in mPFC, but not BLA, inputs to the NAc. Additionally, decreasing excitatory transmission by blocking NMDARs, or reducing activity of mPFC-to-NAc inputs ex vivo was sufficient to increase NAc CP-AMPAR transmission in OPs. These data highlight behavioral and physiological changes that may contribute to diet-induced obesity and provide insights into the mechanism of NAc CP-AMPAR recruitment.
+
+## A. Effects Of Junk-Food Consumption On Behavior
+
+In OP rats, consumption of JF did not alter willingness to respond for the presentation of a food cue (Figure 1C) compared to CH controls. Yet in these same rats, instrumental responding for food pellets was reduced compared to CH controls (Figure1 D,E). This dichotomy of sustained responsivity to the food cue itself despite decreased motivation to work for food is consistent with results from outbred male rats where junk-food consumption enhances conditioned approach, without altering cue potentiated feeding (Derman and Ferrario, 2018a). Furthermore, junk-food-induced reductions in motivation for food in OPs was not related to lower motivational value of the food pellets per se, as rats in the junk-food group consumed similar amounts of these pellets as chow controls during free consumption testing (Figure 1G, ad lib). When OP and OR groups were studied side-by-side (Figure 2A),
+responding was generally greater in OPs than ORs, and was reduced by junk-food diet in both groups (Figure 2). Thus, despite general enhancements in motivation in OPs vs ORs, both groups were able to adjust their behavior in response to their dietary environment, working less for food pellets when JF was freely available in the home cage.
+
+![6_image_0.png](6_image_0.png) 
+
+## B. Effects Of Junk-Food Deprivation On Behavior
+
+In Experiment 1, active lever responding was higher in OPs with a history of JF-Dep compared to OP-CH controls (Figure 1D). In addition, despite reaching equivalent breakpoints to the OP-CH group during PR testing, the OP-JF-Dep group had more entries into the food cup during the first PR session (Figure1F). This enhanced checking behavior is consistent with enhancements in motivation, although this difference did not persist during subsequent PR testing. Furthermore, when OP and ORs were tested side-by-side, we again found evidence for enhancements in motivation following JF-Dep only in OPs. Specifically, throughout FR1 training, active lever responding was indistinguishable between OR-JF-Dep and OR-CH controls (Figure 3A-D). In contrast, the OP-JF-Dep group showed elevated active lever responding during FR1 training that was largely due to the emergence of increased active responding earlier in training compared to all other groups (Figure 3E-H). Thus, when the overall effort to obtain food was relatively low, OPs that underwent JF-Dep showed more rapid acquisition of instrumental responding than their CH counterparts. Finally, when free pellet consumption was measured after food restriction, the OP-JFDep group also showed the greatest increase, consuming even more pellets than OPs maintained on chow (Figure 1G). This difference cannot be attributed to weight gain, as both the OP-CH and OP-JF-Dep groups gained a similar amount of weight across the study (Figure 4). In addition, these shifts in motivation and the regulation of food intake occurred when home cage food access during the deprivation period was unrestricted and was similar to food intake of chow controls (Figure 4). These aspects, in combination with effects of JF-Dep on neural function (discussed below), point to potential antecedents of obesity and have implications for the relatively poor long-term outcomes of current behavioral weight-loss strategies.
+
+## C. Recruitment Of Nac Cp-Ampars
+
+CP-AMPARs have largely been studied in the context of drugs of abuse, fear conditioning, and neurodegeneration
+(Clem and Huganir, 2010; Wolf and Tseng, 2012; Dong et al., 2017; Guo and Ma, 2021), and have roles in both Hebbian and homeostatic plasticity (Man, 2011). For example, activity of NAc CP-AMPARs is required for cuetriggered food- and drug-seeking (Conrad et al., 2008; Derman and Ferrario, 2018b). Yet to date, mechanisms specific to the recruitment of NAc CP-AMPARs (which lack the GluA2 subunit) vs 'traditional' calcium-impermeableAMPARs (CI-AMPARs), which contain the GluA2 subunit, have not been identified (Werner et al., 2017). Here, we found that decreasing synaptic activity via inhibition of NMDARs (>2h APV treatment) was sufficient to recruit CP-AMPARs in the NAc of OPs, but not ORs (Figure 5).
+
+This is reminiscent of homeostatic plasticity in cultured neurons that involves the "scaling up" of AMPARs in response to prolonged decreases in excitatory transmission
+(i.e., synaptic scaling), discussed further below.
+
+With this in mind, we hypothesized that NAc core CPAMPAR increases that occur following a necessary period of JF deprivation (Alonso-Caraballo et al., 2021) may result from reductions in excitatory input to the NAc. To 7
+
+![7_image_0.png](7_image_0.png) 
+
+pursue this idea, we first identified which synaptic inputs CP-AMPAR transmission is enhanced in using an optogenetic approach. We focused on mPFC-to-NAc and BLA-to-NAc inputs because these provide direct inputs to the NAc core and because these regions influence foodmotivated behavior via interactions with the NAc (Cardinal et al., 2002; Holland and Petrovich, 2005; Christoffel et al., 2021). CP-AMPAR increases following JF-Dep were found at mPFC-to-NAc, but not BLA-to-NAc, synapses
+(Figure 6). This is consistent with diet-induced plasticity in the mPFC (Dingess et al., 2017; Reichelt et al., 2019).
+
+We next expressed a Gi-coupled DREADD in the mPFC
+and activated these receptors located in mPFC terminals in the NAc by incubating slices from OPs in CNO (Figure 7A; ORs were not included because neither JF-Dep nor APV treatment altered their NAc CP-AMPAR transmission). We found that CNO treatment increased CPAMPAR transmission compared to treatment of slices from the same rat with vehicle (Figure 7B). Control recordings performed by washing CNO onto slices with and without DREADD expression confirmed that DREADD activation results in a small, but significant decrease in AMPARmediated transmission. Thus, a relatively brief reduction in activity of mPFC-to-NAc inputs was sufficient to support synaptic "scaling-up" of CP-AMPARs. Synaptic scaling in the NAc has been demonstrated using an NAc/mPFC neuronal co-culture system, however this involves increases in CI-AMPARs, not CP-AMPARs, induced by prolonged blockade (24-72h) of excitatory transmission by an AMPAR antagonist (Sun and Wolf, 2009; Werner et al., 2017). In hippocampal cultures, NMDAR blockade combined with action potential blockade is sufficient to recruit CP-AMPARs to synapses (Ju et al.,
+2004; Sutton et al., 2006), with some evidence that NMDAR blockade alone is sufficient (Sutton et al., 2006). To our knowledge, results here are the first demonstration of a similar acute effect in adult brain slices or within the NAc. Increases in CP-AMPAR transmission here occurred
+
+![8_image_0.png](8_image_0.png)
+
+![8_image_1.png](8_image_1.png) 
+
+![8_image_2.png](8_image_2.png)
+
+![8_image_5.png](8_image_5.png) 
+
+![8_image_4.png](8_image_4.png)
+
+D. Obesity-Resistant Timecourse E. Obesity-Resistant Naspm Sensitivity Naspm -80
+
+![8_image_6.png](8_image_6.png)
+
+![8_image_3.png](8_image_3.png) 
+
+within two hours of NMDAR blockade, consistent with the scaling observed in culture (Turrigiano et al., 1998; Sutton et al., 2006; Sutton and Schuman, 2006). While this is a relatively rapid effect, the timescale is long enough that recruitment of existing receptors or the addition of newly synthesized receptors into synapse could contribute; these two possibilities are not mutually exclusive. However, in favor of the latter, CP-AMPAR recruitment in cultured hippocampal neurons requires protein synthesis (Sutton et al., 2006), as does the maintenance of CP-AMPARs at synapses in adult NAc slices (Scheyer et al., 2014; see below for further discussion).
+
+The magnitude of APV-induced increases in CPAMPAR transmission here was similar in OP-CH and OPJF groups. This was unexpected, as we've previously found evidence for the extra-synaptic accumulation of CP-
+AMPARs in OPs maintained on junk-food (10d) vs chow.
+
+Thus, we predicted that the magnitude of CP-AMPAR increases would be greater in OP-JF vs OP-CH groups here.
+
+It is possible that NMDAR blockade resulted in a maximal recruitment of CP-AMPARs, masking group differences, or conversely that more time may be needed to observe group differences in synaptic CP-AMPAR recruitment. Regardless, the effect seen in the OP-CH group in light of the lack of recruitment seen in OR rats suggest inherent differences in the plasticity window between these populations. This is consistent with absence of diet-induced NAc AMPAR plasticity generally observed in OR rats (Oginsky et al.,
+2016; Ferrario, 2020).
+
+We do not know why CP-AMPAR plasticity occurs more readily in OPs than ORs. To date, no evidence for basal differences in NAc CP-AMPAR synaptic transmission be-
+
+FIG. 6: Junk-food deprivation increases CP-AMPAR transmission in mPFC-to-NAc, but not BLA-to-NAc, synapses. A) Schematic of experimental timeline. pAAV-Syn-Chronos-GFP was bilaterally infused into either the mPFC or BLA of obesity-prone (OP)
+and obesity-resistant (OR) rats. Rats were then given 2-3 weeks to recover and allow for viral expression before diet manipulation
+(Chow or JF-Dep). Slices were then prepared for electrophysiology using optical stimulation of mPFC or BLA inputs to the NAc core. B) Timecourse showing effects of bath application of the CP-AMPAR antagonist Naspm (200 µM) on oEPSC amplitude in mPFC-to-NAc synapses (OR: CH N=5,6 JF-Dep N=5,6; OP: CH N=6,9 JF-Dep OP N=9,15). C) Percent reduction in oEPSC
+amplitude following Naspm application (avg. of last two minutes of drug wash-on from B). JF-Dep increased Naspm sensitivity in mPFC-to-NAc synapses of OPs but not ORs (*p<0.05, OP-CH vs OP-JF-Dep: one-tailed t-test based on a priori planned comparisons). D) Timecourse showing effects of bath application of Naspm on oEPSC amplitude in BLA-to-NAc inputs (OR: CH N=4,8 JF-Dep OR N=4,7; OP: CH N=4,5 JF-Dep N=7,8). E) Percent reduction in oEPSC amplitude following Naspm application in BLA-to-NAc inputs (avg. of last two minutes of drug wash-on from D). JF-Dep did not alter CP-AMPAR transmission in BLAto-NAc inputs of OPs or ORs.
+
+made available under aCC-BY-NC 4.0 International license.
+
+![9_image_0.png](9_image_0.png)
+
+![9_image_2.png](9_image_2.png) 
+(%
+B
+
+a s elin e)
+
+![9_image_1.png](9_image_1.png)
+
+Naspm -80
+
+![9_image_3.png](9_image_3.png)
+
+![9_image_5.png](9_image_5.png) 
+
+D. BLA-to-NAc Timecourse E. BLA-to-NAc Naspm Sensitivity
+
+![9_image_4.png](9_image_4.png)
+
+![9_image_6.png](9_image_6.png) 
+
+![10_image_0.png](10_image_0.png)
+
+![10_image_1.png](10_image_1.png)
+
+![10_image_2.png](10_image_2.png) 
+
+tween these lines has been found (e.g., Figure 5,6; Oginsky et al., 2016), although floor effects could mask differences. However, basal NAc GluA1, but not GluA2, surface protein expression is lower in male OPs vs ORs (Derman and Ferrario, 2018b; Alonso-Caraballo et al., 2021) and basal intrinsic excitability of NAc medium spiny neurons is enhanced in OPs vs ORs (Oginsky et al., 2016; Oginsky and Ferrario, 2019). This combination may render OPs more sensitive to experience-induced plasticity. Finally, it's worthwhile to note that JF-Dep also enhances NAc CP-AMPAR transmission in female OPs but not ORs (Nieto et al., 2023). However, this increase is transient, in contrast to persistent effects observed in males (Oginsky et al., 2016; Alonso-Caraballo et al., 2021). Thus it will be important to examine females in future.
+
+D. Conclusions Overall, we find that a history of junk-food consumption and obesity-susceptibility interact to enhance foodmotivated behavior and recruit NAc CP-AMPARs. These data provide further evidence that interactions between predisposition and diet-induced neurobehavioral plasticity likely contribute to weight gain and the maintenance of obesity. In light of modern diet culture, these data also emphasize the importance of understanding lasting changes that occur after stopping a sugary, fatty diet and set the stage for future studies linking these synaptic changes to behavioral outcomes. Finally, these data reveal novel insights into the mechanisms underlying CP-AMPAR recruitment in the NAc that involve synaptic scaling mechanisms. This has important implications for both cuetriggered food- and potentially drug-seeking behaviors.
+
+## V. References 227:113114.
+
+Ferrario CR, Labou`ebe G, Liu S, Nieh EH, Routh VH, Xu S,
+O'Connor EC (2016) Homeostasis Meets Motivation in the Battle to Control Food Intake. J Neurosci 36:11469-11481.
+
+Fetterly TL, Oginsky MF, Nieto AM, Alonso-Caraballo Y,
+Santana-Rodriguez Z, Ferrario CR (2021) Insulin Bidirectionally Alters NAc Glutamatergic Transmission: Interactions between Insulin Receptor Activation, Endogenous Opioids, and Glutamate Release. J Neurosci 41:2360-2372.
+
+Fetterly TL, Basu A, Nabit BP, Awad E, Williford KM, Centanni SW, Matthews RT, Silberman Y, Winder DG (2019)
+α(2A)-Adrenergic Receptor Activation Decreases Parabrachial Nucleus Excitatory Drive onto BNST CRF Neurons and Reduces Their Activity In Vivo. J Neurosci 39:472-484.
+
+Finger BC, Dinan TG, Cryan JF (2012) Diet-induced obesity blunts the behavioural effects of ghrelin: studies in a mouseprogressive ratio task. Psychopharmacology (Berl) 220:173-181.
+
+Guo C, Ma YY (2021) Calcium Permeable-AMPA Receptors and Excitotoxicity in Neurological Disorders. Front Neural Circuits 15:711564. Holland PC, Petrovich GD (2005) A neural systems analysis of the potentiation of feeding by conditioned stimuli. Physiol Behav 86:747-761. Horstmann A, Busse FP, Mathar D, M¨uller K, Lepsien J, Schl¨ogl H, Kabisch S, Kratzsch J, Neumann J, Stumvoll M,
+Villringer A, Pleger B (2011) Obesity-Related Differences between Women and Men in Brain Structure and Goal-Directed Behavior. Front Hum Neurosci 5:58. Ju W, Morishita W, Tsui J, Gaietta G, Deerinck TJ, Adams SR, Garner CC, Tsien RY, Ellisman MH, Malenka RC (2004)
+Activity-dependent regulation of dendritic synthesis and trafficking of AMPA receptors. Nat Neurosci 7:244-253.
+
+Levin BE, Dunn-Meynell AA, Balkan B, Keesey RE (1997)
+Selective breeding for diet-induced obesity and resistance in Sprague-Dawley rats. Am J Physiol 273:R725-730. Man HY (2011) GluA2-lacking, calcium-permeable AMPA receptors–inducers of plasticity? Curr Opin Neurobiol 21:291298.
+
+Matikainen-Ankney BA, Legaria AA, Pan Y, Vachez YM, Murphy CA, Schaefer RF, McGrath QJ, Wang JG, Bluitt MN,
+Ankney KC, Norris AJ, Creed MC, Kravitz AV (2023) Nucleus Accumbens D(1) Receptor-Expressing Spiny Projection Neurons Control Food Motivation and Obesity. Biol Psychiatry 93:512-523.
+
+Murdaugh DL, Cox JE, Cook EW, 3rd, Weller RE (2012) fMRI
+reactivity to high-calorie food pictures predicts short- and longterm outcome in a weight-loss program. Neuroimage 59:27092721.
+
+Nieto AM, Catalfio AM, Papacostas Quintanilla H, AlonsoCaraballo Y, Ferrario CR (2023) Transient effects of junk food on NAc core MSN excitability and glutamatergic transmission in obesity-prone female rats. Obesity (Silver Spring) 31:434-445.
+
+Oginsky MF, Ferrario CR (2019) Eating "junk food" has opposite effects on intrinsic excitability of nucleus accumbens core neurons in obesity-susceptible versus -resistant rats. J Neurophysiol 122:1264-1273.
+
+Oginsky MF, Goforth PB, Nobile CW, Lopez-Santiago LF, Ferrario CR (2016) Eating 'Junk-Food' Produces Rapid and LongLasting Increases in NAc CP-AMPA Receptors: Implications for Enhanced Cue-Induced Motivation and Food Addiction. Neuropsychopharmacology 41:2977-2986.
+
+Alonso-Caraballo Y, Fetterly TL, Jorgensen ET, Nieto AM,
+Brown TE, Ferrario CR (2021) Sex specific effects of "junkfood" diet on calcium permeable AMPA receptors and silent synapses in the nucleus accumbens core. Neuropsychopharmacology 46:569-578.
+
+Brown RM, Kupchik YM, Spencer S, Garcia-Keller C, Spanswick DC, Lawrence AJ, Simonds SE, Schwartz DJ, Jordan KA, Jhou TC, Kalivas PW (2017) Addiction-like Synaptic Impairments in Diet-Induced Obesity. Biol Psychiatry 81:797-806.
+
+Cardinal RN, Parkinson JA, Hall J, Everitt BJ (2002) Emotion and motivation: the role of the amygdala, ventral striatum, and prefrontal cortex. Neurosci Biobehav Rev 26:321-352.
+
+Christoffel DJ, Walsh JJ, Heifets BD, Hoerbelt P, Neuner S,
+Sun G, Ravikumar VK, Wu H, Halpern CH, Malenka RC (2021)
+Input-specific modulation of murine nucleus accumbens differentially regulates hedonic feeding. Nat Commun 12:2135. Clem RL, Huganir RL (2010) Calcium-permeable AMPA receptor dynamics mediate fear memory erasure. Science 330:11081112.
+
+Conrad KL, Tseng KY, Uejima JL, Reimers JM, Heng LJ, Shaham Y, Marinelli M, Wolf ME (2008) Formation of accumbens GluR2-lacking AMPA receptors mediates incubation of cocaine craving. Nature 454:118-121.
+
+Counotte DS, Schiefer C, Shaham Y, O'Donnell P (2014) Timedependent decreases in nucleus accumbens AMPA/NMDA ratio and incubation of sucrose craving in adolescent and adult rats.
+
+Psychopharmacology (Berl) 231:1675-1684.
+
+Crombag HS, Sutton JM, Takamiya K, Holland PC, Gallagher M, Huganir RL (2008) A role for alpha-amino-3-hydroxy-5methylisoxazole-4-propionic acid GluR1 phosphorylation in the modulatory effects of appetitive reward cues on goal-directed behavior. Eur J Neurosci 27:3284-3291.
+
+Demos KE, Heatherton TF, Kelley WM (2012) Individual differences in nucleus accumbens activity to food and sexual images predict weight gain and sexual behavior. J Neurosci 32:5549-5552.
+
+Derman RC, Ferrario CR (2018a) Junk-food enhances conditioned food cup approach to a previously established food cue, but does not alter cue potentiated feeding; implications for the effects of palatable diets on incentive motivation. Physiol Behav 192:145-157.
+
+Derman RC, Ferrario CR (2018b) Enhanced incentive motivation in obesity-prone rats is mediated by NAc core CPAMPARs. Neuropharmacology 131:326-336.
+
+Derman RC, Bass CE, Ferrario CR (2020) Effects of hM4Di activation in CamKII basolateral amygdala neurons and CNO
+treatment on sensory-specific vs. general PIT: refining PIT circuits and considerations for using CNO. Psychopharmacology
+(Berl) 237:1249-1266.
+
+Dingess PM, Darling RA, Derman RC, Wulff SS, Hunter ML,
+Ferrario CR, Brown TE (2017) Structural and Functional Plasticity within the Nucleus Accumbens and Prefrontal Cortex Associated with Time-Dependent Increases in Food Cue-Seeking Behavior. Neuropsychopharmacology 42:2354-2364. Dong Y, Taylor JR, Wolf ME, Shaham Y (2017) Circuit and Synaptic Plasticity Mechanisms of Drug Relapse. J Neurosci 37:10867-10876. Ferrario CR (2020) Why did I eat that?
+
+Contributions of individual differences in incentive motivation and nucleus accumbens plasticity to obesity. Physiol Behav Reichelt AC, Gibson GD, Abbott KN, Hare DJ (2019) A highfat high-sugar diet in adolescent rats impairs social memory and alters chemical markers characteristic of atypical neuroplasticity and parvalbumin interneuron depletion in the medial prefrontal cortex. Food Funct 10:1985-1998.
+
+Richardson NI and Roberts DC (1996) Progressive ratio schedules in drug self-administration studies in rats: a method to evaluate reinforcing efficacy, J. Neurosci. Methods 66: 1–11.
+
+Robinson MJ, Burghardt PR, Patterson CM, Nobile CW, Akil H, Watson SJ, Berridge KC, Ferrario CR (2015) Individual Differences in Cue-Induced Motivation and Striatal Systems in Rats Susceptible to Diet-Induced Obesity. Neuropsychopharmacology 40:2113-2123.
+
+Scheyer AF, Wolf ME, Tseng KY (2014) A protein synthesisdependent mechanism sustains calcium-permeable AMPA receptor transmission in nucleus accumbens synapses during withdrawal from cocaine self-administration. J Neurosci 34:30953100.
+
+Small DM (2009) Individual differences in the neurophysiology of reward and the obesity epidemic. Int J Obes (Lond) 33 Suppl 2:S44-48.
+
+Stice E, Figlewicz DP, Gosnell BA, Levine AS, Pratt WE (2013)
+The contribution of brain reward circuits to the obesity epidemic. Neurosci Biobehav Rev 37:2047-2058.
+
+Sun X, Wolf ME (2009) Nucleus accumbens neurons exhibit synaptic scaling that is occluded by repeated dopamine preexposure. Eur J Neurosci 30:539-550.
+
+Sutton MA, Schuman EM (2006) Dendritic protein synthesis, synaptic plasticity, and memory. Cell 127:49-58. Sutton MA, Ito HT, Cressy P, Kempf C, Woo JC, Schuman EM (2006) Miniature neurotransmission stabilizes synaptic function via tonic suppression of local dendritic protein synthesis. Cell 125:785-799.
+
+Swinburn BA, Sacks G, Hall KD, McPherson K, Finegood DT,
+Moodie ML, Gortmaker SL (2011) The global obesity pandemic: shaped by global drivers and local environments. Lancet 378:804-814.
+
+Tukey DS et al. (2013) Sucrose ingestion induces rapid AMPA
+receptor trafficking. J Neurosci 33:6123-6132.
+
+Turrigiano GG, Leslie KR, Desai NS, Rutherford LC, Nelson SB (1998) Activity-dependent scaling of quantal amplitude in neocortical neurons. Nature 391:892-896. Volkow ND, Wang GJ, Tomasi D, Baler RD (2013) Obesity and addiction: neurobiological overlaps. Obes Rev 14:2-18.
+
+Werner CT, Murray CH, Reimers JM, Chauhan NM, Woo KK,
+Molla HM, Loweth JA, Wolf ME (2017) Trafficking of calciumpermeable and calcium-impermeable AMPA receptors in nucleus accumbens medium spiny neurons co-cultured with prefrontal cortex neurons. Neuropharmacology 116:224-232.
+
+Wolf ME, Tseng KY (2012) Calcium-permeable AMPA receptors in the VTA and nucleus accumbens after cocaine exposure:
+when, how, and why? Front Mol Neurosci 5:72.
+
+## Acknowledgments
+
+This work was supported in part by NIH grants R01DA044204, R01DK106188, R01DK115526, and R01DK130246 to CRF. TLF was supported by NIH grant T32DA007268. AMC was supported by NIH grant T32DA007281.
+
+## Author Contributions
+
+TLF designed and executed the experiments, analyzed data, and wrote this manuscript. AMC executed the experiments and wrote this manuscript. CRF designed experiments, analyzed data, and wrote this manuscript. All authors approved the final version of this work.
+
+## Disclosures
+
+The authors declare no competing financial interests.

medical/md/PMC10259600.md

@@ -0,0 +1,278 @@
+Open Access Full Text Article
+
+# O R I G I N A L R E S E A R C H Longitudinal Findings On The Oneiric Activity Changes Across The Pandemic
+
+Serena Scarpelli 1, Valentina Alfonsi 1, Milena Camaioni 1, Maurizio Gorgoni1,2, Antonio Albano3, Alessandro Musetti 4, Maria Catena Quattropani 5,6, Giuseppe Plazzi7,8, Luigi De Gennaro 1,2, Christian Franceschini 3 1Department of Psychology, University of Rome Sapienza, Rome, Italy; 2Body and Action Lab, IRCCS Fondazione Santa Lucia, Rome, Italy; 3Department of Medicine and Surgery, Faculty of Medicine and Surgery, University of Parma, Parma, Italy; 4Department of Humanities, Social Sciences and Cultural Industries, University of Parma, Parma, Italy; 5Department of Educational Sciences, University of Catania, Catania, Italy; 6Department of Clinical and Experimental Medicine, University of Messina, Messina, Italy; 7Department of Biomedical, Metabolic and Neural Sciences, University of Modena and Reggio Emilia, Modena, Italy; 8IRCCS Institute of Neurological Sciences, Bologna, Italy Correspondence: Serena Scarpelli, Department of Psychology, University of Rome Sapienza, Via dei Marsi 78, Rome, 00185, Italy, Tel +39 06 49917508, Email serena.scarpelli@uniroma1.it Purpose: COVID-19 pandemic waves have strongly influenced individuals' behaviors and mental health. Here, we analyzed longitudinal data collected in the Spring 2020 and 2021 from a large Italian sample with the aim of assessing changes in dream features between the first and third wave. Specifically, we evaluated the modifications of pandemic dream activity as a function of the general distress variations over time. Also, we detected the best explanatory variables of nightmare frequency and distress.
+
+Materials and Methods: Participants previously involved in the web survey during the first wave of the pandemic were asked to complete a new online survey on sleep and dream features available in Spring 2021 (N=728). Subjects decreasing their level of psychological general distress in the third (T3) vs the first (T1) pandemic wave were defined as "Improved" (N=330). In contrast, participants with an unchanged or increased level of general distress were defined as "Not Improved" (N=398).
+
+Results: Statistical comparisons revealed that dream recall frequency, nightmare frequency, lucid dream frequency, and emotional intensity show a reduction in T3 than T1. Moreover, the Improved group is characterized by lower nightmare rate and nightmare distress than Not Improved people. Our findings confirmed that beyond the trait-like variables (ie, age, sex), specific sleep-related measures are related to nightmare features. In particular, poor sleep hygiene was one of the best determinants of nightmare distress among Not Improved subjects.
+
+Conclusion: Our findings revealed that people experienced an adaptation to the pandemic during the third wave. We also strengthen the notion that nightmares and their variations over time are strongly related to human well-being, suggesting that specific trait-like and sleep-related factors could modulate the relationship between mental health and nightmare features.
+
+Keywords: nightmare, distress, sleep, pandemic, third wave, clinical psychology
+
+## Introduction
+
+Different waves of the Coronavirus disease 2019 (COVID-19) pandemic have occurred in Italy since March 2020, strongly influencing the lifestyle of people.1 During the first wave (T1, Spring 2020), the Italian government, according to other European countries, adopted restrictive measures involving home confinement and social distancing in all Italian regions. During the second and third waves, which occurred, respectively, in Autumn 20202 (T2) and Winter-Spring 20213 (T3), restrictive measures were re-adopted taking into consideration the different levels of contagion risk and pressure on the local healthcare system in each region. Both these periods could be considered a "partial-lockdown".
+
+Many findings from various countries highlighted that both mental health and sleep have been particularly affected by the pandemic.4–6 Moreover, dream activity has been examined in different moments of the pandemic showing important changes in parallel to sleep alterations and mental health conditions.7 A group of studies compared pandemic-related changes in the oneiric activity with a pre-pandemic condition.7 The most reported result concerned the increased dream recall frequency during the first wave/lockdown period compared with the non-pandemic period in both healthy adults8–12 and COVID-19 patients.13 Even more remarkable, nightmare frequency during the pandemic showed an increase among the general population,11,14,15 COVID-19 patients13 and people affected by persistent COVID-19 symptoms.16,17 In parallel, dream contents during the first wave appeared to be more emotionally intense8 with more negative valence8,9 compared to pre-lockdown period. Moreover, poor sleep11 and psychological symptoms (eg, anxiety, depression or stress) were predictors of greater dream recall and nightmare frequency.11,15 Only a few studies examined the changes during the pandemic by using a longitudinal design.18–21 In particular, Italian studies focused on longitudinal comparison of sleep and dreaming during the first two waves of the COVID-19 pandemic revealing changes in dreaming during the pandemic.18–20 For instance, Scarpelli and colleagues18 showed a reduction in dream recall, lucid dream, and nightmare frequency during the second wave compared with the first wave. Importantly, subjects with increased nightmare and lucid dream frequency in the second wave reported higher sleep disturbances, excessive daytime sleepiness and lower sleep hygiene, along with greater post-traumatic growth and PostTraumatic Stress Disorder (PTSD)-related nocturnal disruptive behaviors.18 Differently, Conte and co-workers19 found that a reduced proportion of participants reported increased or decreased dream frequency during the partial lockdown.
+
+More recently, in an Italian sample reporting moderate level of depression, stress, anxiety and poor sleep, Sommantico et al22 found that, during the third wave, a high proportion of individuals remembered their dreams and nightmares that were, respectively, characterized by high emotional intensity and nightmare distress. Sommantico et al22 showed that people affected by COVID-19 have a higher nightmare distress and more negative emotions in their most recent dreams. Consistently, individuals who knew someone who died of COVID-19 reported greater nightmare distress along with higher anxiety, stress and sleep disturbances during the wakefulness.22 To the best of our knowledge, this represents the only study investigating the sociodemographic, COVID-19-related variables, mood, sleep quality, and oneiric activity during the third wave of the pandemic in Italy.22 However, no longitudinal data including within-subject analyses are available concerning dream changes from the first to the third large waves.
+
+Here, we compared data collected in the third vs first wave from a quite large healthy sample consisting of Italians from all over regions (age range 18–75 years). We aimed to evaluate changes in self-reported dream features between the first and third wave. We also assessed the differences in dreaming taken into account the variation in the general distress among individuals, an index of mental health conditions. Specifically, we hypothesized that all dream variables changed between first and third waves, in the direction of reduced recall of dreams and nightmares. Also, since the wellestablished relationship between dreaming and mood variables, we expected that the condition of reduced psychological distress during the third wave was associated with a lower unpleasant oneiric activity.
+
+Considering that nightmares are relevant indicators of individual well-being,17 we aimed to identify predictors of nightmare frequency and the associated distress during the third wave (T3). In light of previous findings,8,11,15 we hypothesized that specific trait-like variables (eg, age, sex), COVID-19-related variables, and sleep measures may be determinants of the altered oneiric features in the third wave of pandemic.
+
+## Materials And Methods Protocol And Participants
+
+The current study is part of a more comprehensive project having different aims on the effect of the pandemic in Italy. 
+
+Part of the data from healthy subjects included in the present study have been reported elsewhere.11,18,23,24 We carried out a follow-up study during the third wave of the pandemic. Italian participants previously involved in the web survey investigating the dream and sleep features during the first wave of the pandemic (please see11,23) were asked to complete a new online survey on the Microsoft Azure platform available from 12 April to 20 May 2021.
+
+The survey was advertised through academic websites (eg, Facebook, Instagram and Twitter accounts of Italian universities) and social networks, and it took approximately 30 min to complete. Subjects were required to fill out selfadministered questionnaires to collect socio-demographic and COVID-19-related information, psychological measures, sleep, and dream features.
+
+All subjects filled out the survey after mandatorily accepting the informed consent stating a clear agreement to participate in the study by checking an appropriate box. Conversely, the subject could not access the questionnaires. No monetary compensation was given, and the participation was completely voluntary. After providing written permission, all participants generated a personal identification code to bridge their data between the two time points. Individuals could withdraw from the protocol without justification, and no data was stored. No individually identifiable information was required to guarantee anonymity.
+
+The protocol was carried out following the Declaration of Helsinki, and the approval was granted by the local ethics committee of the University of Messina (protocol \#12106, 4 March 2021).
+
+Eight hundred and sixteen individuals included in the first survey (T1) completed the follow-up survey (T3). The response rate at T3 was about 13%. The inclusion criteria were being Italian and being resident in Italy at the time of the survey completion, and being at least 18 years old. To account for potential effects of current or recent COVID-19 infection on oneiric, sleep, or psychological variables, all participants who reported having had COVID-19 within the last 3 months were excluded from the study. In brief, eighty-eight subjects were excluded for the following reasons: 77 reported to have recently had COVID-19 (last three months), 5 subjects were under 18, 6 subjects were living outside Italy. The final sample consisted of 728 participants.
+
+## Measures Socio-Demographic And Covid-19-Related Information
+
+Firstly, socio-demographic and COVID-19-related information were requested: age, sex, Italian area, education level, marital status, occupation, job loss, having friends or relatives infected by COVID-19; having friends or relatives dead due to COVID-19, and changes in physical or online relationships.
+
+## Depression Anxiety Stress Scale-21
+
+The short form of the Italian version of the Depression Anxiety Stress Scale-21 (DASS-21)25 was used to assess the mental health status of each participant. Individuals evaluated through 21 items the frequency and severity of depression, anxiety and stress symptoms. Each subscale score corresponds to the sum of the responses to the 7 items multiplied by two. The total score indicates the General Distress, calculated as the sum of the three subscales. The General Distress index (GDI) was considered for further analyses in the current study and used as an index of general psychopathology and mood problems, according to the literature.25 The Italian version of the DASS-21 scale seems to have good psychometric properties. Cronbach's alpha was between 0.88 and 0.92 for the three scales and the total general distress.25
+
+## Sleep Hygiene Index (Shi)
+
+The Sleep Hygiene Index (SHI)26 is a subjective questionnaire including 13 items to assess specific habits associated with sleep hygiene. Subjects rate the frequency of each behavior on a 5-point Likert scale (from "never" to "always"). A total score (13–65) is calculated by summing items and was considered for further analysis in the present study. A greater score represents poor sleep hygiene. The Italian version of SHI showed high internal consistency with a Cronbach's alpha of 0.91.26
+
+## Medical Outcomes Study—Sleep Scale (Mos-Ss)
+
+Sleep parameters were evaluated through the Italian adaptation of the Medical Outcomes Study-sleep scale (MOS-SS),27 a self-administered questionnaire assessing the quantity and quality of sleep within a month by 12 items. The questionnaire allows us to obtain six outcomes: sleep disturbance, snoring, awakening short of breath or with headache, sleep adequacy, sleepiness, and sleep duration/optimal sleep. Moreover, a Sleep Problem Index (SPI) can be calculated as a synthetic measure of sleep quality. Specifically, the SPI represents an aggregate measure of responses in the following areas: sleep disturbance, awakening with shortness of breath or headache, sleep adequacy, and sleepiness. In the current investigation, the SPI was considered for further analyses. Internal consistency of the scale is good to excellent, with Cronbach's alpha values ranging from 0.63 to 0.83 for the subscales.28
+
+## Mannheim Dream Questionnaire (Madre)
+
+Dream characteristics were measured by the Italian adaptation of the Mannheim Dream Questionnaire (MADRE),29 a self-administered questionnaire including 20 items. Different outcomes concerning dreaming features were obtained through this instrument. In the current investigation, we considered for further analyses the following state-like dream measures with the reference to the last month: (a) item 1 evaluating the dream-recall frequency (DRF) from "0 = never" to "6 = almost every morning"; (b) item 2 assessing the dream emotional intensity (EI) from "0 = not at all intense" and "4 = very intense"; (c) item 4 evaluating the nightmare frequency (NMF) from "0 = never" to "8 = several times a week"; (d) item 5 assessing the nightmare distress (NMD) from "0 = not at all distressing" to "4 = very distressing"; and (e) item 10 assessing the lucid-dream frequency (LDF) from "0 = never" to "8 = several times a week". The Italian version of the MADRE has been shown to have good internal consistency with Cronbach's alpha values ranging from 0.74 to 0.91.29
+
+## Statistical Analysis
+
+Descriptive analyses were performed to show the socio-demographic features of the final sample.
+
+Based on the difference between T3 and T1 on the GDI (from DASS-21), the participants were divided into two subgroups: 1) Improved subjects, ie, participants with a GDI score lower at T3 than T1, and 2) Not Improved subjects, ie, participants with a GDI score equal or higher at T3 than T1. Then, intending to explore differences in dream features between the first (T1) and third (T3) wave of the COVID-19 pandemic, we performed a two-way mixed multivariate analysis of variance (MANOVA), with "Time" (T1 versus T3) as the within-subject factor, and "GDI condition" (Improved vs Not Improved subjects) as the between-subject factor. DRF, NMF, LDF, EI and NMD were considered dependent variables. Partial eta-squared (η2) was calculated as a measure of effect size. Effect sizes between 0.01 and 0.05 were considered small or low, between 0.06 and 0.13 were moderate, and ≥0.14 were large.
+
+Finally, to assess the best explanatory variables of the dream measures discriminating Improved and Not Improved groups, we performed multiple linear regressions separately in the two groups (Not Improved and Improved) considering the following socio-demographic, COVID-19-related, and sleep-related measures as independent variables: age, sex, having friends or relatives infected by or dead due to COVID-19, changes in physical or online relationships, SPI, SHI. We entered the variables at the same time into the model. We also checked the multicollinearity between the predictors (ie, independent variables) prior to performing the regressions by calculating variance inflation factors (VIF <3). The Statistical Package for Social Sciences (SPSS) version 25.0 and MATLAB version R2019 were used for computing statistical analyses. The significance level for all analyses was α = 0.05.
+
+## Results Characteristics Of Participants
+
+The features of the sample are detailed in Table 1.
+
+Briefly, more than 40% of participants were young (18–25 years). Most of the participants were females (77.9%). 
+
+Individuals were mainly single (38.6%), but a significant proportion of subjects was involved in a stable relationship (27.5%) or married (21.5%). Participants most often indicated that they had a high-school education (45.5%). Also, a great percentage of individuals had a job (47.1%) or were students (48.1%). Few subjects had lost (6.5%) their job during the third wave of the pandemic. Moreover, the most represented Italian area was the North (79.1%). Slightly more than half of the sample had COVID-19-infected friends or relatives (50.1%), and a small proportion of people had a close person who died for the COVID-19 infection (around 12%). Finally, more than half of the sample reduced their physical relationships (59.1%) and maintained stable online relationships (59.2%).
+
+## Dreams And Nightmares Changes During The Third Wave
+
+In this section, we report the results of the two-way mixed MANOVA (Time X GDI condition) comparing the self-reported dream features between the first and third wave of the pandemic, considering the modifications of the GDI as a criterion to divide the sample in Improved (N = 330) and Not Improved (N = 398) people. We showed significant differences between the two time points (Wilk's λ = 0.935, F5,722 = 9.977, p < 0.001, η2 = 0.065), but not between the two groups based on GDI 
+
+| Table 1 Characteristics of the Sample During the Third Wave of the Pandemic Participants (N=728) N (%) Age 18–25 299 (41.1) 26–30 135 (18.5) 31–40 99 (13.6) 41–50 82 (11.3) 51–60 83 (11.4) 60+ 30 (4.1) Sex Male 161 (22.1) Female 567 (77.9) Marital status Single 281 (38.6) Married 157 (21.5) Cohabitating 65 (8.9) Engaged 200 (27.5) Divorced/Separated/Widower 25 (3.5) Education level Until middle School 14 (1.9) High School 331 (45.5) Bachelor's Degree 150 (20.6) Master's Degree 179 (24.6) PhD/postgraduate school 54 (7.4) Occupation Retired 11 (1.5) Unemployed 24 (3.3) Student 350 (48.1) Employed 343 (47.1) Job loss Yes 47 (6.5) No 681 (93.5) Italian area North Italy 576 (79.1) Centre and South Italy 152 (20.9) (Continued)   |
+|--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+
+| Participants (N=728) N (%)                  |            |
+|---------------------------------------------|------------|
+| COVID-19-infected friends/relatives Yes     | 365 (50.1) |
+| No                                          | 363 (49.9) |
+| COVID-19-died friends/relatives Yes         | 93 (12.8)  |
+| No                                          | 635 (87.2) |
+| Changes in physical relationships Decreased | 430 (59.1) |
+| Stable                                      | 249 (34.2) |
+| Improved                                    | 49 (6.7)   |
+| Changes in online relationships Decreased   | 112 (15.4) |
+| Stable                                      | 431 (59.2) |
+| Improved                                    | 185 (25.4) |
+
+| as Within and Between Factors, Respectively Time                                                                                                                                                                                       | GDI Condition   | Time X GDI Condition   |       |        |        |         |
+|----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|-----------------|------------------------|-------|--------|--------|---------|
+| F1,726                                                                                                                                                                                                                                 | p               | F1,726                 | p     | F1,284 | p      |         |
+| DRF                                                                                                                                                                                                                                    | 23.429          | <0.001*                | 5.530 | 0.257  | 3.383  | 0.066   |
+| NMF                                                                                                                                                                                                                                    | 14.093          | <0.001*                | 1.741 | 0.583  | 19.734 | <0.001* |
+| LDF                                                                                                                                                                                                                                    | 8.996           | 0.003*                 | 0.029 | 0.951  | 0.720  | 0.396   |
+| EI                                                                                                                                                                                                                                     | 23.778          | <0.001*                | 5.806 | 0.052  | 0.794  | 0.373   |
+| NMD                                                                                                                                                                                                                                    | 0.708           | 0.401                  | 0.801 | 0.484  | 4.549  | 0.033*  |
+| Note: *Asterisks indicate statistical significance.  Abbreviations: GDI, General Distress Index; DRF, Dream Recall Frequency; NMF, Nightmare Frequency; LDF, Lucid Dream Frequency;  EI, Emotional Intensity, NMD, Nightmare Distress. |                 |                        |       |        |        |         |
+
+scores (Wilk's λ = 0.994, F5,722 = 0.907, p = 0.476, η2 = 0.006). We also found a significant interaction between the two factors "Time" and "GDI condition" (Wilk's λ = 0.960, F5,722 = 6.038, p < 0.001, η2 = 0.040).
+
+Specifically, subsequent univariate ANOVAs on each dependent variable (Table 2, and see also Figure 1) revealed that both Improved and Not Improved groups reported in T3 lower scores on the following oneiric variables: DRF (F1,726 = 
+23.001, p < 0.001, η2 = 0.031), NMF (F1,726 = 14.093, p < 0.001, η2 = 0.019), LDF (F1,726 = 8.996, p = 0.003, η2 = 0.012), EI (F1,726 = 23.778, p < 0.001, η2 = 0.032). Moreover, the significant "Time" vs "GDI condition" interaction points to reduced NMF (F1,726 = 19.734, p < 0.001, η2 = 0.026) and NMD (F1,726 = 4.549, p = 0.033, η2 = 0.006) during the third wave in Improved compared with Not Improved subjects. Accordingly, post-hoc (paired t-tests) showed that Improved subjects significantly reduced their NMF (t = 5.424; p < 0.001) and NMD (t = 2.095; p = 0.037) in T3 compared to T1.
+
+![6_image_0.png](6_image_0.png)
+
+## Predictors Of Nightmare Frequency And Nightmare Distress During The Third Wave
+
+Considering socio-demographic, COVID-19-related factors and sleep measures as predictors, multiple linear regressions have been carried out on the oneiric variables in which we detected an interaction effect in the previous analyses, ie, NMF and NMD. Results of the multiple regressions conducted separately on Not Improved and Improved group were reported in Table 3 and 4.
+
+| the Third Wave as Dependent Variables in Improved People (N = 330) Dependent Variables Predictors Standardized β Coefficients   | t      | P      |                   |         |
+|---------------------------------------------------------------------------------------------------------------------------------|--------|--------|-------------------|---------|
+| NMF R = 0.446  adjusted R2 = 0.179  F = 9.941  p <0.001*                                                                        | Age    | −0.266 | −4.931            | <0.001* |
+| Sex                                                                                                                             | 0.135  | 2.626  | 0.009*            |         |
+| COVID-19-infected relatives/friends                                                                                             | −0.025 | −0.479 | 0.632             |         |
+| COVID-19-died relatives/friends                                                                                                 | −0.084 | −1.655 | 0.099             |         |
+| Changes in physical relationships                                                                                               | −0.009 | −0.171 | 0.865             |         |
+| Changes in online relationships                                                                                                 | 0.001  | 0.029  | 0.977             |         |
+| SPI                                                                                                                             | 0.251  | 4.325  | <0.001*           |         |
+| SHI                                                                                                                             | 0.007  | 0.115  | 0.909 (Continued) |         |
+
+Scarpelli et al **Dovepress**
+Table 3 (Continued). 
+
+| Dependent Variables                                                                                                                                                        | Predictors   | Standardized β Coefficients   | t      | P     |
+|----------------------------------------------------------------------------------------------------------------------------------------------------------------------------|--------------|-------------------------------|--------|-------|
+| NMD R = 0.335  Adjusted R2 = 0.090  F = 5.081  p <0.001*                                                                                                                   | Age          | −0.028                        | −0.495 | 0.621 |
+| Sex                                                                                                                                                                        | 0.141        | 2.590                         | 0.010* |       |
+| COVID-19-infected relatives/friends                                                                                                                                        | −0.037       | −0.687                        | 0.493  |       |
+| COVID-19-died relatives/friends                                                                                                                                            | 0.023        | 0.439                         | 0.661  |       |
+| Changes in physical relationships                                                                                                                                          | 0.035        | 0.459                         | 0.647  |       |
+| Changes in online relationships                                                                                                                                            | 0.011        | 0.216                         | 0.829  |       |
+| SPI                                                                                                                                                                        | 0.199        | 3.264                         | 0.001* |       |
+| SHI                                                                                                                                                                        | 0.114        | 1.840                         | 0.067  |       |
+| Note: *Asterisks indicate statistical significance.  Abbreviations: NMF, Nightmare Frequency, SHI, Sleep Hygiene Index; SPI, Sleep Problem Index; NMD, Nightmare Distress. |              |                               |        |       |
+
+Table 4 Results of the Multiple Linear Regressions Considering Nightmare Frequency and Nightmare Distress During the Third Wave as Dependent Variables in Not Improved People (N = 398)
+
+| the Third Wave as Dependent Variables in Not Improved People (N = 398) Dependent Variables Predictors Standardized β Coefficients                                          | t      | P      |         |         |
+|----------------------------------------------------------------------------------------------------------------------------------------------------------------------------|--------|--------|---------|---------|
+| NMF R = 0.487  adjusted R2 = 0.222  F = 15.141  p <0.001*                                                                                                                  | Age    | −0.198 | −4.196  | <0.001* |
+| Sex                                                                                                                                                                        | 0.088  | 1.961  | 0.051   |         |
+| COVID-19-infected relatives/friends                                                                                                                                        | −0.066 | −1.463 | 0.144   |         |
+| COVID-19-died relatives/friends                                                                                                                                            | −0.006 | −0.129 | 0.898   |         |
+| Changes in physical relationships                                                                                                                                          | −0.027 | −0.581 | 0.561   |         |
+| Changes in online relationships                                                                                                                                            | 0.069  | 1.547  | 0.123   |         |
+| SPI                                                                                                                                                                        | 0.297  | 5.837  | <0.001* |         |
+| SHI                                                                                                                                                                        | 0.097  | 1.861  | 0.063   |         |
+| NMD R = 0.393  adjusted R2 = 0.137  F = 8.880  p <0.001*                                                                                                                   | Age    | −0.036 | −0.730  | 0.466   |
+| Sex                                                                                                                                                                        | 0.126  | 2.668  | 0.008*  |         |
+| COVID-19-infected relatives/friends                                                                                                                                        | −0.037 | 0.778  | 0.437   |         |
+| COVID-19-died relatives/friends                                                                                                                                            | −0.030 | −0.626 | 0.531   |         |
+| Changes in physical relationships                                                                                                                                          | −0.067 | −1.402 | 0.162   |         |
+| Changes in online relationships                                                                                                                                            | 0.039  | 0.826  | 0.409   |         |
+| SPI                                                                                                                                                                        | 0.244  | 4.547  | <0.001* |         |
+| SHI                                                                                                                                                                        | 0.136  | 2.470  | 0.014*  |         |
+| Note: *Asterisks indicate statistical significance.  Abbreviations: NMF, Nightmare Frequency, SHI, Sleep Hygiene Index; SPI, Sleep Problem Index; NMD, Nightmare Distress. |        |        |         |         |
+
+Dovepress Scarpelli et al
+
+![8_image_0.png](8_image_0.png)
+
+Concerning Improved participants, both the regression models were statistically significant (NMF: adjusted R2 = 
+0.179, p < 0.001; NMD: adjusted R2 = 0.090, p < 0.001). The partial correlations show that younger age (β = −0.266; t = 
+−4.931; p < 0.001), female sex (β = 0.135; t = 2.626; p = 0.009), and higher scores on SPI (β = 0.251; t = 4.325; p < 0.001) predict higher NMF. Also, the partial correlations reveal that female sex (β = 0.141; t = 2.590; p = 0.010), and higher scores on SPI (β = 0.199; t = 3.264; p = 0.001) predict higher NMD.
+
+Concerning Not Improved participants, both the regression models were statistically significant (NMF: adjusted R2 = 
+0.222, p < 0.001; NMD: adjusted R2 = 0.137, p < 0.001). Specifically, the partial correlations show that younger age (β = 
+−0.198; t = −4.196; p < 0.001), and higher scores on SPI (β = 0.297; t = 5.847; p < 0.001) predict higher NMF. Additionally, the partial correlations reveal that female sex (β = 0.126; t = 2.668; p = 0.008), higher scores on SPI (β = 0.244; t = 4.547; p < 0.001), and poor sleep hygiene (β = 0.136; t = 2.470 0; p = 0.014) predict higher NMD.
+
+As control analyses, we performed the regressions on the whole sample to verify potential changes in the predictors of NMF and NMD (see Supplementary Data, Table S1). No other variable was associated with these two oneiric features.
+
+Since the Sleep Hygiene shows a significant relationship with NMD only among Not Improved participants, we checked potential differences of SHI score between T1 and T3 in the Improved and Not Improved groups. Actually, the two-way mixed ANOVA "Time x GDI condition" shows no main effect for Time (F1,726 = 1.327, p = 0.250, η2 = 0.002) and GDI Condition (F1,726 = 1.273, p = 0.260, η2 = 0.002) was found. Differently, the interaction Time x GDI condition was significant (F1,726 = 57.895, p < 0.001, η2 = 0.074) and reveals that the Improved group have greater scores in SHI (poorer sleep hygiene) at T1 than T3. Conversely, Not Improved people report higher scores in SHI at T3 than T1 (see Figure 2).
+
+## Discussion
+
+The current investigation had the main objective to longitudinally evaluate the changes in the oneiric activity during the third wave of the COVID-19 pandemic. In line with the available literature,18,19 we showed that both quantitative (DRF, 
+NMF, LDF) and emotional (EI) oneiric features had lower scores in the third than the first wave. We substantially confirmed the reduced oneiric production and emotional load of dreams after more than one year of the pandemic according to the hypothesis of an adaptation to the situation.19,20,22 Indeed, most of the studies found higher dream recall and nightmare rate among healthy subjects during the period characterized by greater restrictive measures (lockdown/first pandemic wave).8,10,11,30 Consistently, these effects appeared to change over the course of the pandemic, with the reduction of dream recall and lucid dreams immediately after the end of the lockdown31 and lower DRF and NMF during the second wave than the first wave.18 Moreover, for the first time, we assessed the modifications of pandemic dream activity as a function of the general distress variations over time. Although we identified that almost all dream features decreased during the third wave, we revealed that nightmare rate and distress are reduced in the third than first wave only among Improved subjects. Namely, subjects that reduced their level of general (psychological) distress during the third wave reported a decreased rate of nightmare and lower nightmare-related consequences. This is partly in line with the several findings suggesting that changes in the oneiric activity could inform us about the individual psychological conditions.13,32,33 Actually, frequent nightmares are strongly associated with mental illness.34 For instance, anxiety symptoms and mood alterations are often accompanied by nightmares32,35,36 and nightmare sufferers seem to have more suicidal ideations.37,38 More directly, recent studies revealed people more impacted by COVID-19 had greater NMF13,17 or greater emotional load in their dreams.9,29,39,40 Moreover, anxiety symptoms were associated with higher NMF in people who have contracted the infection.13 Also, subjects with long-term COVID-19 consequences showed more nightmares associated with greater number of persistent symptoms and anxiety.17 On the one hand, the reduction of NMF and NMD among Improved is consistent with the continuity hypothesis postulating that dream activity mirror the individual's current concerns, thoughts and waking experiences.41,42 On the other hand, the absence of any decreasing in NMF and NMD among Not Improved could reflect the effort - still ongoing - of metabolizing, downregulating, and coping with emotions elicited by adverse pandemic events.43 Moreover, we identified the explanatory variables of NMF and NMD in each group. Consistently to the well-known literature on dreaming,44,45 it is not surprising that stable individual features are related with nightmare characteristics. Aging seems to prevent the oneiric production likely because older adults are lower interested in their dreams.46 Additionally, female sex is associated with both high nightmare frequency and nightmare distress in both group, consistently to several COVID-19 studies revealed that women experiencing more dreams and nightmares and an increase in negative dreams during the COVID-19 pandemic.11,15,39,40,47 According to our expectation, Improved and Not Improved people showed higher nightmare frequency and distress in relation to greater sleep problems as evaluated by the MOSS. In other words, having more sleep disorders, intra-sleep awakenings and sleepiness - included in the synthetic index SPI - was associated with greater NMF and NMD. This is in line with previous pandemic studies suggesting that dream rate is influenced by the level of arousal/activation during sleep.7 More in general, the results are coherent with the current frameworks explaining dream recall (eg, arousalretrieval model48) and also confirmed by electrophysiological studies49–51 emphasizing that fragmentation and lower deep sleep promote the retrieval of oneiric traces.
+
+Interestingly, sleep hygiene was the only determinant related to nightmare distress among Not Improved but not among Improved participants. Our additional analysis revealed two opposite directions for SHI scores in Improved and Not Improved groups between the two different pandemic waves, with a significant amelioration of sleep hygiene among Improved and significant worsening among Not Improved in T3. Notably, some randomized clinical trial showed that including a section that specifically focuses on improving dysfunctional sleep habits appeared to be effective in the treatment of chronic nightmares (eg,52). Moreover, better sleep hygiene by improving overall sleep quality could also reduce the perceived discomfort associated with nightmares.53 In light of this, we can speculate that a good sleep hygiene may represent a protective factor for nightmare-related consequences.
+
+## Limitations
+
+The present study has some important limitations. First, likely most of web-survey on the COVID-19 pandemic in the field of sleep research8,23,54,55 we have a sex imbalance in our sample. Importantly, the response rate at T3 was very low 
+(13%). We are aware that people during T1 were probably more willing to fill out online questionnaires and participate in research on pandemic. However, the low response rate can give rise to sampling bias. Both these issues lead to a relative difficulty in generalizing the current results.
+
+Moreover, the protocol did not evaluate the presence of potential long-COVID symptoms that could contribute to modulate the oneiric activity as suggested by previous findings.17 Our investigation has the great advantage of longitudinally comparing oneiric activity between first and third wave in a large Italian sample taking under account the general distress condition. However, it should be noted that we were unable to address the same research objective also considering the second wave since the data on psychological status (DASS) were not collected in that step.
+
+Finally, intrinsic flows of the retrospective questionnaires should be considered since memory biases could stem for the use of self-reported instrument to assess dream and sleep patterns without any support from polysomnographic or actigraphic measures.56
+
+## Conclusion
+
+Our investigation represents the first longitudinal assessment of dreaming across the first and third wave of the pandemic. In brief, we found that most of the dream features, with the exception of nightmare distress, decreased in the third wave as compared to the first. Notably, we revealed that subjects that reduced their level of general distress in the third vs first pandemic (ie, Improved people) wave are characterized by lower nightmares rate and nightmare distress.
+
+Additionally, our findings confirmed that beyond the trait-like variables (ie, age, sex), also specific sleep-related measures are related to nightmare features. Importantly, poor sleep hygiene was one of the best determinants of nightmare distress among individuals with unchanged or increased level of general distress (ie, Not Improved people).
+
+Overall, our results strengthen the available pandemic literature emphasizing that nightmares and their variations over time are strongly related to human well-being. Moreover, we suggest that specific factors could modulate the relationship between mental health and nightmares along with their consequences. Therefore, our results suggest that clinicians should assess the role of nightmares to better direct clinical psychological interventions. Future studies should focus on protective and risk factors eliciting nightmares to increase the efficacy of treatments and prevent the development of chronic nightmare disorder.
+
+## Abbreviations
+
+COVID-19, coronavirus disease 2019; T1, first wave; T2, second wave; T3, third wave; PTSD, Post-Traumatic Stress Disorder; DASS-21, Depression Anxiety Stress Scale-21; GDI, General Distress index; SHI, Sleep Hygiene Index; MOSSS, Medical Outcomes Study—Sleep Scale; SPI, Sleep Problem Index; MADRE, Mannheim Dream Questionnaire; DRF, 
+Dream Recall Frequency; NMF, Nightmare Frequency; LDF, Lucid Dream Frequency; EI, Emotional Intensity; NMD, Nightmare Distress; MANOVA, multivariate analysis of variance; VIF, variance inflation factor; SPSS, Statistical Package for Social Sciences.
+
+## Disclosure
+
+Giuseppe Plazzi is a consultant and participated in advisory board for Jazz, Bioprojet, Takeda, Idorsia. Luigi De Gennaro reports personal fees from Idorsia, outside the submitted work. The authors report no other conflicts of interest in this work.
+
+## References
+
+9. Schredl M, Bulkeley K. Dreaming and the COVID-19 pandemic: a survey in a US sample. *Dreaming*. 2020;30(3):189–198. doi:10.1037/ 
+drm0000146 10. Fränkl E, Scarpelli S, Nadorff MR, et al. How our dreams changed during the COVID-19 pandemic: effects and correlates of dream recall frequency-a multinational study on 19,355 adults. *Nat Sci Sleep*. 2021;13:1573–1591. doi:10.2147/NSS.S324142 11. Scarpelli S, Alfonsi V, Mangiaruga A, et al. Pandemic nightmares: effects on dream activity of the COVID-19 lockdown in Italy. *J Sleep Res*. 
+
+2021;30(5):e13300. doi:10.1111/jsr.13300 12. Solomonova E, Picard-Deland C, Rapoport IL, et al. Stuck in a lockdown: dreams, bad dreams, nightmares, and their relationship to stress, depression and anxiety during the COVID-19 pandemic. *PLoS One*. 2021;16(11):e0259040. doi:10.1371/journal.pone.0259040 13. Scarpelli S, Nadorff MR, Bjorvatn B, et al. Nightmares in people with COVID-19: did Coronavirus infect our dreams? *Nat Sci Sleep*. 
+
+2022;14:93–108.
+
+14. Guerrero-Gomez A, Nöthen-Garunja I, Schredl M, et al. Dreaming in adolescents during the COVID-19 health crisis: survey among a sample of European school students. *Front Psychol*. 2021;12:652627. doi:10.3389/fpsyg.2021.652627 15. Pesonen AK, Lipsanen J, Halonen R, et al. Pandemic dreams: network analysis of dream content during the COVID-19 lockdown. *Front Psychol*. 
+
+2020;11:2569. doi:10.3389/fpsyg.2020.573961 16. Davis HE, Assaf GS, McCorkell L, et al. Characterizing long COVID in an international cohort: 7 months of symptoms and their impact. EClin Med. 2021;38:101019. doi:10.1016/j.eclinm.2021.101019 17. Scarpelli S, De Santis A, Alfonsi V, et al. The role of sleep and dreams in long-COVID. *J Sleep Res*. 2022c;18:e13789. doi:10.1111/jsr.13789 18. Scarpelli S, Alfonsi V, Gorgoni M, et al. Dreams and nightmares during the first and second wave of the covid-19 infection: a longitudinal study. 
+
+Brain Sci. 2021b;11(11):1375. doi:10.3390/brainsci11111375 19. Conte F, Rescott ML, De Rosa O, et al. Changes in dream features across the first and second waves of the Covid-19 pandemic. *J Sleep Res*. 
+
+2022;31(1):e13425. doi:10.1111/jsr.13425 20. Gorgoni M, Scarpelli S, Alfonsi V, et al. The oneiric activity during and after the COVID-19 total lockdown in Italy: a longitudinal study. 
+
+Int J Environ Res Public Health. 2022b;19(7):3857. doi:10.3390/ijerph19073857 21. Alfonsi V, Gorgoni M, Scarpelli S, et al. Changes in sleep pattern and dream activity across and after the COVID-19 lockdown in Italy: 
+a longitudinal observational study. *J Sleep Res*. 2022;31(2):e13500. doi:10.1111/jsr.13500 22. Sommantico M, Iorio I, Parrello S. Mood, sleep quality, and dreaming during the third wave of the COVID-19 pandemic in Italy. *Int J Dream Res*. 
+
+2021;14(2):309–319. doi:10.11588/ijodr.2021.2.82109 23. Franceschini C, Musetti A, Zenesini C, et al. Poor sleep quality and its consequences on mental health during the COVID-19 lockdown in Italy. 
+
+Front Psychol. 2020;11:3072. doi:10.3389/fpsyg.2020.574475 24. Musetti A, Soffer-Dudek N, Imperato C, et al. Longitudinal associations between maladaptive daydreaming and psychological distress during the COVID-19 health crisis. *J Behav Addict*. 2023;1:34.
+
+25. Bottesi G, Ghisi M, Altoè G, et al. The Italian version of the Depression Anxiety Stress Scales-21: factor structure and psychometric properties on community and clinical samples. *Compr*. 2015;60:170–181. doi:10.1016/j.comppsych.2015.04.005 26. Zagaria A, Ballesio A, Musetti A, et al. Psychometric properties of the Sleep Hygiene Index in a large Italian community sample. *Sleep Med*. 
+
+2021;84:362–367. doi:10.1016/j.sleep.2021.06.021 27. Palagini L, Manni R. Misurare il sonno: repertorio delle scale di valutazione dei disturbi del sonno. *Minerva Med*. 2016;3–4. 28. Hays RD, Martin SA, Sesti AM, et al. Psychometric properties of the medical outcomes study sleep measure. *Sleep Med*. 2005;6:41–44. 
+
+doi:10.1016/j.sleep.2004.07.006 29. Settineri S, Frisone F, Alibrandi A, et al. Italian adaptation of the Mannheim Dream Questionnaire (MADRE): age, gender and dream recall effects. 
+
+Int J Dream Res. 2019;12(1):119–129. doi:10.11588/ijodr.2019.1.59328 30. Iorio I, Sommantico M, Parrello S. Dreaming in the time of COVID-19: a quali-quantitative Italian study. *Dreaming*. 2020;30(3):199–215. 
+
+doi:10.1037/drm0000142 31. Scarpelli S, Gorgoni M, Alfonsi V, et al. The impact of the end of COVID confinement on pandemic dreams, as assessed by a weekly sleep diary: 
+a longitudinal investigation in Italy. *J Sleep Res*. 2022d;31(1):e13429. doi:10.1111/jsr.13429 32. Blagrove M, Farmer L, Williams E. The relationship of nightmare frequency and nightmare distress to well-being. *J Sleep Res*. 2004;13 
+(2):129–136.
+
+33. Carr M, Matthews E, Williams J, et al. Testing the theory of Differential Susceptibility to nightmares: the interaction of Sensory Processing Sensitivity with the relationship of low mental wellbeing to nightmare frequency and nightmare distress. *J Sleep Res*. 2021;30(3):e13200. doi:10.1111/jsr.13200 34. Bishop TM, Walsh PG, Ashrafioun L, et al. Sleep, suicide behaviors, and the protective role of sleep medicine. *Sleep Med*. 2020;66:264–270. 
+
+doi:10.1016/j.sleep.2019.07.016 35. Levin R, Fireman G. Nightmare prevalence, nightmare distress, and self-reported psychological disturbance. *Sleep*. 2002;25(2):205–212. 36. Van Schagen A, Lancee J, Swart M, et al. Nightmare disorder, psychopathology levels, and coping in a diverse psychiatric sample. *J Clin Psychol*. 
+
+2017;73(1):65–75. doi:10.1002/jclp.22315 37. Sjöström N, Hetta J, Waern M. Persistent nightmares are associated with repeat suicide attempt: a prospective study. *Psychiatry Res*. 2009;170(2– 
+3):208–211. doi:10.1016/j.psychres.2008.09.006 38. Nadorff MR, Nazem S, Fiske A. Insomnia symptoms, nightmares, and suicidal ideation in a college student sample. *Sleep*. 2011;34:93–98. 
+
+doi:10.1093/sleep/34.1.93 39. Barrett D. Dreams about COVID-19 versus normative dreams: trends by gender. *Dreaming*. 2020;30(3):216–221. doi:10.1037/drm0000149 40. Parrello S, Sommantico M, Lacatena M, et al. Adolescents' dreams under COVID-19 isolation. *Int J Dream Res*. 2021;14(1):10–20. doi:10.11588/ 
+ijodr.2021.1.73858 41. Hall CS, Nordby VJ. *The Individual and His Dreams*. New York, NY: NAL; 1972. 42. Scarpelli S, Alfonsi V, Gorgoni M, et al. What about dreams? State of the art and open questions. *J Sleep Res*. 2022e;31(4):e13609. doi:10.1111/ 
+jsr.13609 43. Picchioni D, Goeltzenleucher B, Green DN, et al. Nightmares as a coping mechanism for stress. *Dreaming*. 2002;12:155–169.
+
+44. Scarpelli S, Bartolacci C, D'Atri A, et al. Mental sleep activity and disturbing dreams in the lifespan. *Int J Environ Res Public Health*. 2019a;16 
+(19):3658. doi:10.3390/ijerph16193658 45. Schredl M, Reinhard I. Gender differences in dream recall: a meta-analysis. *J Sleep Res*. 2008;17:125–131. doi:10.1016/j.smrv.2010.06.002 46. Cohen DB. Remembering and forgetting dreaming. In: Kihlstrom J, Evans F, editors. *Functional Disorders of Memory*. Hillsdale, NY, USA: 
+Erlbaum; 1979:239–274. doi:10.1177/000306516301100404 47. Holzinger B, Nierwetberg F, Chung F, et al. Has the COVID-19 Pandemic Traumatized Us Collectively? The Impact of the COVID-19 Pandemic on Mental Health and Sleep Factors via Traumatization: a Multinational Survey. *Nat Sci Sleep*. 2022;14(August):1469–1483. doi:10.2147/NSS.S368147 48. Koulack D, Goodenough DR. Dream recall and dream recall failure: an arousal-retrieval model. *Psychol Bull*. 1976;83(5):975–984. doi:10.1037/ 
+0033-2909.83.5.975 49. Scarpelli S, D'Atri A, Mangiaruga A, et al. Predicting dream recall: EEG activation during NREM sleep or shared mechanisms with wakefulness? 
+
+Brain Topogr. 2017;30:629–638. doi:10.1007/s10548-017-0563-1 50. Siclari F, Baird B, Perogamvros L, et al. The neural correlates of dreaming. *Nat Neurosci*. 2017;20(6):872–878. doi:10.1038/nn.4545 51. D'Atri A, Scarpelli S, Schiappa C, et al. Cortical activation during sleep predicts dream experience in narcolepsy. *Ann Clin Transl Neurol*. 2019;6 
+(3):445–455. doi:10.1002/acn3.718 52. Davis JL, Wright DC. Randomized clinical trial for treatment for chronic nightmares in trauma-exposed adults. *J Trauma Stress*. 
+
+2007;202:123–133. doi:10.1002/jts.20199 53. Krakow B, Johnston L, Melendrez D, et al. An open-label trial of evidence-based cognitive behavior therapy for nightmares and insomnia in crime victims with PTSD. *Am J Psychiatry*. 2001;158(12):2043–2047. doi:10.1176/appi.ajp.158.12.2043 54. Cellini N, Canale N, Mioni G, et al. Changes in sleep pattern, sense of time and digital media use during COVID-19 lockdown in Italy. *J Sleep Res*. 
+
+2020;29(4):e13074. doi:10.1111/jsr.13074 55. Casagrande M, Favieri F, Tambelli R, et al. The enemy who sealed the world: effects quarantine due to the COVID-19 on sleep quality, anxiety, and psychological distress in the Italian population. *Sleep Med*. 2020;75:12–20. doi:10.1016/j.sleep.2020.05.011 56. Scarpelli S, Gorgoni M, D'Atri A, et al. Structural and functional differences in brain mechanisms of dream recall. *Handb Behav Neurosci*. 
+
+2019;30:269–281.
+
+Nature and Science of Sleep Dovepress Publish your work in this journal Nature and Science of Sleep is an international, peer-reviewed, open access journal covering all aspects of sleep science and sleep medicine, including the neurophysiology and functions of sleep, the genetics of sleep, sleep and society, biological rhythms, dreaming, sleep disorders and therapy, and strategies to optimize healthy sleep. The manuscript management system is completely online and includes a very quick and fair peer-review system, which is all easy to use. Visit http://www.dovepress.com/testimonials.php to read real quotes from published authors. 
+
+Submit your manuscript here: https://www.dovepress.com/nature-and-science-of-sleep-journal

medical/md/PMC10280766.md

@@ -0,0 +1,174 @@
+# Tolerancia Y Respuesta A La Terapia Cetógena En Neonatos Y Lactantes Menores De 4 Meses. Serie De Casos En Un Centro Hospitalario De Medellín, Colombia
+
+Carolina Serrano-Tabares, Juliana Trujillo-Gómez, Rosa M. Morales-Gil, Yudy Aguilar-Pérez, M. José Jiménez-Villegas Introducción. Los estudios para terapia cetógena (TC) se han concentrado en niños mayores de 2 años y adultos. Su eficacia en lactantes se ha descrito, pero hay pocos estudios en este grupo de edad. 
+
+Pacientes y métodos. Se describe una serie de casos de nueve neonatos y lactantes menores de 4 meses de edad con epilepsia refractaria que recibieron tratamiento con TC. Se evaluaron, retrospectivamente, los registros clínicos de niños tratados entre 2015 y 2021. Resultados. Se recolectaron datos de siete pacientes. Seis pacientes iniciaron con crisis epilépticas el primer día de vida, y uno, el día 45. La etiología de la epilepsia fue variada (metabólica, genética y estructural). La TC se inició tan temprano como a los 9 días de vida. La edad promedio de inicio fue los 24 días de vida. Se inició con una tasa cetógena de 1:1 o 1:2, y se progresó posteriormente a 4:1. Después de un mes de TC, 5/7 pacientes presentaron una reducción significativa en la frecuencia de las crisis (>50%) y 2/7 experimentaron un control completo. A los seis meses, 4/7 pacientes lograron un control completo y 1/7 un control >50%. Dos pacientes se perdieron en el seguimiento. No se notificaron efectos gastrointestinales que obligaran al ajuste o la suspensión de la dieta. Se notificaron hipoglucemia e hipertrigliceridemia. 
+
+Conclusión. A pesar de que la evidencia en la TC en lactantes y neonatos apenas está empezando a aparecer, nuestra experiencia muestra que puede ser una buena opción terapéutica para el control de las crisis epilépticas, sin efectos adversos importantes. Existe un gran potencial de investigación en el área de la TC en lactantes y neonatos. 
+
+Palabras clave. Crisis neonatales. Dieta cetógena. Epilepsia. Epilepsia neonatal. Epilepsia refractaria. Terapia cetógena. 
+
+## Introducción
+
+Las crisis epilépticas neonatales constituyen una manifestación de disfunción cerebral importante y con frecuencia conllevan una carga de pronóstico neurológico desfavorable, lo que incrementa el riesgo de desenlaces adversos de forma significativa 
+[1]. Debido a lo anterior, en los últimos años se han realizado estudios que han intentado encontrar opciones de medicamentos novedosos y con un aceptable perfil de eventos adversos en este grupo de edad, pero hasta el día de hoy las opciones siguen siendo muy limitadas, con un porcentaje de eficacia no satisfactorio [2-4].
+
+La terapia cetógena (TC) se emplea desde hace varios años como terapia no farmacológica de la epilepsia, y su eficacia en el manejo de la epilepsia refractaria se ha demostrado en estudios y revisiones sistemáticas [5,6]. Durante mucho tiempo, los estudios se enfocaron en niños mayores de 2 años y adultos, pero, en los últimos años, diferentes autores han descrito la seguridad y la eficacia en niños menores de esta edad [7-10]; sin embargo, siguen siendo pocos los estudios realizados en lactantes menores, y especialmente en neonatos. Las razones para ello están en relación con los requerimientos nutricionales especiales que existen a estas edades y en la posibilidad teórica de mayores efectos adversos, además de la dificultad de hacer diseños metodológicos adecuados para la experimentación en este grupo.
+
+En 2020, Lyons et al [11] publicaron una revisión sistemática de la bibliografía acerca del uso de TC en lactantes menores de 2 años. Se incluyeron 33 artículos con 534 pacientes, con baja calidad metodológica; solamente dos de los estudios incluyeron a algún paciente menor de 28 días en el inicio de la TC. Los autores encontraron que el 59% de los lactantes presentó una mejoría >50% de las crisis y el 33% logró la libertad de crisis, y en general se pre-
+Departamento de Pediatría y Puericultura. Universidad de Antioquia (C. Serrano-Tabares, J. Trujillo-Gómez, M.J. JiménezVillegas). Clínica Universitaria Bolivariana (CUB) (C. SerranoTabares, R.M. Morales-Gil, Y. 
+
+Aguilar-Pérez). Hospital General de Medellín (J. Trujillo-Gómez). Instituto Neurológico de Colombia. Medellín (M.J. Jiménez-Villegas). Clínica SOMER. Rionegro, Colombia (M.J. Jiménez-Villegas). Correspondencia: Dra. M. José Jiménez-Villegas. Instituto Neurológico de Colombia. Cl. 55 \#46-36. Medellín, Antioquia, Colombia. E-mail: mariaj.jimenezv@gmail.com Aceptado tras revisión externa: 03.11.22. Conflicto de intereses: Los autores declaran no tener conflictos de intereses. Cómo citar este artículo: Serrano-Tabares C, Trujillo-Gómez J, Morales-Gil RM, Aguilar-Pérez Y, Jiménez-Villegas MJ. Tolerancia y respuesta a la terapia cetógena en neonatos y lactantes menores de 4 meses. Serie de casos en un centro hospitalario de Medellín, Colombia. Rev Neurol 2022; 75: 305-10. doi: 10.33588/ rn.7510.2022134. English version available at www.neurologia.com © 2022 Revista de Neurología sentaron pocos efectos adversos. En el mismo año, Falsaperla et al publicaron una revisión de la bibliografía y el estado del arte [12]; se incluyeron 50 artículos de TC con énfasis en menores de 2 años, y concluyeron que la TC y sus variantes son seguras y útiles en el tratamiento de la epilepsia refractaria de pacientes entre 0 y 23 meses. Ambos artículos concluyen que se requieren más estudios con calidad metodológica acerca del uso de TC en neonatos y lactantes. 
+
+No existen guías que den una directriz precisa respecto al empleo de la TC en neonatos. Contamos solamente con un consenso de expertos publicado en 2016 que aportó recomendaciones respecto al inicio y el seguimiento de la TC en lactantes 
+[13], pero no incluye a recién nacidos. Tampoco tenemos en nuestro medio estudios que describan la utilidad de esta opción terapéutica en los primeros meses de vida. Por eso, describimos la experiencia de la Clínica Universitaria Bolivariana en la ciudad de Medellín con el uso de TC en neonatos y lactantes menores de 4 meses. 
+
+## Pacientes Y Métodos
+
+Se realizó un estudio de tipo descriptivo de una serie de casos. Los coinvestigadores revisaron de manera retrospectiva las historias clínicas de pacientes neonatos y lactantes menores de 4 meses con epilepsia refractaria que recibieron TC entre 2015 y 2021 en la institución, y consignaron la información en un formulario de Excel diseñado con celdas de validación para disminuir errores de tecleado. Se obtuvo la siguiente información: antecedentes perinatales: edad gestacional al nacer, antropometría, puntuación de Apgar, características eléctricas y clínicas de las crisis epilépticas antes del inicio de la TC, etiología de la epilepsia, estado nutricional, tipo de fórmula y relación empleada al inicio y al final, impacto en el número de crisis y en el electroencefalograma después del inicio de la DC; y efectos adversos presentados: hipoglucemia, diarrea, estreñimiento, vómito, acidosis metabólica, dislipidemia, afectación de pruebas hepáticas y peso; además, se recogió información relacionada con la lactancia materna durante su realización.
+
+Los estudios realizados fueron parte de las conductas médicas llevadas a cabo por el servicio de neurología pediátrica como parte del enfoque diagnóstico de cada paciente. A todos se les realizó un electroencefalograma, una resonancia magnética cerebral y estudios bioquímicos básicos. En los pacientes en quienes no se encontró una etiología clara de su epilepsia, se hicieron estudios metabólicos (amonio, lactato, aminoácidos cuantitativos en la sangre y el líquido cefalorraquídeo, ácidos orgánicos cuantitativos en la orina y perfil de acilcarnitinas). En Colombia, el cribado neonatal para errores innatos del metabolismo no se realiza de manera rutinaria. Los estudios bioquímicos son costosos y los resultados se demoran. Por eso, se realizaron estos estudios sólo en los pacientes con sospecha de epilepsia genética o metabólica. En los pacientes en los cuales la causa de la epilepsia era clara (estructural o hipóxico-isquémica) no esperamos estos resultados, ya que retrasaban el inicio de la terapia y posiblemente empeorarían el pronóstico. La TC se indicó por neurología pediátrica de la institución al considerar que el paciente presentaba epilepsia refractaria y no existían contraindicaciones para su inicio. Se obtuvo consentimiento informado de los padres antes del inicio de la dieta. El equipo de nutrición verificó datos en relación con la antropometría, el uso de lactancia materna y requerimientos nutricionales, así como la ausencia de condiciones que contraindicaran el inicio de la TC. Se inició con fórmula en polvo con alto contenido de grasas y bajo contenido de carbohidratos. Se calculó el inicio de la dieta con tasa 1:1 o 2:1, y después de una semana se avanzó a tasa 4:1. La fórmula comercial Ketocal® se usó en todos los pacientes excepto uno. El paciente 3 recibió Ketovolve®. La elección de la fórmula se basó en la facilidad de su consecución en el momento de la iniciación. El paciente 1, cuya epilepsia tenía etiología genética (encefalopatía por glicina), recibió formula cetógena regular con restricción proteica de 2-2,5 g/kg/día. 
+
+El análisis estadístico fue de tipo descriptivo. Se usó Excel 2010 como programa de análisis estadístico. Para las variables cualitativas, se expresaron en frecuencias relativas y absolutas. Para las variables cuantitativas, se expresaron en media con su desviación estándar si tenían distribución normal; en caso contrario, se expresaron como mediana y rango intercuartílico. El estudio fue aprobado por el Comité de Ética de la Clínica Universitaria Bolivariana.
+
+## Resultados
+
+Se ingresó a siete pacientes en el estudio. Todos fueron recién nacidos a término con peso adecuado al nacer. Todos los pacientes presentaron crisis epilépticas el primer día de vida, excepto uno, que empezó a los 45 días. Todos los pacientes presentaron crisis epilépticas frecuentes, de ocurrencia diaria o 
+
+| Tabla. Características clínicas y demográficas. Paciente 1                                                                             | Paciente 2                           | Paciente 3                         | Paciente 4           | Paciente 5           | Paciente 6           | Paciente 7         |                    |
+|----------------------------------------------------------------------------------------------------------------------------------------|--------------------------------------|------------------------------------|----------------------|----------------------|----------------------|--------------------|--------------------|
+| Peso al nacer (gramos)                                                                                                                 | 3.400                                | 3.700                              | 3.250                | 2.480                | 4.050                | 2.985              | 3.505              |
+| Edad en la primera  crisis epiléptica                                                                                                  | Día 1                                | Día 45                             | Día 1                | Día 1                | Día 1                | Día 1              | Día 1              |
+| Crisis eléctricas  predominantes/ tónicas, clónicas,  espasmos                                                                         |                                      |                                    |                      |                      |                      |                    |                    |
+| Clínicas-eléctricas/                                                                                                                   |                                      |                                    |                      |                      |                      |                    |                    |
+| Tipo de crisis epiléptica                                                                                                              | clónicas,                            |                                    |                      |                      |                      |                    |                    |
+| mioclónicas, tónicas                                                                                                                   | Clínicas-eléctricas/                 | Clínicas-eléctricas/               | Clínicas-eléctricas/ | Clínicas-eléctricas/ | Clínicas-eléctricas/ |                    |                    |
+| espasmos                                                                                                                               | clónicas, tónicas                    | tónicas                            | clónicas             | tónicas, clónicas    |                      |                    |                    |
+| epilépticos                                                                                                                            |                                      |                                    |                      |                      |                      |                    |                    |
+| Frecuencia de crisis                                                                                                                   | 3-4 veces a                          |                                    |                      |                      |                      |                    |                    |
+| antes de la TC                                                                                                                         | la semana                            | Diarias                            | Diarias              | Diarias              | Diarias              | Diarias            | Diarias            |
+| Estructural                                                                                                                            |                                      |                                    |                      |                      |                      |                    |                    |
+| (encefalomalacia  multiquística  secundaria a asfixia  perinatal)                                                                      | Estructural                          |                                    |                      |                      |                      |                    |                    |
+| (encefalomalacia  multiquística  secundaria a asfixia  perinatal)                                                                      |                                      |                                    |                      |                      |                      |                    |                    |
+| Metabólica                                                                                                                             |                                      |                                    |                      |                      |                      |                    |                    |
+| Etiología de                                                                                                                           | Desconocida                          | Genética (mutación                 |                      |                      |                      |                    |                    |
+| (encefalopatía por                                                                                                                     | de KCNQ2)                            | Desconocida                        |                      |                      |                      |                    |                    |
+| la epilepsia                                                                                                                           | glicina)                             | Estructural  (paquigiria  extensa) |                      |                      |                      |                    |                    |
+| Medicamentos                                                                                                                           | FNB, LVT                             | FNB, LVT, VGB, OXC                 | FNB, LVT, CBZ,       |                      |                      |                    |                    |
+| anticonvulsivantes                                                                                                                     | VGB, AV, TPM                         | FNB, LVT, TPM                      | FNB, LVT, TPM        | FNB, LVT, VGB, CBZ   | FNB, LVT             |                    |                    |
+| predieta  Edad de inicio de la TC  (días)                                                                                              | 40                                   | 120                                | 40                   | 24                   | 17                   | 24                 | 9                  |
+| Relación de la TC inicial/ final                                                                                                       | 1:1/4:1                              | 1:1/4:1                            | 1:1/3:1              | 1:1/4:1              | 1:1/4:1              | 1:1/4:1            | 2:1/4:1            |
+| Vía de administración                                                                                                                  | Sonda nasogástrica                   | Oral                               | Oral                 | Oral                 | Sonda nasogástrica   | Sonda nasogástrica | Sonda nasogástrica |
+| Efectos adversos                                                                                                                       | Ninguno                              | Hipertrigliceridemia  leve         | Hipoglucemia         | Ninguno              | Ninguno              | Ninguno            | Ninguno            |
+| Control de crisis después de la dieta cetógena >50%                                                                                    | >50%                                 |                                    |                      |                      |                      |                    |                    |
+| A la semana                                                                                                                            | (la encefalopatía                    | >50%                               | 100%                 | (la encefalopatía    | >50%                 | >50%               | >50%               |
+| mejoró)                                                                                                                                | mejoró)                              |                                    |                      |                      |                      |                    |                    |
+| Al mes                                                                                                                                 | >50%                                 | 100%                               | 100%                 | > 50%                | >50%                 | >50%               | >50%               |
+| Se perdió en  el seguimiento                                                                                                           |                                      |                                    |                      |                      |                      |                    |                    |
+| A los seis meses                                                                                                                       | >50%                                 | 100%                               | 100%                 | 100%                 | por motivos          |                    |                    |
+| socioeconómicos                                                                                                                        | Abandono de la  terapia por decisión | 100%                               |                      |                      |                      |                    |                    |
+| de la madre                                                                                                                            |                                      |                                    |                      |                      |                      |                    |                    |
+| AV: ácido valproico; CBZ: carbamacepina; FNB: fenobarbital: LVT: levetiracetam; OXC: oxcarbacepina; TPM: topiramato; VGB: vigabatrina. |                                      |                                    |                      |                      |                      |                    |                    |
+
+varias veces a la semana. Los datos demográficos y las características clínicas se presentan en la tabla. La etiología de la epilepsia fue heterogénea. 
+
+El promedio de edad de inicio de la TC fue a los 24 días de vida, con un rango entre los 9 días y los 4 meses. Seis de los pacientes estaban hospitalizados en el momento del inicio de la TC y uno de ellos se inició ambulatoriamente. De los siete pacientes, cuatro estaban recibiendo lactancia materna en el inicio de la TC, la cual se continuó con leche materna extraída, mientras la terapia tuviera una tasa cetógena 1:1 o 2:1. Ésta se suspendió en el momento de avanzar a la tasa 4:1 por el contenido de carbohidratos que exige esta relación. Se inició la TC con una relación 1:1 en seis pacientes y 2:1 en un paciente, y se ascendió hasta 4:1 en todos los pacientes menos en uno, en el que se llegó hasta la relación 3:1.
+
+Todos los pacientes ingresaron a un programa de TC. Cada mes se realizó seguimiento por nutrición, en cada visita se indagó por el control de las crisis, la tolerancia y la adhesión a la TC, y se realizó una evaluación del estado nutricional. De los siete pacientes, dos no continuaron con la TC. Uno de ellos (paciente 6) la suspendió por decisión de la madre a los 2 meses de vida, pero sin notificar efectos adversos. Adicionalmente, en la paciente 5, no se logró realizar adecuadamente el seguimiento después de los 2 meses de vida por dificultades con su seguridad social.
+
+Al mes de inicio de la TC, 5/7 pacientes presentaron mejoría parcial (>50% de las crisis), y 2/7, mejoría completa (el 100% de las crisis). A los seis meses, se tenían datos de cinco pacientes. Cuatro presentaron mejoría completa de las crisis epilépticas, y uno, mejoría parcial. Adicionalmente, en dos pacientes (pacientes 1 y 4) se logró identificar también una mejoría en el estado de alertamiento y de la encefalopatía de base. 
+
+En cuanto a los efectos adversos, ninguno notificó intolerancia gastrointestinal significativa que requiriera ajustes o suspensión de la TC. Un paciente describió episodios de hipoglucemia leve asociados a vómito en el inicio de la dieta, que no tuvo recurrencia (paciente 3). Se obtuvieron datos de perfil lipídico en el seguimiento en 4/7 pacientes, de los cuales sólo en uno se observó hipertrigliceridemia leve (paciente 2).
+
+## Discusión
+
+En esta serie de casos describimos la experiencia con el uso de TC en siete pacientes, en su mayoría neonatos, con epilepsia de inicio el primer día posnatal que rápidamente cumplieron criterios de refractariedad y con inicio de la TC durante las primeras 6 semanas de vida en 6/7 pacientes, con una buena respuesta inicial en todos y efectos adversos leves, ninguno que llevara a la suspensión del tratamiento. Ningún paciente requirió reducción o suspensión de la TC. 
+
+La etiología de la epilepsia en nuestro grupo de pacientes fue variada, lo que apoya la utilidad de la TC para el tratamiento de la epilepsia refractaria de diversas etiologías. La decisión de iniciar la TC se tomó según la identificación de la etiología y el fallo de los medicamentos anticrisis, buscando controlar las crisis epilépticas e impactar en el neurodesarrollo.
+
+Recientemente, Dressler y Trimmel-Schwahofer 
+[8] describieron 20 estudios de TC en niños, que incluyeron también niños menores de un año de vida, pero no se incluyeron neonatos. Se incluyeron informes de casos y estudios de cohorte, y encontraron una reducción >50% de las crisis en el 48-80% 
+de los pacientes y libertad de crisis en el 14-54%. Se describieron pocos efectos adversos. Esta publicación no informa de un análisis completo del perfil de efectos adversos en menores de 12 meses.
+
+Thompson et al [9] describieron el uso de TC en cuatro lactantes menores en una unidad de cuidados intensivos neonatales. La edad mínima de inicio de la dieta fue 6 semanas. Informaron de mejoría subjetiva de las crisis en tres ellos y un bajo perfil de efectos adversos en todos. Le Pichon et al 
+[14], en un estudio de cohorte en el cual incluyeron a nueve lactantes con epilepsia refractaria, con edades entre 1 y 13 meses, describieron la experiencia con el uso de TC y el empleo simultáneo de leche materna. Encontraron que cuatro de ellos tuvieron una disminución >50% de las crisis en la primera visita, tres presentaron una mejoría completa de las crisis y en uno no se encontró respuesta. La dieta se toleró bien en general, aunque un niño requirió hospitalización por acidosis y deshidratación. Estos datos son similares a los nuestros en cuanto a reducción de crisis, tolerancia y pocos efectos adversos. 
+
+Nosotros iniciamos la TC el primer mes de vida en cuatro de los pacientes, incluso tan temprano como al día 9 de vida en uno de ellos, con una mejoría significativa en todos. En la bibliograf ía son escasos los estudios que han incluido a pacientes con inicio de TC durante el primer mes de vida, y en nuestro conocimiento, no hay informes de inicio a edad tan temprana. En nuestros pacientes, logramos un control de las crisis que superó el 50% de forma temprana y segura. Los dos pacientes que abandonaron el tratamiento no lo hicieron por efectos secundarios, sino por decisiones parentales o dificultades para la entrega de la fórmula por parte de su asegurador. Adicionalmente, la administración de la dieta fue fácil a través de fórmulas lácteas comerciales y con un incremento de la relación según la tolerancia metabólica y gastrointestinal. Resaltamos, además, que en dos pacientes se logró identificar una mejoría significativa en el estado de alertamiento. Esto es importante, ya que se ha demostrado que los efectos positivos de la TC van más allá del control de las crisis epilépticas [15,16]. 
+
+Esto puede explicarse por los múltiples mecanismos de acción que se han descrito y que van más allá de la producción de cetosis [17]. 
+
+Los efectos secundarios fueron poco frecuentes. 
+
+Se presentó hipoglucemia e hipertrigliceridemia leve, cada una en un paciente. Fueron temporales y no requirieron suspensión de la terapia. La hipoglucemia suele ser más frecuente en el inicio de la TC [13,18]. De igual manera, la dislipidemia suele presentarse de forma más frecuente en las primeras semanas de su uso, y normalmente cede en los siguientes meses [19,20]. 
+
+## Limitaciones
+
+Reconocemos varias limitaciones en nuestro estudio. Las principales son el pequeño número de pacientes y el carácter retrospectivo del estudio, así como la pérdida de dos de los pacientes en el seguimiento. 
+
+Adicionalmente, nos tuvimos que enfrentar a una realidad inherente al sistema de salud de nuestro país, y es que actualmente la TC no se encuentra fácilmente disponible. Esto genera dificultades en cumplimiento de la terapia y puede desmotivar su uso en pacientes que podrían beneficiarse de ella, lo que pone de manifiesto la necesidad de informar de las experiencias tempranas. Se requieren más estudios como éste que permitan su aprobación universal. 
+
+## Conclusión
+
+En esta serie de casos pudimos mostrar una experiencia exitosa con el uso de TC en neonatos y lactantes menores. Si bien está claro que éste es apenas un estudio inicial de un número bajo de pacientes, es muy valioso poder mostrar que, de una manera rápida y segura, se logró un buen control de las crisis epilépticas, sin efectos secundarios graves. Es importante continuar la investigación en el uso de TC en neonatos y lactantes menores en estudios prospectivos y con mayor número de pacientes, considerando el seguimiento a largo plazo de control de crisis, neurodesarrollo, estudios de laboratorio, electroencefalograma y neuroimágenes. La publicación de estos datos puede promover el uso de la terapia en edades más tempranas.
+
+## Bibliografía
+
+1. Glass HC, Shellhaas RA, Wusthoff CJ, Chang T, Abend NS, 
+Chu CJ, et al. Contemporary profile of seizures in neonates: a prospective cohort study. J Pediatr 2016; 174: 98-103.
+
+2. Stevenson NJ, Boylan GB, Hellström-Westas L, Vanhatalo S. 
+
+Treatment trials for neonatal seizures: the effect of design on sample size. PLoS One 2016; 11: e0165693. 
+
+3. El-Dib M, Soul JS. The use of phenobarbital and other anti-seizure drugs in newborns. Semin Fetal Neonatal Med 2017; 22: 321-7. 
+
+4. Pressler RM, Boylan GB, Marlow N, Blennow M, Chiron C, 
+Cross JH, et al. Bumetanide for the treatment of seizures in newborn babies with hypoxic ischaemic encephalopathy (NEMO): an open-label, dose finding, and feasibility phase 1/2 trial. Lancet Neurol 2015; 14: 469-77. 
+
+5. Martin-McGill KJ, Jackson CF, Bresnahan R, Levy RG, 
+Cooper PN. Ketogenic diets for drug-resistant epilepsy. Cochrane Database Syst Rev 2018; 11: CD001903. 
+
+6. Luz IR, Pereira C, Garcia P, Ferreira F, Faria A, MacEdo C, 
+et al. Ketogenic diet for refractory childhood epilepsy: beyond seizures control, the experience of a Portuguese pediatric centre. Acta Med Port 2019; 32: 760-6. 
+
+7. Ismayilova AN, Leung M, Kumar R, Smith M, Williams RE. 
+
+Ketogenic diet therapy in infants less than two years of age for medically refractory epilepsy. Seizure 2018; 57: 5-7. 
+
+8. Dressler A, Trimmel-Schwahofer P. The ketogenic diet for infants: how long can you go? Epilepsy Res 2020; 164: 106339. 
+
+9. Thompson L, Fecske E, Salim M, Hall A. Use of the ketogenic diet in the neonatal intensive care unit − Safety and tolerability. Epilepsia 2017; 58: e36-9. 
+
+10. Wirrell E, Eckert S, Wong-Kisiel L, Payne E, Nickels K. 
+
+Ketogenic diet therapy in infants: efficacy and tolerability. Pediatr Neurol 2018; 82: 13-8. 
+
+11. Lyons L, Schoeler NE, Langan D, Cross JH. Use of ketogenic diet therapy in infants with epilepsy: a systematic review and meta-analysis. Epilepsia 2020; 61: 1261-81. 
+
+12. Falsaperla R, D'Angelo G, Praticò AD, Mauceri L, Barbagallo M, Pavone P, et al. Ketogenic diet for infants with epilepsy: a literature review. Epilepsy Behav 2020; 112: 107361. 
+
+13. van der Louw E, van den Hurk D, Neal E, Leiendecker B, 
+Fitzsimmon G, Dority L, et al. Ketogenic diet guidelines for infants with refractory epilepsy. Eur J Paediatr Neurol 2016; 20: 798-809. 
+
+14. Le Pichon JB, Thompson L, Gustafson M, Abdelmoity A. 
+
+Initiating the ketogenic diet in infants with treatment refractory epilepsy while maintaining a breast milk diet. Seizure 2019; 69: 41-3. 
+
+15. van Berkel AA, IJff DM, Verkuyl JM. Cognitive benefits of the ketogenic diet in patients with epilepsy: a systematic overview. Epilepsy Behav 2018; 87: 69-77. 
+
+16. Hallböök T, Ji S, Maudsley S, Martin B. The effects of the ketogenic diet on behavior and cognition. Epilepsy Res 2012; 100: 304-9. 
+
+17. Boison D. New insights into the mechanisms of the ketogenic diet. Curr Opin Neurol 2017; 30: 187-92. 
+
+18. Lin A, Turner Z, Doerrer SC, Stanfield A, Kossoff EH. 
+
+Complications during ketogenic diet initiation: prevalence, treatment, and influence on seizure outcomes. Pediatr Neurol 2017; 68: 35-9. 
+
+19. Kossoff EH, Zupec-Kania BA, Auvin S, Ballaban-Gil KR, 
+Christina Bergqvist AG, Blackford R, et al. Optimal clinical management of children receiving dietary therapies for epilepsy: updated recommendations of the International Ketogenic Diet Study Group. Epilepsia Open 2018; 3: 175-92. 
+
+20. Nizamuddin J, Turner Z, Rubenstein JE, Pyzik PL, Kossoff EH. Management and risk factors for dyslipidemia with the ketogenic diet. J Child Neurol 2008; 23: 758-61. 
+
+## Tolerance And Response To Ketogenic Therapy In Neonates And Infants Younger Than 4 Months. Case Series In A Hospital Center In Medellín, Colombia
+
+Introduction. Ketogenic therapy (KT) studies have focused in children older than 2 years and adults. Recently its efficacy in infants has been reported, but there are few studies in this age group. Patients and methods. We report a case series of nine newborn and children younger than 4 months of age with refractory epilepsy treated with KT. We retrospectively reviewed charts of children treated at our center between 2015-2021. Results. Data was collected on seven patients. Six patients began having seizures on day one of life, one had seizures starting on day 45. Different epilepsy etiologies were found. KT was started as soon as 9 days of life. The average age at which ketogenic therapy was started was 24 days of life. Initially, the diet was started at 1:1 or 2:1 ratio, and was progressed to a 4:1 ratio. After one month of KT 5/7 patients experienced a significant reduction in seizure frequency (>50%) and 2/7 had complete seizure control. At six months, 4/7 patients achieve complete seizure freedom and 1/7 had >50% seizure reduction. Two patients were lost to follow-up. None of our patients reported gastrointestinal side effects that required diet adjustments. One patient had mild and one mild hypertriglyceridemia. Conclusion. Even though evidence about KT in young children are starting to emerge, our experience shows it can be successful in controlling seizure burden without considerable adverse effects. There is great research potential regarding KT in young children. Key words. Epilepsy. Ketogenic diet. Ketogenic therapy. Neonatal epilepsy. Neonatal seizures. Refractory epilepsy.

medical/md/PMC10534064.md

@@ -0,0 +1,205 @@
+# —Full Paper— Effects Of Resveratrol And Its Analogues On The Cell Cycle Of Equine Mesenchymal Stem/Stromal Cells
+
+Norihisa TAMURA1,2***, Neda HEIDARI2, Richard G.A. FARAGHER3,** 
+Roger K.W. SMITH2 and Jayesh DUDHIA2 1Clinical Veterinary Medicine Division, Equine Research Institute, Japan Racing Association, Tochigi 329-0412, Japan 2Department of Clinical Sciences and Services, Royal Veterinary College, University of London, Hatfield AL9 7TA, UK 3School of Pharmacy and Biomolecular Sciences, University of Brighton, Brighton BN2 4GJ, UK
+Resveratrol (RSV; trans-3,5,4′-trihydroxystilbene) strongly activates sirtuin 1, and it and its analogue V29 enhance the proliferation of mesenchymal stem/stromal cells (MSCs). Although culture medium containing 5‐azacytydine and RSV inhibits senescence of adipose tissue–derived MSCs isolated from horses with metabolic syndrome, few studies have reported the effects of RSV on equine bone marrow–derived MSCs (eBMMSCs) isolated from horses without metabolic syndrome. The aim of this study was to investigate the effects of RSV and V29 on the cell cycle of eBMMSCs. Following treatment with 5 µM RSV or 10 µM V29, the cell proliferation capacity of eBMMSCs derived from seven horses was evaluated by EdU (5-ethynyl-2′-deoxyuridine) and Ki-67 antibody assays. Brightfield images of cells and immunofluorescent images of EdU, Ki-67, and DAPI staining were recorded by fluorescence microscopy, and the number of cells positive for each was quantified and compared by Friedman's test at P<0.05. The growth fraction of eBMMSCs was significantly increased by RSV and V29 as measured by the EdU assay (control 28.1% ± 13.8%, V29 31.8% ± 14.6%, RSV 32.0% ± 10.8%; mean ± SD; P<0.05) but not as measured by the Ki-67 antibody assay (control 27.0% ± 11.2%, V29 27.4% ± 10.8%, RSV 27.7% ± 6.8%). RSV and V29 promoted progression of the cell cycle of eBMMSCs into the S phase and may be useful for eBMMSC expansion. Key words: *cell cycle, mesenchymal stem cell, resveralogue, resveratrol*
+
+| J. Equine Sci. Vol. 34, No. 3 pp. 67–72, 2023   |
+|-------------------------------------------------|
+
+Resveratrol (RSV; *trans*-3,5,4′-trihydroxystilbene) is a plant polyphenol and is found at high concentrations in grape skin and wine [7]. It has beneficial effects on disorders such as osteoarthritis [31], metabolic diseases [13], and inflammatory bowel disease [22]. RSV has a strong effect on the inflammatory phenotype of senescent cells and can reverse cell senescence [18]. Investigations of its effects on mesenchymal stem/stromal cells (MSCs) are increasing in the field of human regenerative medicine [14] because of its strong activation of sirtuin 1 (SIRT1), which is associated with biological aging [5, 26, 34]. Long-term culture of human MSCs decreases SIRT1 [39, 40], but RSV activates SIRT1 to promote cell cycling, survival, and proliferation of MSCs [8, 23, 36]. Studies suggest that RSV could improve the therapeutic efficacy of human regenerative medicine [27, 29] through its actions via multiple pathways [10] in addition to its canonical SIRT1 activity [30]. Analogues and prodrugs of RSV have recently been developed that can act via SIRT1-dependent or SIRT1-independent activity [2, 3, 18, 37].
+
+Equine MSCs are used in equine regenerative medicine 
+[11, 24]. Equine MSC therapies were effective in treating musculoskeletal diseases of tendons, ligaments, and joints [9, 25, 32]. One study [35] showed promising results in the treatment of tendon injury with a local administration of 2 × 107 MSCs into lesions, much higher than the 1 × 106 MSCs reported in a previous study [4]. The use of MSC-derived extracellular vesicles prepared from culture media of highly culture-expanded MSCs is also increasing in equine regenerative medicine [12, 24]. These approaches require significant scale-up in the manufacture of MSCs, which is a major challenge for efficient methods of sustained cell proliferation and maintenance of the quality of equine MSCs, to realize the clinical use of these therapies [11].
+
+Several studies have reported the effects of RSV on equine MSCs. Culture media containing 5-azacytydine and RSV inhibited senescence of adipose tissue–derived MSCs isolated from horses with metabolic syndrome and promoted cell proliferation, osteogenesis, and chondrogenesis [16, 19, 20]. However, few studies have reported the effects of RSV on equine bone marrow–derived MSCs (eBMMSCs) isolated from horses without metabolic syndrome, and to the best of our knowledge, no studies have reported the effects of novel RSV analogues (resveralogues) on eBMMSCs.
+
+The aim of this *in vitro* study was to investigate the effects of RSV and V29, a novel analogue of RSV [3], on the cell cycle of eBMMSCs.
+
+## Materials And Methods Ebmmsc Culture
+
+The study was approved by the Ethics and Welfare Committee of the Royal Veterinary College (ref. URN 2022 2127-2). The authors have no competing interests.
+
+Standard culture medium (D10) contained Dulbecco's Modified Eagle's Medium (DMEM) with 1 g/l of glucose (31885023, Gibco, Thermo Fisher Scientific, London, UK) 
+supplemented with 10% heat-inactivated FBS and 1% penicillin/streptomycin (all Gibco, Thermo Fisher Scientific).
+
+Equine MSCs were derived from bone marrow aspirates of horses (n=7) for isolation, expansion, and osteogenic, adipogenic, and chondrogenic differentiation as described previously [32]. The eBMMSCs were stored in liquid nitrogen with 1 ml aliquots of cell freezing medium (Cell-banker 2, AMS Biotechnology, London, UK ) in accordance with the manufacturer's instructions. The passage number of the eBMMSCs at freezing was 2.1 ± 1.1 (2.0).
+
+eBMMSCs were rapidly thawed in a 37°C water bath, immediately diluted in 10 ml of D10, and then centrifuged at 300 × g for 5 min at 21°C (Rotina 380 R, Andreas Hettich GmbH, Germany). The cell pellet was suspended in 15 ml D10. The MSCs were seeded in a 75-cm2 flask and incubated at 37°C in humidified 5% CO2 (CB 170, Binder GmbH, Tuttlingen, Germany). The medium was replaced after 24 hr to remove non-adherent cells and then replaced every 2 to 3 days until the cells reached 80% confluence. Cell cultures were passaged for experimental treatment as describe below.
+
+of both were prepared in DMSO (Invitrogen, Thermo Fisher Scientific) and diluted into working solutions with D10. The working solutions were used at final concentrations of 5 and 10 µM, respectively, at which both enhance proliferation of human fibroblasts [3] and are not toxic.
+
+Treatment with resveratrol and V29 Cells were detached from flasks with TrypLE Express 
+(Gibco, Thermo Fisher Scientific, UK) and centrifuged at 300 × g for 5 min at 21°C. The cell pellet was suspended in 1 ml of culture medium, and the cell concentration was assessed with an automated cell counter (Countess II FL, Thermo Fisher Scientific).
+
+For experiments, eBMMSCs were seeded into 12-well plates at 8 × 103 cells/well in D10 and allowed to adhere for 24 hr. Non-adherent cells were carefully removed by washing with phosphate-buffered saline (PBS; Gibco, Thermo Fisher Scientific). Cells were then treated with 2 ml of D10 (control group), 10 µM V29 in D10 (V29 group), or 5 µM RSV solution in D10 (RSV group) and incubated for 24 hr. The medium was then discarded, and the cells washed with PBS before culture in D10 for a further 72 hr.
+
+The population doubling level (PDL) of eBMMSCs was calculated as PDL=3.322 (logNend − logNini) + PDLini, where Nend was the cell number at the end of the growth period, Nini was that at the beginning of the growth period, and PDLini was the initial population doubling level, which was assumed to be 11 for all eBMMSCs.
+
+## Cell Proliferation Assay
+
+The cell proliferation rate was evaluated with an EdU 
+(5-ethynyl-2′-deoxyuridine) labelling kit (Click-iT Plus EdU Cell Proliferation Kit for Imaging Alexa Fluor 594, Gibco) and Ki-67 antibody (Recombinant Alexa Fluor 488 Anti-Ki-67, Abcam) in accordance with the manufacturers' instructions. Cells were labelled with EdU in D10 for 3 hr, washed with PBS, fixed in 3.7% paraformaldehyde for 15 min, permeabilized with 0.5% Triton X-100 in PBS for 15 min at room temperature, incubated overnight in blocking buffer (1% bovine serum albumin, 0.1% Triton X-100 in PBS), and then incubated with EdU reaction solution for 30 min at room temperature in the dark.
+
+After washing with PBS, cells were incubated with Ki-67 antibody diluted 1:50 with 3% bovine serum albumin in PBS for 3 hr at room temperature in the dark. Cell nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific).
+
+Preparation of resveratrol and V29 Resveratrol was purchased (ab120726, Abcam, London, UK) and V29 was synthesized in house [3]. Stock solutions Image analysis Brightfield images of cells and immunofluorescent images of EdU (red), Ki-67 (green), and DAPI (blue) 
+staining in the same region of interest were recorded by fluorescence microscopy (EVOS FL, Thermo Fisher Scien-tific; Fig. 1).
+
+The numbers of cells positive for EdU, Ki-67, and DAPI 
+staining were quantified in the ImageJ v. 1.53t software (National Institutes of Health, Bethesda, MD, USA) [28]. To evaluate the proliferating fraction, at least 1,000 total nuclei were counted in random regions in each well, and the percentage of EdU- or Ki-67-positive cells was calculated.
+
+## Statistical Analysis
+
+![2_Image_0.Png](2_Image_0.Png)
+
+Data are expressed as the mean ± standard deviation 
+(median in parentheses). Friedman's test with Dunn's *post* hoc test was used to determine the significance of differences between treatment groups at P<0.05 in the GraphPad Prism v. 7.04 software (GraphPad Software, San Diego, CA, USA).
+
+## Results
+
+Microscopic observation confirmed good growth and proliferation of all eBMMSCs. The passage number and PDL of eBMMSCs at the time of treatment were 3.4 ± 1.2 (3.0) and 16.2 ± 3.9 (15.5), respectively.
+
+The percentages of EdU-positive cells were 28.1% 
+± 13.8% (31.3%) in the control group, 31.8% ± 14.6% (37.0%) in the V29 group, and 32.0% ± 10.8% (36.5%) in the RSV group, with those of the V29 and RSV groups being significantly higher than that of the control group (Fig. 2).
+
+The percentages of Ki-67-positive cells were 27.0% 
+± 11.2% (28.5%) in the control group, 27.4% ± 10.8% (25.1%) in the V29 group, and 27.7% ± 6.8% (26.5%) in the RSV group, with no significant difference among the groups (Fig. 3).
+
+![2_image_1.png](2_image_1.png)
+
+Fig. 2. Proportions of EdU-labelled cells following treatment with V29 or RSV. Values are indicated as the mean ± standard deviation (error bars), and median values are indicated by an x. Different letters above groups indicates statistical significance (P<0.05 by Friedman's test).
+
+## Discussion
+
+The purpose of this study was to evaluate the effects of RSV and V29, a novel resveralogue, on the cell cycle of eBMMSCs. The Ki-67 assay is generally used to evaluate the whole cell cycle, because Ki-67 is a nuclear protein antigen that is expressed in cells during all phases of the cell cycle but is strongly downregulated during the G0 phase [15]. In this study, it revealed no significant differences among the three groups. Although some antioxidants show cytotoxic effects on MSCs [14], neither of the RSV and V29 concentrations used in this study adversely affected the eBMMSCs. EdU staining is an excellent indicator of cell proliferation [6] owing to its incorporation into newly synthesized DNA by cells during the S phase. The proportion of EdU-labelled cells during the same incubation period was dependent on the cell type because of their differences in cell cycle acceleration [21]. The percentages of EdUpositive cells were significantly higher in both the RSV and V29 groups than in the control group. Our results indicate that both RSV and V29 promoted progression of the cell cycle of eBMMSCs to the S phase and cell proliferation without affecting the whole cell cycle.
+
+Our results support previous reports that RSV can increase the proportion of human MSCs in the S phase in vitro [23, 36]. They are also consistent with the report that both 10 µM RSV and 5 µM V29 (and other resveralogues) accelerated the cell cycle of human fibroblasts [3].
+
+RSV promotes proliferation of mouse [33] and human MSCs [36, 38]. Our results also suggest that both RSV and V29 would be useful to promote the proliferation of autologous eBMMSCs. Autologous eBMMSCs are widely used to treat musculoskeletal diseases, including injuries of the superficial digital flexor tendon [25, 32], arthritis [9], and laminitis [1]. A longer culture period, however, is required to increase eBMMSCs to sufficient numbers for regenerative therapies in equine clinical use [24]. The use of RSV and V29 to promote progression of the cell cycle to the S phase will contribute to equine regenerative medicine by shortening the period of eBMMSC preparation.
+
+Synthetic analogues and prodrugs of RSV have been developed to enhance pharmacological activity [2, 3, 37]. There are, however, few reports of the effects of these RSV derivatives on MSCs [14]. This study shows the effects of V29 on eBMMSCs for the first time. Our study also revealed that a novel synthesized resveralogue showed similar effects to conventional RSV, because there was no difference between the effects of RSV and those of V29. Several structurally related resveralogues induce higher SIRT1 activation of human fibroblasts and are less toxic to them than RSV [3]. Although further research is needed, our results suggest that other resveralogues may be candidates for enhancing the proliferation of eBMMSCs and motivate the development of new RSV analogues for use in regenerative medicine.
+
+The effects of RSV on cells have been shown to be different depending on the concentration [8, 23, 36]. Although dose-dependent cell proliferation of human MSCs was observed in the range of 0.01 µM to 10 µM of RSV [8], 60 µM RSV caused irreversible cell cycle arrest, DNA damage, and premature senescence in human MSCs [17]. Our previous study also showed that resveralogues promoted cell proliferation at 10 µM but caused increasing cell death at 100 µM due to their toxicity [3]. Several studies of RSV have shown that these concentration-dependent effects vary by animal species, cell origin, and culture duration [8, 14, 33]. Although studies of RSV in equine cells are limited, culture medium containing both 0.5 µM 
+5-azacytydine, which was incorporated into DNA and inhibited the methylation pattern of specific gene regions, and 5 µM RSV induced the proliferation of eMSCs isolated from equine metabolic syndrome cases [16]. Our preliminary experiments performed prior to this study also resulted in increased proliferation of eBMMSCs and equine tendon cells with 10 µM RSV and 10 µM V29 (data not shown). Although the concentrations of RSV and V29 used here promoted cell proliferation in the short period examined, further experiments are necessary to evaluate the effects in long-term cultures or on cells of different ages because it takes approximately one month to culture eBMMSCs for clinical use.
+
+In conclusion, RSV and V29 promoted progression of the cell cycle of eBMMSCs into the S phase. They may be useful for eBMMSC expansion for autologous use but will be especially useful for allogeneic applications where extensive cell expansion is necessary.
+
+## Acknowledgment
+
+The authors acknowledge funding from the UK Horserace Betting Levy Board.
+
+## References
+
+1. Angelone, M., Conti, V., Biacca, C., Battaglia, B., Pecorari, L., Piana, F., Gnudi, G., Leonardi, F., Ramoni, R., 
+Basini, G., Dotti, S., Renzi, S., Ferrari, M., and Grolli, S. 
+
+2017. The contribution of adipose tissue-derived mesenchymal stem cells and platelet-rich plasma to the treatment of chronic equine laminitis: a proof of concept. *Int. J. Mol.* 
+Sci. 18: 18. [Medline] [CrossRef]
+2. Biasutto, L., and Zoratti, M. 2014. Prodrugs of quercetin and resveratrol: a strategy under development. Curr. Drug Metab. 15: 77–95. [Medline] [CrossRef]
+3. Birar, V.C., Sheerin, A.N., Ostler, E.L., and Faragher, R.G.A. 2020. Novel resveratrol derivatives have diverse effects on the survival, proliferation and senescence of primary human fibroblasts. *Biogerontology* 21: 817–826. 
+
+[Medline] [CrossRef]
+4. Caniglia, C.J., Schramme, M.C., and Smith, R.K. 2012. 
+
+The effect of intralesional injection of bone marrow derived mesenchymal stem cells and bone marrow supernatant on collagen fibril size in a surgical model of equine superficial digital flexor tendonitis. *Equine Vet. J.* 44: 587–593. [Medline] [CrossRef]
+5. Chaudhary, N., and Pfluger, P.T. 2009. Metabolic benefits from Sirt1 and Sirt1 activators. Curr. Opin. Clin. Nutr. 
+
+Metab. Care 12: 431–437. [Medline] [CrossRef]
+6. Chehrehasa, F., Meedeniya, A.C., Dwyer, P., Abrahamsen, G., and Mackay-Sim, A. 2009. EdU, a new thymidine analogue for labelling proliferating cells in the nervous system. *J. Neurosci. Methods* 177: 122–130. [Medline]
+[CrossRef]
+7. Chimento, A., De Amicis, F., Sirianni, R., Sinicropi, M.S., 
+Puoci, F., Casaburi, I., Saturnino, C., and Pezzi, V. 2019. Progress to improve oral bioavailability and beneficial effects of resveratrol. *Int. J. Mol. Sci.* 20: 20. [Medline]
+[CrossRef]
+8. Dai, Z., Li, Y., Quarles, L.D., Song, T., Pan, W., Zhou, H., 
+and Xiao, Z. 2007. Resveratrol enhances proliferation and osteoblastic differentiation in human mesenchymal stem cells via ER-dependent ERK1/2 activation. *Phytomedicine* 14: 806–814. [Medline] [CrossRef]
+9. Frisbie, D.D., Kisiday, J.D., Kawcak, C.E., Werpy, N.M., 
+and McIlwraith, C.W. 2009. Evaluation of adipose-derived stromal vascular fraction or bone marrow-derived mesenchymal stem cells for treatment of osteoarthritis. *J. Orthop.* 
+Res. 27: 1675–1680. [Medline] [CrossRef]
+10. Fuggetta, M.P., Bordignon, V., Cottarelli, A., Macchi, B., Frezza, C., Cordiali-Fei, P., Ensoli, F., Ciafrè, S., 
+Marino-Merlo, F., Mastino, A., and Ravagnan, G. 2016. 
+
+Downregulation of proinflammatory cytokines in HTLV1-infected T cells by Resveratrol. *J. Exp. Clin. Cancer Res.*
+35: 118. [Medline] [CrossRef]
+11. Gugjoo, M.B., Amarpal., Makhdoomi, D.M., and Sharma, G.T. 2019. Equine mesenchymal stem cells: properties, sources, characterization, and potential therapeutic applications. *J. Equine Vet. Sci.* 72: 16–27. [Medline] [Cross-Ref]
+12. Hotham, W.E., Thompson, C., Szu-Ting, L., and Henson, F.M.D. 2021. The anti-inflammatory effects of equine bone marrow stem cell-derived extracellular vesicles on autologous chondrocytes. *Vet. Rec. Open* 8: e22. [Medline]
+[CrossRef]
+13. Hou, C.Y., Tain, Y.L., Yu, H.R., and Huang, L.T. 2019. 
+
+The effects of resveratrol in the treatment of metabolic syndrome. *Int. J. Mol. Sci.* 20: 20. [Medline] [CrossRef]
+14. Hu, C., and Li, L. 2019. The application of resveratrol to mesenchymal stromal cell-based regenerative medicine. 
+
+Stem Cell Res. Ther. 10: 307. [Medline] [CrossRef]
+15. Kim, K.H., Sederstrom, J.M. 2015. Assaying cell cycle status using flow cytometry. *Curr. Protoc. Mol. Biol.* 111: 
+28.6.1–28.6.11. [Medline] [CrossRef]
+16. Kornicka, K., Szłapka-Kosarzewska, J., Śmieszek, A., and Marycz, K. 2019. 5-Azacytydine and resveratrol reverse senescence and ageing of adipose stem cells via modulation of mitochondrial dynamics and autophagy. *J. Cell.* 
+Mol. Med. 23: 237–259. [Medline] [CrossRef]
+17. Kornienko, J.S., Smirnova, I.S., Pugovkina, N.A., Ivanova, J.S., Shilina, M.A., Grinchuk, T.M., Shatrova, A.N., 
+Aksenov, N.D., Zenin, V.V., Nikolsky, N.N., and Lyublin-skaya, O.G. 2019. High doses of synthetic antioxidants induce premature senescence in cultivated mesenchymal stem cells. *Sci. Rep.* 9: 1296. [Medline] [CrossRef]
+18. Latorre, E., Birar, V.C., Sheerin, A.N., Jeynes, J.C.C., 
+Hooper, A., Dawe, H.R., Melzer, D., Cox, L.S., Faragher, R.G.A., Ostler, E.L., and Harries, L.W. 2017. Small mol-ecule modulation of splicing factor expression is associated with rescue from cellular senescence. *BMC Cell Biol.*
+18: 31. [Medline] [CrossRef]
+19. Marycz, K., Houston, J.M.I., Weiss, C., Röcken, M., and Kornicka, K. 2019. 5-azacytidine and resveratrol enhance chondrogenic differentiation of metabolic syndromederived mesenchymal stem cells by modulating autophagy. *Oxid. Med. Cell. Longev.* **2019**: 1523140. [Medline]
+[CrossRef]
+20. Marycz, K., Kornicka, K., Irwin-Houston, J.M., and Weiss, C. 2018. Combination of resveratrol and 5-azacytydine improves osteogenesis of metabolic syndrome mesenchymal stem cells. *J. Cell. Mol. Med.* 22: 4771–4793. [Medline]
+[CrossRef]
+21. Nihashi, Y., Umezawa, K., Shinji, S., Hamaguchi, Y., Ko-bayashi, H., Kono, T., Ono, T., Kagami, H., and Takaya, T. 2019. Distinct cell proliferation, myogenic differentiation, and gene expression in skeletal muscle myoblasts of layer and broiler chickens. *Sci. Rep.* 9: 16527. [Medline]
+[CrossRef]
+22. Nunes, S., Danesi, F., Del Rio, D., and Silva, P. 2018. 
+
+Resveratrol and inflammatory bowel disease: the evidence so far. *Nutr. Res. Rev.* 31: 85–97. [Medline] [CrossRef]
+23. Peltz, L., Gomez, J., Marquez, M., Alencastro, F., 
+Atashpanjeh, N., Quang, T., Bach, T., and Zhao, Y. 2012. Resveratrol exerts dosage and duration dependent effect on human mesenchymal stem cell development. *PLoS One* 7: 
+e37162. [Medline] [CrossRef]
+24. Ribitsch, I., Oreff, G.L., and Jenner, F. 2021. Regenerative medicine for equine musculoskeletal diseases. Animals 
+(Basel) 11: 11. [Medline]
+25. Richardson, L.E., Dudhia, J., Clegg, P.D., and Smith, R. 
+
+2007. Stem cells in veterinary medicine--attempts at regenerating equine tendon after injury. *Trends Biotechnol.*
+25: 409–416. [Medline] [CrossRef]
+26. Rodgers, J.T., Lerin, C., Haas, W., Gygi, S.P., Spiegelman, B.M., and Puigserver, P. 2005. Nutrient control of glucose homeostasis through a complex of PGC-1α and SIRT1. 
+
+Nature 434: 113–118. [Medline] [CrossRef]
+27. Saud, B., Malla, R., and Shrestha, K. 2019. A review on the effect of plant extract on mesenchymal stem cell prolif-eration and differentiation. *Stem Cells Int.* **2019**: 7513404. 
+
+[Medline] [CrossRef]
+28. Schneider, C.A., Rasband, W.S., and Eliceiri, K.W. 2012. 
+
+NIH Image to ImageJ: 25 years of image analysis. Nat. 
+
+Methods 9: 671–675. [Medline] [CrossRef]
+29. ShamsEldeen, A.M., Ashour, H., Shoukry, H.S., Fadel, M., 
+Kamar, S.S., Aabdelbaset, M., Rashed, L.A., and Ammar, H.I. 2019. Combined treatment with systemic resveratrol and resveratrol preconditioned mesenchymal stem cells, maximizes antifibrotic action in diabetic cardiomyopathy. 
+
+J. Cell. Physiol. 234: 10942–10963. [Medline] [CrossRef]
+30. Sinclair, D.A., and Guarente, L. 2014. Small-molecule allosteric activators of sirtuins. *Annu. Rev. Pharmacol.* 
+Toxicol. 54: 363–380. [Medline] [CrossRef]
+31. Sirše, M. 2022. Effect of dietary polyphenols on osteoarthritis-molecular mechanisms. *Life (Basel)* 12: 12. [Medline]
+32. Smith, R.K., Werling, N.J., Dakin, S.G., Alam, R., Goodship, A.E., and Dudhia, J. 2013. Beneficial effects of autologous bone marrow-derived mesenchymal stem cells in naturally occurring tendinopathy. *PLoS One* 8: e75697. 
+
+[Medline] [CrossRef]
+33. Song, L.H., Pan, W., Yu, Y.H., Quarles, L.D., Zhou, H.H., 
+and Xiao, Z.S. 2006. Resveratrol prevents CsA inhibition of proliferation and osteoblastic differentiation of mouse bone marrow-derived mesenchymal stem cells through an ER/NO/cGMP pathway. *Toxicol. In Vitro* 20: 915–922. 
+
+[Medline] [CrossRef]
+34. Valenzano, D.R., Terzibasi, E., Genade, T., Cattaneo, A., 
+Domenici, L., and Cellerino, A. 2006. Resveratrol prolongs lifespan and retards the onset of age-related markers in a short-lived vertebrate. *Curr. Biol.* 16: 296–300. [Medline]
+[CrossRef]
+35. Van Loon, V.J.F., Scheffer, C.J.W., Genn, H.J., Hoogendoorn, A.C., and Greve, J.W. 2014. Clinical follow-up of horses treated with allogeneic equine mesenchymal stem cells derived from umbilical cord blood for different tendon and ligament disorders. *Vet. Q.* 34: 92–97. [Medline]
+[CrossRef]
+36. Wang, X., Ma, S., Meng, N., Yao, N., Zhang, K., Li, Q., 
+Zhang, Y., Xing, Q., Han, K., Song, J., Yang, B., and Guan, F. 2016. Resveratrol exerts dosage-dependent effects on the self-renewal and neural differentiation of hUC-MSCs. 
+
+Mol. Cells 39: 418–425. [Medline] [CrossRef]
+37. Xiao, Y., Chen, H., Song, C., Zeng, X., Zheng, Q., Zhang, Y., Lei, X., and Zheng, X. 2015. Pharmacological activities and structure-modification of resveratrol analogues. 
+
+Pharmazie 70: 765–771. [Medline]
+38. Yoon, D.S., Choi, Y., Choi, S.M., Park, K.H., and Lee, J.W. 2015. Different effects of resveratrol on early and late passage mesenchymal stem cells through β-catenin regulation. *Biochem. Biophys. Res. Commun.* 467: 1026–1032. 
+
+[Medline] [CrossRef]
+39. Yuan, H.F., Zhai, C., Yan, X.L., Zhao, D.D., Wang, J.X., 
+Zeng, Q., Chen, L., Nan, X., He, L.J., Li, S.T., Yue, W., and Pei, X.T. 2012. SIRT1 is required for long-term growth of human mesenchymal stem cells. *J. Mol. Med. (Berl.)* 90: 
+389–400. [Medline] [CrossRef]
+40. Zhou, L., Chen, X., Liu, T., Zhu, C., Si, M., Jargstorf, J., Li, M., Pan, G., Gong, Y., Luo, Z.P., Yang, H., Pei, M., and He, F. 2018. SIRT1-dependent anti-senescence effects of celldeposited matrix on human umbilical cord mesenchymal stem cells. *J. Tissue Eng. Regen. Med.* 12: e1008–e1021. 
+
+[Medline] [CrossRef]

medical/md/PMC10836430.md

@@ -0,0 +1,266 @@
+
+## The Effect Of Menopause On The Sexual Functions And Marital Adjustment Of The Spouses
+
+Fatma Yildirim, Nuriye Büyükkayaci Duman, Özen Kulakaç1 Department of Obstetrics and Gynecology Nursing, Faculty of Health Sciences, Hitit University, Çorum, 1Department of Obstetrics and Gynecology Nursing, Faculty of Health Sciences, Ondokuz Mayıs University, Samsun, Turkey Submitted: 18‑May‑2023 Revised: 20‑Jun‑2023 Accepted: 20‑Jul‑2023 Published: 30-Dec-2023 Background: This study was conducted as a cross‑sectional descriptive study to determine the effect of menopause on the SFs and marital adjustment (MA) of the spouses. **Materials and Methods:** The sample of the study consisted of a total of 254 people, 127 of whom were postmenopausal women and their spouses. The data were collected with the Descriptive Information Form, the Female Sexual Function Scale (FSFS), the Arizona Sexual Experiences Scale (ASES), and the Marital Adjustment Scale (MAS). The t‑test, Mann–Whitney U‑test, Kruskal–Wallis test, and correlation analysis were used in the analysis of the data. **Results:** Sexual dysfunctions (SDs) were detected in 91.3% of women and 77.2% of men. MA 
+was found to be low in 74.1% of the women. The relationship between the level of MA and the total mean score of the women's FSFS was found to be statistically significant (P < 0.05). In addition, the relationship between the presence of SD in the postmenopausal women and the mean ASES score in the husband was found to be statistically significant (P < 0.05). According to Spearman's rho correlation coefficient, the positive correlation between the total mean score of the MAS and the mean total score of the FSFS was weak (r = 0.290; P = 0.001), and the negative correlation between the mean score of the total score of the ASES was weak (r = −0.381; P = 0.000) which was found to be a relationship (P < 0.05). Conclusion: In this study, it was determined that menopause affects the marriage and sexual adjustment of spouses negatively.
+
+Keywords: *Marital adjustment, menopause, sexual function*
+
+## Introduction
+
+Menopause is defined as the permanent cessation of menstruation as a result of loss of ovarian activity.[1] In the postmenopausal period, genitourinary problems such as frequently recurring genital infections, urinary system infections, genital atrophy, vaginal dryness, and uterine prolapse are frequently seen in women due to hypoestrogenemia developing with a loss of ovarian activity.[2] Studies on the subject show that there is a strong relationship between genitourinary problems and sexual dysfunctions (SDs) in this period.[3] In the postmenopausal period, female SDs are generally dyspareunia, sexual reluctance, orgasm disorders, sexual arousal disorders, and decreased sexual satisfaction.[4‑7] While the decrease in estrogen production directly affects sexual function by causing 
+
+![0_image_0.png](0_image_0.png)
+
+Website: https://journals.lww.com/jomh
+
+| Website: https://journals.lww.com/jomh DOI: 10.4103/jmh.jmh_90_23   |
+|---------------------------------------------------------------------|
+
+vaginal dryness, hot flashes, and night sweats (which can lead to a loss of energy in women), it may also result in a decrease in sexual desire.
+
+[8,9]
+In addition to biological factors like hypoestrogenemia during menopause, psychosocial factors can also cause sexual problems.[10] With menopause, women may think that their sexual attractiveness decreases. This situation can lead to deterioration in body image, self‑esteem, and sexual reluctance.[11] It is known that emotional problems such as anxiety, depression, and anxiety disorders are more common in postmenopausal Address for correspondence: Dr. Fatma Yildirim, Department of Obstetrics and Gynecology Nursing, Faculty of Health Sciences, Hitit University, Çorum, Turkey. 
+
+E‑mail: fatmadmryldrm@gmail.com This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution‑NonCommercial‑ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non‑commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.
+
+For reprints contact: WKHLRPMedknow_reprints@wolterskluwer.com How to cite this article: Yildirim F, Duman NB, Kulakaç Ö. The effect of menopause on the sexual functions and marital adjustment of the spouses. J Mid‑life Health 2023;14:170-5.
+
+![0_image_1.png](0_image_1.png)
+
+![0_image_2.png](0_image_2.png)
+
+et al women. When the literature is examined, it is seen that there is a positive relationship between emotional problems experienced during menopause and SDs.[12‑14]
+In addition, the psychosexual problems experienced by women during menopause can negatively affect their marital relations and marital adjustment (MA).[15]
+In addition, the spouses of women with SDs can also develop SDs.[16]
+There are many studies in the literature on the SFs and MA of menopause.[6,7,17] However, a limited number of studies have been found in which the sexual problems experienced by married men whose spouses have entered menopause are separately addressed.[16,18,19] This situation was the determining factor in the planning of our study. In addition, it is known that regional factors and sociocultural environment play an important role in determining the outlook toward menopause, maintaining MA in menopause, and developing SD. In this sense, it can be thought that the realization of our study in Çorum, a Central Anatolian City, will set a regional example.
+
+## Aims
+
+This study was conducted as a cross‑sectional descriptive study to determine the effect of menopause on the SFs and MA of the spouses.
+
+Objectives
+- To determine the sexual life and MA of women in menopause
+- To determine the sex lives of the partners of menopausal women.
+
+## Materials And Methods Sample Of The Research
+
+The population of this study, which was planned as a cross‑sectional descriptive study, consisted of women who applied to the menopause polyclinic of a university hospital between November 08, 2017, and December 29, 2017. The samples of the study consisted of women who were aged between 45 and 65 years, had at least 1 year of menopause, had no communication barriers, volunteered to participate in the research, lived in the same house with their spouses, and had sexual activity in the past 4 weeks, who were selected using the simple random sampling method. Considering the limitations of the study, it is thought that the number of women who are married during menopause, who have a sexual function in the last month, and who do not have diabetes, hypertension, or depression is more than 30,000. Thus, the universe is considered infinite. The sample size was calculated with the following formula, which is used when the number of individuals in the population is not known.[20]
+n = 
+2 2 2
+× 1.96 × 1.96 × 3.88 × 3.88
+= 0.68 × .68 0 s t d = 125 Accordingly, the number of couples to be taken into the sample was determined as 125, and a total of 254 individuals, 127 of whom were menopausal women and their spouses, were included in the study. Individuals with chronic systemic diseases (such as cancer, cardiovascular disease, kidney failure, hypertension, and diabetes mellitus) that may affect sexual function, or those with chronic neurotic-psychotic diseases (including major depression, anxiety disorder, paranoid disorder, and schizophrenia), as well as individuals using drugs affecting sexual function, men with urological problems, and those who had undergone surgical operations for it were not included in the study.
+
+## Data Collection
+
+The Descriptive Information Form (DIF), Female Sexual Functioning Scale (FSFS), Marital Adjustment Scale (MAS), and Arizona Sexual Experiences Scale‑Male Form (ASES) were used to collect data.
+
+## Descriptive Information Form
+
+The DIF was developed by the researcher according to the literature.[8] This form consists of questions to reveal some characteristics of sociodemographic and marital history such as age, education level, employment status, health insurance, monthly total income, marriage age, duration of marriage, and having children. It was composed of 31 questions in total, including questions to reveal some characteristics of menopause and SFs, such as the status and duration of replacement therapy, hormone replacement therapy (HRT), postmenopausal sexual problems, and the status of receiving sexual counseling.
+
+## Female Sexual Functioning Scale
+
+The FSFS is a 19‑item scale developed by Rosen et al. to measure SFs in women in the past 4 weeks.[21] The scale was adapted into Turkish by Aygın and Aslan. The Cronbach's alpha coefficient of the scale was 0.75, and the Cronbach alpha coefficient for the subscales was between 0.89 and 0.98. In the structure of the scale, there are six subdimensions: desire, arousal, lubrication, orgasm, satisfaction, pain, or discomfort. The cutoff point of the scale is 26.55. Those with a score below 26.55 on the scale are considered to be SDs.[22]
+
+## Arizona Sexual Experiences Scale-Male Form
+
+The Male Form ASES is a 5‑item Likert‑type scale developed by McGahuey et al. to evaluate SFs in men.[23]
+The scale was adapted into Turkish by Soykan (2004). The Cronbach's alpha coefficient of the scale was 
+ ¦  ¦  ¦  171 et al determined as 0.89.[24] In the structure of the scale, there are five sub‑dimensions: arousal, arousal, penile hardening, ability to reach orgasm, and satisfaction from orgasm. The cutoff point of the scale is 11. A score of 11 and above is considered SD.
+
+## Marriage Adjustment Scale
+
+The Marriage Adjustment Scale (MAS) is a 15‑item Likert‑type scale developed by Locke and Wallace (1959) 
+to evaluate marital satisfaction and MA level.[25] It was adapted into Turkish by Tutarel and Kışlak (1999), and Cronbach's alpha coefficient was found to be 0.83 for men and 0.84 for women.[26] As the score obtained from the scale increases, MA also increases. The cutoff point of the scale is 43.5. Those who have a score below 43.5 on the scale are considered to have low MA.
+
+## Statistical Analysis
+
+In the study, descriptive statistics such as number, percentage, and mean were used in the evaluation of descriptive data. With the Kolmogorov–Smirnov test, it was decided whether the data showed normal distribution or not. The t‑test was used for a two‑group comparison of parametric data, the Mann–Whitney U‑test was used for a two‑group comparison of nonparametric data, and the Kruskal–Wallis test was used for a nonparametric data comparison of more than two groups. In addition, the relationship between the mean scores of the FSFS, ASES, and MAS was evaluated using Spearman's rho correlation analysis. The results were evaluated at a 95.0% confidence interval, P < 0.05 significance level, and P < 0.01 and P < 0.001 advanced significance level.
+
+## Results
+
+The mean age of the women participating in the study was 55.94 ± 5.51 years, and the mean age of their spouses was 57.82 ± 4.91 years. 63.0% of women and 61.4% of their spouses are primary school graduates. 84.3% of women do not work in any job. The age at the first marriage of 74.8% of women is between 15 and 19 years. The mean age of menopause of 67.7% of the women participating in the study was 47.00 ± 5.11 years. The menopause period of 41.7% of women is between 1 and 5 years, and 90.6% of them did not receive HRT. In addition, 45.7% of women reported that they had a very difficult menopause process, 81.1% did not experience premenopausal sexual problems, and 67.7% reported that menopause had a negative impact on their sexual life. 55.8% of the women stated that they experienced sexual reluctance, and 40.7% of them experienced dyspareunia. In addition, it was determined that 56.7% 
+of women experienced vaginal dryness, and only 13.9% 
+received treatment for vaginal dryness. In the study, when the mean scores of the participants on the FSFS, ASES, and MAS and the distributions of SDs and MA were examined, the total mean score of the women's FSFS was 11.02 ± 9.80. This mean is below 26.55, which is the mean FSFS cutoff point. The women's mean FSFS subdimension scores are also quite low. The lowest subdimension mean score is arousal (1.58 ± 1.62). The mean total score of the ASES in men was 14.14 ± 3.29. This mean is above 11 points, which means SD, which is the cutoff mean of the ASES. According to the mean scores obtained from the scales, it can be said that 91.3% of the menopausal women and 77.2% of the men had SD. In the study, the mean total score of the women's MAS was found to be 35.55 ± 9.04. This average is below 43.5 points, which is the cutoff point average of the MAS, which means that there is a problem with the level of MA. According to this average, 74.1% of women have a low level of MA [Table 1]. In the study, when the distribution of the total mean score of the FSFS mean score of subdimension and the mean score of the ASES according to MA level was analyzed in the study, in the statistical evaluation, 
+
+| Scale, and Marital Adjustment Scale and their                                                                                                                       |            |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------------|------------|
+| distribution regarding sexual dysfunction and marital  adjustment                                                                                                   |            |
+| Scales                                                                                                                                                              | X̅±SS/n (%) |
+| FSFS Request                                                                                                                                                        | 2.01±1.14  |
+| Arousal                                                                                                                                                             | 1.58±1.62  |
+| Lubrication                                                                                                                                                         | 1.84±1.92  |
+| Orgasm                                                                                                                                                              | 1.87±1.86  |
+| Satisfaction                                                                                                                                                        | 1.85±1.84  |
+| Pain                                                                                                                                                                | 1.85±1.96  |
+| FSFS total score                                                                                                                                                    | 11.02±9.80 |
+| ASES (men)                                                                                                                                                          | 14.14±3.29 |
+| MAS                                                                                                                                                                 | 35.55±9.04 |
+| Women's SD Having                                                                                                                                                   | 116 (91.3) |
+| Not having                                                                                                                                                          | 11 (8.7)   |
+| Men's SD Having                                                                                                                                                     | 98 (77.2)  |
+| Not having                                                                                                                                                          | 29 (22.8)  |
+| MA level Low                                                                                                                                                        | 94 (74.01) |
+| High                                                                                                                                                                | 33 (35.09) |
+| MA: Marital adjustment, MAS: MA Scale, FSFS: Female Sexual  Function Scale, ASES: Arizona Sexual Experiences Scale,  SD: Sexual dysfunction, SS: Standard deviation |            |
+
+172  ¦  ¦  ¦ 
+et al the mean score of the total score of the FSFS of the women with low level of MA and the mean score of the subdimension of the FSFS (desire, arousal, lubrication, orgasm, satisfaction, and pain) are lower than women with high MA. This difference was found to be statistically significant (P < 0.05). In other words, a low level of MA has an increasing effect on female SDs. Accordingly, it can be said that the level of MA affects women's SFs. On the other hand, the relationship between the MA level and the ASES score average was found to be statistically insignificant (P > 0.05). In other words, the MA level does not affect SFs in men [Table 2]. In the study, when the distribution of the spouses' mean ASES scores in the presence of women's SDs was examined, the ASES score averages of the spouses of women with SDs were higher than the mean ASES scores of the spouses of women without SDs. This difference was found to be statistically significant (P < 0.05). Accordingly, it can be said that the SDs of the wife have an increasing effect on the SDs of the husband [Table 3]. In the study, according to Spearman's rho correlation analysis, which was performed to determine the relationship between the mean FSFS, ASES, and MAS scores, there was a weak positive relationship between the mean FSFS score and the mean MAS 
+score (r = 0.290; P = 0.001), and there was a weak negative correlation between the mean FSFS score and the mean ASES score. It was determined that there was a relationship in the direction (r=−0.381; P = 0.000) (P < 0.05). According to this, as the mean FSFS scores decrease, the mean MAS scores of the spouses also decrease, while the mean scores of the spouses' ASES increase. In other words, as the SDs of the wife increase, the SD of the husband increases and MA decreases [Table 4].
+
+## Discussion
+
+Due to hypoestrogenemia seen in the postmenopausal period, many genitourinary problems occur in women, especially vaginal atrophy, vaginal dryness, genital infections, and pelvic prolapse.[2] Emotional problems caused by both genitourinary problems and psychosocial changes in this process can negatively affect the SFs and MA of menopausal women.[3,27] Studies on the subject show that the incidence of SD in women in the postmenopausal period is 2–3 times higher than in women in the same age group in adulthood.[7,10]
+Similarly, in our study, most of the women (81.1%) reported that they did not have sexual problems before menopause, while approximately three out of every 
+
+| Table 2: The distribution of the mean Female Sexual  Function Scale and Arizona Sexual Experiences Scale  scores by marriage adjustment level   |            |                           |               |       |
+|-------------------------------------------------------------------------------------------------------------------------------------------------|------------|---------------------------|---------------|-------|
+| Scales                                                                                                                                          | X̅±SS       | t                         | P             |       |
+| Low MA                                                                                                                                          | High MA    |                           |               |       |
+| level (n=94) level (n=33)                                                                                                                       |            |                           |               |       |
+| FSFS lower dimension Request                                                                                                                    | 1.88±1.08  | 2.40±1.22                 | −2.277 0.024* |       |
+| Arousal                                                                                                                                         | 1.41±1.56  | 2.07±1.69                 | −2.032 0.044* |       |
+| Lubrication                                                                                                                                     | 1.62±1.81  | 2.45±2.12                 | −2.153 0.033* |       |
+| Orgasm                                                                                                                                          | 1.66±1.77  | 2.46±1.99                 | −2.143 0.034* |       |
+| Satisfaction                                                                                                                                    | 1.65±1.78  | 2.43±1.90                 | −2.136 0.035* |       |
+| Pain                                                                                                                                            | 1.61±1.82  | 2.54±2.21                 | −2.372 0.019* |       |
+| FSFS total score                                                                                                                                | 9.85±9.36  | 14.36±10.39 −2.315 0.022* |               |       |
+| ASES for men                                                                                                                                    | 14.43±3.32 | 13.30±3.10                | 1.713         | 0.089 |
+| *P<0.05. FSFS: Female Sexual Function Scale, ASES: Arizona  Sexual Experiences Scale, MA: Marital adjustment, SS: Standard                      |            |                           |               |       |
+
+| Table 3: Distribution of spouses of women with                                 |           |            |        |       |       |        |
+|--------------------------------------------------------------------------------|-----------|------------|--------|-------|-------|--------|
+| sexual dysfunction according to their Arizona Sexual  Experiences Scale scores |           |            |        |       |       |        |
+| Scale                                                                          | Having    | Not having | U      | P     |       |        |
+| SD (n=116)                                                                     | SD (n=11) |            |        |       |       |        |
+| Mean                                                                           | Sum of    | Mean       | Sum of |       |       |        |
+| rank                                                                           | rank      | rank       | rank   |       |       |        |
+| ASES (men)                                                                     | 42.41     | 7661.5     | 66.05  | 466.5 | 400.5 | 0.040* |
+| *P<0.05. ASES: Arizona Sexual Experiences Scale, SD: Sexual  dysfunction       |           |            |        |       |       |        |
+
+| Table 4: Distribution of the correlations of the Female  Sexual Function Scale, Marital Adjustment Scale, and  Arizona Sexual Experiences Scale scores mean   |         |         |       |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------|---------|---------|-------|
+| Scales                                                                                                                                                        | FSFS    | MAS     | ASES  |
+| FSFS                                                                                                                                                          | 1.000   |         |       |
+| MAS                                                                                                                                                           | 0.290*  | 1.000   |       |
+| ASES                                                                                                                                                          | −0.381* | −0.282* | 1.000 |
+| *P<0.05                                                                                                                                                       |         |         |       |
+
+5 (67.7%) women reported that menopause had a negative impact on their sexual life. In addition, SD was detected in almost all (91.3%) postmenopausal women in the study. It is reported in the literature that the incidence of SD in menopausal women varies between 48.3% and 85.9%.[28‑30] In our study, it was determined that the mean total score of the women's FSFS was below the cutoff score (26.55) (11.02 ± 9.80). When the international and national literature is examined, it is seen that the mean MAS score of menopausal women varies between 18.6 ± 7.91 and 27.16 ± 6.25.[29,31,32]
+According to the literature, physical and mental changes experienced during menopause can negatively affect the level of MA.[13,14,16,17,33] When the literature on the subject is examined, different study results are et al encountered. In some studies, it has been reported that MA strengthens with the increase in spousal support during menopause, while in some studies, an increase in physical and emotional complaints of women and a decrease in MA with deterioration in SFs.[34,35] In our study, it was determined that the mean total score of the MAS (35.55 ± 9.04) was below the cutoff point (43.5). This finding indicates that MA is low in the population of menopausal women included in the study. On the other hand, the MA level of 74.1% of the women was found to be low compared to the total mean score of the MAS in the study. When the international and national literature is examined, it is seen that the mean total score of the MAS of menopausal women varies between 18.6 ± 7.91 and 27.16 ± 6.25.[13,17] The finding of our study is similar to the literature. In our study, it was determined that the mean ASES total score (14.14 ± 3.29) in male spouses was above the cutoff point. This mean indicates SD in the male partner population included in the study. In the study, 77.2% of male spouses were found to have SD, according to the ASES total score average. Many studies on male sexual life have been found in the international and national literature available;[36,37] however, there are many studies that deal with the SFs of men whose spouses are in the menopause period. No quantitative study was found. In the literature, only qualitative studies on the subject have been found, and it has been reported that the sexual life of some men with menopausal spouses is not the same as before.[16,19] In a study examining men's point of view toward menopause, it was determined that the most important concern of a man whose wife is in menopause is about his own sexual life.[18] In some studies, it is reported that men with menopausal spouses only think about their own sexual activities and mostly experience SDs.[19,38] The finding of our study is similar to the literature. In addition, in the study, it was determined that as the SDs of the wife increased, the SDs of the male partner increased. In other words, it was determined that males with a partner with SDs developed more SDs than the other population. Supporting the results of our study, Goldstein et al.
+
+[39] and Krakowsky and Grober[38]
+reported that the sexual life satisfaction of menopausal women and their spouses is related to each other, and as the SDs increase in menopausal women, the SFs of their spouses are also negatively affected. In our study, SDs were found to be higher in women with low MA levels. Accordingly, it can be said that low MA negatively affects women's SFs. On the other hand, no relationship was found between MA level and male SFs in our study. In other words, the MA 
+level does not affect SFs in men. When the literature is examined, different study results are encountered. While some studies have reported that MA only affects SFs in women, male SFs are not affected by MA, which supports the result of our study.[14,16,40] In some studies, it has been reported that MA affects SFs in both men and women regardless of gender.[35,39] In some studies, however, MA could not be associated with SFs.[15,40]
+The significance that individuals attribute to sexuality in marital relationships varies from one relationship to another. In addition, both the biological differences of the male and female sexes, as well as the differences in perspective toward marriage, are important determinants of SFs. In this context, it can be considered reasonable that the relationship between MA and SFs cannot be clearly explained.
+
+## Conclusion
+
+In the study, SDs were detected in 91.3% of menopausal women, and 77.2% of men whose spouses are in menopause. In addition, 74.1% of women have a low level of MA. The rate of SDs in women with low MA was found to be higher than in the other population. However, no relationship was found between female MA level and male SFs. In addition, in the study, it was determined that the SDs of the spouses had an increasing effect on the SDS of the men.
+
+## Acknowledgments
+
+Thanks to participation for their participants. We would like to thank the editors and referees who reviewed the article for their efforts.
+
+## Financial Support And Sponsorship Nil. Conflicts Of Interest
+
+There are no conflicts of interest.
+
+## References
+
+1. World Health Organization. Education and Treatment in Human Sexuality: The Training of Health Professionals. Tecnical Report Series 572. Geneva, CHE: World Health Organization; 2020.
+
+2. Sritonchai C, Manonai J, Sophonsritsuk A, Cherdshewasart W. 
+
+Comparison of the effects of *Pueraria mirifica* gel and of placebo gel on the vaginal microenvironment of postmenopausal women with genitourinary syndrome of menopause (GSM). Maturitas 2020;140:49‑54.
+
+3. Nasreen SZ, Shahreen S, Huq S, Huq S. Genito urinary syndrome of menopause (GSM) or vulvo‑vaginal atrophy (VVA) an unspoken sorrow. Am J Intern Med 2019;7:154‑62.
+
+4. Simon JA, Davis SR, Althof SE, Chedraui P, Clayton AH, 
+Kingsberg SA, et al. Sexual well‑being after menopause: An ınternational menopause society white paper. Climacteric 2018;21:415‑27.
+
+5. Erbil N. Attitudes towards menopause and depression, body image of women during menopause. Alex J Med 2018;54:241‑6.
+
+174  ¦  ¦  ¦ 
+6. Erel T. Hormone Therapy During Menopause; 2018. Available from: http://www.tjodistanbul.com/egitim/istanbulkliniklerinden/ menopozdönemindeki-hormon-tedavisi. [Last accessed on 2018 Jan 27].
+
+7. Rouhbakhsh M, Kermansaravi F, Shakiba M, Navidian A. The effect of couples education on marital satisfaction in menopausal women. J Women Aging 2019;31:432‑45.
+
+8. Bozkurt ÖD, Sevil Ü. Menopause and sex life. Journal of Celal Bayar University Institute of Health Sciences 2016;3:497‑503.
+
+9. Potter N, Panay N. Vaginal lubricants and moisturizers: A review into use, efficacy, and safety. Climacteric 2021;24:19‑24.
+
+10. Heidari M, Ghodusi M, Rezaei P, Kabirian Abyaneh S, 
+Sureshjani EH, Sheikhi RA. Sexual function and factors affecting menopause: A systematic review. J Menopausal Med 2019;25:15‑27.
+
+11. Aygin D, Pektemek M. How is sexuality affected in young women entering surgical menopause? Andrology Bulletin 2018;20:21‑4.
+
+12. Yazdanpanahi Z, Nikkholgh M, Akbarzadeh M, Pourahmad S. 
+
+Stress, anxiety, depression, and sexual dysfunction among postmenopausal women in Shiraz, Iran, 2015. J Family Community Med 2018;25:82‑7.
+
+13. Pınar ŞE, Polat Ş. Marriage harmony of women in menopause and affecting factors. Journal of İnönü University Vocational School of Health Servise 2020;8:246‑57.
+
+14. Ghazanfarpour M, Khadivzadeh T, Roudsari RL. Sexual disharmony in menopausal women and their husband: A qualitative study of reasons, strategies, and ramifications. J Menopausal Med 2018;24:41‑9.
+
+15. Yılmaz FA, Avci D. The relationship between personality traits, menopausal symptoms, and marital adjustment. Health Care Women Int 2022;43:1142‑57.
+
+16. Yazdkhasti M, Negarandeh N, Moghadam ZB. Menopause: Two sides of the same coin: A qualitative study. Int J Adv Biotechnol Res (IJBR) 2016;7:690‑700.
+
+17. Önder M, Batigun AD. Premature and normal menopause: 
+An evaluation in terms of stress, marital adjustment and sex roles/early and normal menopause: A comparison in terms of stress, marriage compliance level and gender roles. Journal of Thinking Man 2016;29:129.
+
+18. Mehrdad R, Mazloumi A, Arshi S, Kazemi Z. Work ability index among healthcare personnel in a university hospital in Tehran, Iran. Work 2016;53:851‑7.
+
+19. Khalesi ZB, Jafarzadeh‑Kenarsari F, Mobarrez YD, 
+Abedinzade M. The impact of menopause on sexual function in women and their spouses. Afr Health Sci 2020;20:1979‑84.
+
+20. Erdoğan S, Nahcivan N, Esin N.Sampling. Research Process, Practice and Critical in Nursing. Vol. 3. Istanbul: Nobel Medical Bookstore, Edition; 2017. p. 175.
+
+21. Rosen R, Brown C, Heiman J, Leiblum S, Meston C, 
+Shabsigh R, et al. The Female Sexual Function Index (FSFI): A multidimensional self‑report instrument for the assessment of female sexual function. J Sex Marital Ther 2000;26:191‑208.
+
+22. Aygın D, Aslan FE. Adaptation of the scale of female sexual function to Turkish. Turkish Clinic Journal of Medical Science 2005;25:393‑9.
+
+23. McGahuey CA, Gelenberg AJ, Laukes CA, Moreno FA, 
+Delgado PL, McKnight KM, et al. The Arizona sexual experience scale (ASEX): Reliability and validity. J Sex Marital Ther 2000;26:25‑40.
+
+24. Soykan A. The reliability and validity of Arizona sexual experiences scale in Turkish ESRD patients undergoing hemodialysis. Int J Impot Res 2004;16:531‑4.
+
+25. Locke HJ, Wallace KM. Short marital‑adjustment and prediction tests: Their reliability and validity. Marriage Fam Living 1959;21:251‑5.
+
+26. Tutarel‑Kışlak, Ş. Reliability and validity study of the scale of adaptation in marriage (EUÖ). Journal of 3P 1999;7:50‑7.
+
+27. Phillips NA, Bachmann GA. The genitourinary syndrome of menopause. Menopause 2021;28:579‑88.
+
+28. Cruz EF, Nina VJ, Figuerêdo ED. Climacteric symptoms and sexual dysfunction: Association between the blatt‑kupperman ındex and the female sexual function ındex. Rev Bras Ginecol Obstet 2017;39:66‑71.
+
+29. Andac T, Aslan E. Sexual life of women in the climacterium: 
+A community‑based study. Health Care Women Int 2017;38:1344‑55.
+
+30. Nateri NS, Beigi M, Kazemi A, Shirinkam F. Women coping strategies towards menopause and its relationship with sexual dysfunction. Iran J Nurs Midwifery Res 2017;22:343‑7.
+
+31. Gozuyesil E, Avcıbay Vurgec B, Gokyildiz Surucu S, 
+Onat Koroglu C. The relationship between the attitudes towards menopause and SFs among women in the climacteric period, Turkey. J Midwifery Reprod Health 2021;9:1‑10.
+
+32. Duran AD, Sinan Ö. Determinations of sexual dysfunctions and depression states in women entering natural and surgical menopause. Journal of Kocaeli University Health Sciences 2020;6:150‑6.
+
+33. Yang CF, Kenney NJ, Chang TC, Chang SR. Sex life and role identity in Taiwanese women during menopause: A qualitative study. J Adv Nurs 2016;72:770‑81.
+
+34. Jalambadani Z, Rezapour Z, Movahedi Zadeh S. Investigating the relationship between menopause specific quality of life and perceived social support among postmenopausal women in Iran. Exp Aging Res 2020;46:359‑66.
+
+35. Kling JM, Kelly M, Rullo J, Kapoor E, Kuhle CL, Vegunta S,
+et al. Association between menopausal symptoms and relationship distress. Maturitas 2019;130:1‑5.
+
+36. Træen B, Štulhofer A, Janssen E, Carvalheira AA, Hald GM, 
+Lange T, et al. Sexual activity and sexual satisfaction among older adults in four European countries. Arch Sex Behav 2019;48:815‑29.
+
+37. Kilic A, Tastan S, Ayhan H, Seven M, Tastan B. Reliability and validity of a Turkish version of the sexual quality of life - Male questionnaire: A methodological study. Sex Health 2018;15:413‑9.
+
+38. Krakowsky Y, Grober ED. A practical guide to female sexual dysfunction: An evidence‑based review for physicians in Canada. Can Urol Assoc J 2018;12:211‑6.
+
+39. Goldstein I, Kim NN, Clayton AH, DeRogatis LR, Giraldi A, 
+Parish SJ, et al. Hypoactive sexual desire disorder: International society for the study of women's sexual health (ISSWSH) expert consensus panel review. Mayo Clin Proc 2017;92:114‑28.
+
+40. Jafarbegloo E, Bakouei S. Dadkhahtehrani T. Marital satisfaction in menopausal women with and without sexual dysfunction. J Midwifery ReprodHealth 2017;5:1053‑8.

medical/md/PMC2109609.md

@@ -0,0 +1,251 @@
+
+## Intercellular Communication In The Rat Anterior Pituitary Gland An In Vivo And In Vitro Study
+
+WILLIAM H. FLETCHER, NELS C. ANDERSON, JR., and JOHN W. EVERETT. From the Department of Anato~ny and the Department of Physiology, Duke University Medical Center, Durham, North Carolina 27710 The concept of "stimulus-secretion coupling" suggested by Douglas and co-workers to explain the events related to monamine discharge by the adrenal medulla (5, 7) may be applied to other endocrine tissues, such as adrenal cortex (36), 
+pancreatic islets (4), and magnocellular hypothalamic neurons (6), which exhibit a similar iondependent process of hormone elaboration. In addition, they share another feature, that of joining neighbor cells via membrane junctions (12, 26, and Fletcher, unpublished observation). Given this, and the reports that hormone secretion by the pars distalis also involves a secretagogue-induced decrease in membrane bioelectric potential accompanied by a rise in cellular [Ca ++] (27, 34, 41), it was appropriate to test the possibility that cells of the anterior pituitary gland are united by junctions. 
+
+## Materials And Methods Electron Microscopy
+
+Pieces o.f rat anterior pituitary were processed for electron microscopy using isosmotic solutions (cf. reference 12). Tissues were immersed for 4 6 h in Karnovsky's dialdehyde fixative (19) buffered to pH 7.4 with 0.1 M sodium cacodylate containing 0.05% calcium chloride, then rinsed in buffer containing 4% sucrose. 
+
+After this, they were postfixed in 2% osmium tetroxide containing 3% sucrose and either dehydrated in a graded series of ethanol or placed for I--4 h in a solution of 0.5% 
+uranyl acetate and 5% sucrose, after which they were dehydrated. Cultured cells were fixed *in situ* using the dialdehyde described at half strength. They were then briefly rinsed in buffer as described above, postfixed in similarly buffered 1% osmium tetroxide and dehydrated. 
+
+THE JOURNAL OF CELL BIOLOGY 9 VOLUME 67, 1975 9 pages 469-476 469 Tissues and cultures of cells both were imbedded in Epon 812 (Shell Chemical *Co.,* New York). 
+
+For some protocols, tissues were exposed to electrondense extracellular tracers either before or during fixation. Lanthanum was used as described by Revel and Karnovsky (31), potassium pyroantimonate (20) as a 1 2% solution, and ruthenium red according to Luft's method (23). In each case, Ca ++ was eliminated from buffer. Treatment of cultures with any of these tracers, especially lanthanum, before fixation caused cells to lift free of the substrate; thus, tracers were used only after dialdehyde fixation was begun. 
+
+Tissues to be used for freeze-fracture were fixed in dialdehyde for 4-6 h, then passed through progressively increasing concentrations of glycerol buffered to pH 7.4 with 0.1 M sodium cacodylate containing 0.1% calcium chloride, and allowed to stay in the final concentration 
+(20%) of glycerol for 4 6 h. Fracturing at - 115~ was done in a Balzers 360-m device (Balzers High Vacuum Corp., Santa Ana, Calif.) at less than 6 x 10 -7 torr. 
+
+Replicas were cast with platinum-carbon and stabilized with carbon. 
+
+## Preparation Of Cell Cultures
+
+Anterior pituitary glands were removed from decapitated rats, rinsed in complete culture medium (Dulbeccos) plus 10% fetal-calf serum and 100gg/ml Gentamicin 
+(Schering Diagnostics, Port Reading, N.J.), and diced into small pieces. The "clean" bits of gland were placed in a sterile centrifuge tube (15 ml) to which 3 ml of enzyme solution (0.1% trypsin-EDTA in balanced salt solution) were added. The contents of the tube were continually stirred. Every 15 min, agitation was stopped and the dispersed cells and enzyme solution were removed, and fresh enzyme solution was added and stirring restarted. The suspension of freshly disaggregated cells was centrifuged for 5 rain at 500 g and the cell pellet resuspended with I ml of complete culture medium. An aliquot of this pellet was used to obtain an estimate of cell number and viability (trypan blue exclusion). Cells thus disaggregated were seeded into sterile plastic petri dishes and placed in a 37~ chamber, gassed with 95% 
+02:5% CO2. The cells were allowed to incubate for 4 days, by which time they had firmly attached to the substratum and flattened slightly. 
+
+## Assessment Of Electrotonic Coupling
+
+Intercellular electrotonic coupling measurements were carried out on an inverted phase microscope with Leitz micromaniputators (E. Leitz, Inc., Rockleigh, N. J.)The cultures were maintained at 35-37~ on the microscope stage, and a thin layer of mineral oil spread over the medium prevented desiccation. A soft, continuous flow of 95% 02:5% CO2 was maintained over the mineral oil. 
+
+Pyrex microelectrodes were filled with 3 M KCI, and only those with tip resistances of 30-50 Mft were used. One electrode was attached to a modified Wheatstone bridge circuit, and the second electrode was used for monitoring electrotonic potentials in the adjacent cell. 
+
+Microelectrode resistance was checked before and after recording from cells by monitoring balance for the bridge electrode and by a brief voltage ramp to the voltage-sensing electrode. 
+
+## Results
+
+Extensive examination of anterior pituitary tissue revealed that some endocrine cells were joined by gap junctions. In thin sections the contact regions usually extended for less than 0.2 uM (range ca. 
+
+0.1-0.25 ~M) and consisted of apposed plasma membranes separated by a 3 5-nm intercellular cleft (as in Fig. 1). When filled with electronopaque tracers, this "gap" appeared wider due to staining of the outer aspects of subjacent membranes. In some instances the intercellular cleft broadened to ca. 6 nm, but reclosed quickly. 
+
+However, in other cases the entire intermembrane distance was this dimension. Occasionally, functional characterization of both partners contributing to the junction could be made using established ultrastructural criteria (8, 15, 16, 25). In these cases, mammotropes (cells producing prolactin) 
+were the prevalent cell type joined by gap junctions while such contacts were less frequent between somatotropes (producing growth hormone), 
+gonadotropes [producing either luteinizing hormone (LH) or follicle-stimulating hormone (FSH)] 
+or thyrotropes (producing thyroid-stimulating hormone). More often than not, only one cell of a conjoined pair could be characterized, usually because the junction occurred between the body of one cell and a sometimes deeply invaginating process of a distant, unidentifiable, partner. In other instances, two cell processes, neither of which contained secretion granules, were joined by a gap junction. Whether these events represented contact between folliculo-stellate cells, corticotropes 
+(producing ACTH) or chromophobes (resting endocrine cells? [15, 16]) is uncertain, as each of these pituitary constituents can send out undifferentiated processes. As described by various authors (8, 15, 16), secretory cells often were united homologously 1 and heterologously by desmosomes and intermediate junctions (9). 
+
+Freeze-fracture of the gland efficiently revealed the diminutive gap junctions (Fig. 2). When replicated, they appeared as macular, sometimes oblate, regions of apposed cell membranes specialized by polygonally arrayed 8 9-nm particles associated with the "A" fracture face s and similarly arranged depressions in the "B" face. While this procedure unveiled a number of gap junctions, it was seldom possible to identify both contributors because one of them was usually removed by the fracturing process. Mammotropes and gonadotropes could be readily distinguished and differentiated from nonendocrine follicle cells whose surfaces were specialized by microvilli. However, somatotropes and thyrotropes, while easily found under certain experimental conditions (Fletcher and Everett, unpublished observations) were less conspicuous in the basal-state preparations used for this study. Thus, the junctions possibly uniting these latter cell types could not be verified by freeze-fracture. 
+
+Besides these authentic gap junctions, numerous loose aggregates of I1-11.5-nm particles were routinely seen on replicas of the A fracture face relatively devoid of the ubiquitous, scattered 6-8-nm intramembrane particles (inset, Fig. 2). 
+
+Except for the absence of a filamentous component, these clusters of large particles are reminiscent of the freeze-fractured desmosomes found in cervical epithelium (cf. reference 24). Also, the frequency with which they were encountered here was comparable to that of the desmosomes seen in 
+~The terms homologous and heterologous are used to describe the secretion product, not the embryonic origin of the endocrine ceils. 
+
+2 The complementary intramembrane faces exposed by splitting within the hydrophobic bilayer (3, 29) are conventionally labeled "A" face, the leaflet associated with cell interior, and "B" face, the leaflet adjacent to extracellular space. 
+
+![2_image_0.png](2_image_0.png)
+
+thin sections of the pituitary. Even so, since desmosomes do not seem to always involve modification of the membrane interior (13) and do not occupy obligatory positions between secretory cells of the anterior pituitary, this interpretation must remain provisional. 
+
+After 4 days in culture, the pituitary cells uniformly appeared healthy, and occasional mitoses were seen. Prolactin cells were typically (8, 15, 16) hyperactive, yet the relative numbers of this and other cell types was not remarkably changed from those found 90 min after their dispersion. 
+
+These observations are consistent with the report of Hopkins and Farquhar (17), except that by using trypsin and neuraminidase to disaggregate the gland, they reduced cell losses during the 1st day to "less than 10%" whereas our losses appeared to be slightly higher. Fibroblast contamination was not a problem in these short-term cultures, but in the few preparations maintained for up to 3 wks increasingly greater numbers of agranular, fibroblast-like cells were found. As shown in Fig. 1, gap junctions, presumably destroyed during cell disaggregation, had reformed such that 4 days later they could be readily identified and were indistinguishable from the junctions found in intact glands. Commonly, cells retracted from one another during preparation of the cultures for electron microscopy, particularly in those cases where extracellular tracers were used. When this occurred, the junction did not divide in the intercellular space but withdrew intact and remained with one partner. Similar asymmetric splitting of gap junctions has been observed after enzyme dispersion of liver cells (2) and may well be a common feature of in vitro preparations 
+(19), at least in those cases where the methods of tissue disaggregation and cell maintenance described here are used. 
+
+Electrophysiological studies of similar cultures revealed that endocrine cells (judged by their containing numerous refractile granules when viewed with phase optics) are ionically coupled 
+(Fig. 3). In 6 of 14 cases, current pulsed into one cell (V 1) resulted in an electrotonic potential in the adjacent cell (V2) which was only slightly attenuated (V2/VI) ca. 0.90-0.94). in five cases the cells were not coupled, and in three instances the bridge balance after otherwise successful impalements was low. No systematic analysis of resting membrane potentials was made, although they were generally low (ca. -10 mV) and negative relative to the external bath potential. These potentials are consistent with those reported by York et al. (41), except that they found numerous instances of positive inside potentials. 
+
+## Discussion
+
+We have shown that endocrine cells of the intact and disaggregated rat anterior pituitary gland are united by gap junctions. Both in vivo and in vitro, the thin section appearance of these membrane specializations conformed to the structural criteria established by Revel and co-workers (31; also see 32) and which have been repeatedly confirmed 
+
+![3_image_0.png](3_image_0.png)
+
+since then (cf. references 13, 24, 35). At the pituitary junctions, potassium pyroantimonate and lanthanum are sequestered in the intercellular gap and stain the outer leaflets of adjacent membranes. This may indicate, as it does in other tissues (12, 20), that polyvalent cation-binding sites face the extracellular space differentiated by these intimate appositions. Freeze-fracture of anterior pituitary tissue has established these structures as true gap junctions in that they involve extensive modification of the membrane interior. In replicas the junctions appeared as packed aggregates of intramembrane particles on the A face and similarly arranged depressions into the apposing B membrane leaflet. In the pituitary, the size range of particles (8 9 nm) is similar to that found in other tissues (cf. references 12-14, 38) although it is slightly larger than the 6-7-rim dimensions described for the gap junctions (nexus) of cardiac muscle (cf. reference 24), This variation is most likely due to differences in the thickness of replicas used, a problem which has been considered in detail by McNutt and Weinstein (24). 
+
+The combined morphological evidence retrieved by these two preparative methods clearly demonstrates that cells producing the same tropic-hormone (homologous cells) can contact one another via gap junctions. The data from sectioned material indicate that the mammotropes, gonadotropes, somatotropes, or thyrotropes, and possibly other types of secretory cells, are united by this means. For reasons discussed in Results, only the junctions between mammotropes or gonadotropes could be verified with the freeze-fracture method, although it is likely that the junctions between other cell types are equally authentic. 
+
+Recently, Hopkins and Farquhar (17) mentioned that "shallow gap junctions" are found between secretory cells of the rat adenohypophysis: however, their observations were confined to thinly sectioned material, and the authors did not indicate the functional categories of cells united by these specializations. Even so, when considered in the light of the detailed descriptions given here, the findings of Hopkins and Farquhar essentially agree with ours. 
+
+In an effort to establish whether or not cells of the adenohypophysis could communicate ionically pooled anterior pituitaries were enzymatically disaggregated and the harvested cells maintained in culture. While the preparative methods employed here differed slightly from those used by Hymer et al. (18) and Hopkins and Farquhar (17), the viability and percentage of cells retrieved from glands were similar in all three cases, in addition, the morphology of cells 90 min after dissociation compared favorably with that described by Hymer et al. and Hopkins and Farquhar, indicating that the functional competence of preparations used for this study was also comparable. Because the cells were small (ca. 8-10 ~tM) and often lysed after introduction of a microelectrode, many attempts to impale adjacent cells were abortive. In those cases where valid, repetitive measurements of direct intercellular current passage were made, about 40% of the cell pairs tested were electrotonically coupled. This frequency of ionic communication in these heterotypic cultures is consistent with the finding of gap junctions only between homologous cells. If heterologous pairing was widespread, more, if not most, cells should have been coupled. 
+
+This is clearly not the case. It is conceivable that junctions form only during certain functional states. This might also explain the existence of coupling in less than half the cell pairs; however, we have no evidence to support this notion. The possibility that coupling involved nonsecretory cells is considered unlikely for two reasons: (a) 
+only those cells with numerous, refractile granules were impaled with microelectrodes, which could be expected to eliminate the agranular follicle cells and (b) a contribution by fibroblasts, which do couple ionically and metabolically via gap junctions (14) can be partially discounted for reasons given in (a). Also, fibroblasts were infrequently seen and could not, on a basis of random distribution, account for the high rate of microelectrode impalements resulting in positive coupling. Therefore, when this is taken together with the morphological evidence already considered, it seems likely that the direct intercellular coupling is between tropic-hormone-producing cells and, in view of comparable data from other systems (1, 13, 14, 22, 24, 35, 37, 38), this communication is probably mediated by the gap junctions described here. 
+
+Before we arrived at this conclusion, the possibility was considered that the route of intercellular communication was established by other forms of cell-to-cell contact. No gross continuities such as cytoplasmic bridges (10) united secretory cells in vivo or in vitro, and the number of such structures that might exist between early postmitotic cells would be very small, given the low incidence of cytokinesis observed. The desmosomes and intermediate junctions which, like the gap junctions, reform after pituitary disaggregation have long been known to unite adenohypophysial cells (8, 15, 16). However, neither of these types of.contact has been shown to play a role in the cell-to-cell exchange of molecules (1, 13, 14, 22, 24, 35). Finally, the loose aggregates of 11 l l.5-nm A-face particles unveiled by freeze-fracture could represent a novel type of junction, rather than desmosomes as suggested in the Results section. This is especially so since such modification of the membrane interior could correspond to those "gap junctions" which had an excessively wide intercellular cleft 
+(ca. 6 nm). Similarly unusual gap junctions have been reported in intestinal epithelium (38), vertebrate retina (30), and crayfish axon (28) and have been recently reviewed by McNutt and Weinstein 
+(24) who categorize them as "large subunit gap junctions." In contrast to each of the occurrences indicated above, the clusters of large intramembrahe particles in the anterior pituitary gland lack a complementary B-face image. As the B-face impressions revealed by freeze-fracture seem to be an invariable component of junctions thought to mediate intercellular communication (13, 24, 35), 
+the absence of this feature suggests that the aggregated large particles are not a true junction and most likely do not subserve electrotonic coupling. 
+
+## Functional Implications
+
+It seems likely from the data already discussed that homologous endocrine cells of the anterior pituitary gland when joined by gap junctions can act as a functional syncytium. Even so, in view of the instances where these membrane specializations united gonadotropes which could not be characterized as exclusively producing LH or FSH, the possibility that heterologous intercellular junctions occur cannot be discounted. This inability to determine the mode of intercellular communication in the gland, however, does not obscure the findings of gap junctions and electrotonic coupling documented here. These observations, together with the wealth of literature devoted to anterior pituitary function, allow us to discuss the potential importance of intercellular communication to the gland as an endocrine organ. 
+
+The demonstration that disaggregated anterior pituitary cells are coupled electrically strongly supports the proposition that they share a common intracellular space, at least in terms of inorganic ions. In view of this, it is possible that activated cells united homologously or heterologously with neighbors via gap junctions may act, respectively, as sinks or sources for the ionic requirements of the secretory process. Thus, secretion by a cell responding to its specific stimulus could be facilitated by Ca ++ (18, 27, 33, 34, 41) or other ions from contiguous neighbors? While we have not shown in this study that pituitary cells exchange larger molecules, this would be consonant with the findings of others that cells coupling ionically and joined by gap junctions also cooperate metabolically (I, 13, 14, 22, 24, 39). Given this, it is conceivable that when a releasing factor binds to a competent tropic-hormone cell it initiates the production or activation of some "secretion signal" that is capable of passing to adjacent, homologous cells. This would have the advantage of retaining the apparent specificity of releasing factors and allow a way for their action to be amplified and evenly distributed throughout the gland. Supporting this contention is the report by Rubin et al. (33) that, in adrenal cortical cells which are extensively united by junctions (12), 
+ACTH initiates the production (unmasking?) of a labile, intracellular factor responsible for stimulating steroid synthesis, even after ACTH has been withdrawn. They speculate that this factor could be Ca ++, prostaglandin, messenger RNA, or cyclic 3'-5' adenosine monophosphate (CAMP). In the anterior pituitary gland, intercellular transfer of such a factor generated by action of secretagogue may well be mediated by the specialized junctional membrane areas described here. Sheridan has proposed a similar scheme for the brown fat cells that he demonstrated were electrotonically coupled (37). To the extent that his model applies to the pituitary, CAMP passed between cells united by gap junctions may assume a similar role in the normalization of releasing factor information among homologous cell types. 
+
+We are grateful to Dr. J. David Robertson for allowing us free access to his electron microscope facilities and for his helpful criticisms during the course of this study. We also appreciate Dr. Jean L. Pasteels suggestions during the writing of this manuscript. Dr. Fletcher thanks Drs. 
+
+Herbert H. Srebnik and Peter Satir for their encouragement during preliminary studies. 
+
+This work was supported by grants NSRB 6 FO2 GM 
+52636-01, SO4 PR 06148-06, 5 POI NS 10299, HD 
+s Perhaps related to this is the finding that, in the central nervous system, glial cells act as ion sources for neurons 
+(40), to which they can join via gap junctions (I I) **and** 
+certain, more elaborate, intermembrane specializations 
+(21). 
+
+02742 from the National Institutes of Health, and NSF 
+GB 21025. 
+
+Received/or publication 11 October 1974, and in revised form 9 June 1975. 
+
+## Bibliography
+
+1. BENNETT, M. V. L. 1973. Function of electrotonic junctions in embryonic and adult tissues. *Fed. Proc.* 
+32:65 75. 
+
+2. BERR'~, M. N., and D. S. FRIEND. 1969. High-yield preparations of isolated rat liver parenchymal cells. 
+
+J. Cell Biol. 43:506-520. 
+
+3. BRANTON, D. 1966. Fracture faces of frozen membranes. *Proc. Natl. Acad. Sci. U. S. A.* 55:1048 1051. 
+
+4. DEAN, P. M., and E. K. MATTHEWS. 1968. Electrical activity in pancreatic islet cells. *Nature (Lond.).* 
+219:389-391. 
+
+5. DOUGLAS, W. W., and A. M. POISNER. 1962. On the mode of action of acetylcholine in evoking adrenal medullary secretion: increased uptake of calcium during the secretory response. *J. Physiol. (Lond.).* 
+162:385 392. 
+
+6. DOUGLAS, W. W., and A. M. POISNER. 1964. 
+
+Stimulus-secretion coupling in a secretory organ: the role of calcium in the release of vasopressin from the neurohypophysis. *J. Physiol. (Lond.).* 172:1 18. 
+
+7. DOUGLAS, W. W., and R. P. RUBIN. 1962. The role of calcium in the secretory response of the adrenal medulla to acetylcholine. *J. Physiol. (Lond.).* 
+159:40-57. 
+
+8. FARQUHAR, M. G. 1971. Processing of secretory products by cells of the anterior pituitary gland. 
+
+Mere. Soc. Endocrinol. 19:79-124. 
+
+9. FARQUHAR, M. G., and G. E. PALADE. 1963. Junctional complexes in various epithelia. *J. Cell Biol.* 
+17:375 412. 
+
+10. FAWCETT, D. W., S. [TO, and D. SLAUTTERBACK. 
+
+1959. The occurrence of intercellular bridges in groups of cells exhibiting synchronous differentiation. *J. Biophys. Biochem. Cytol.* 5:453-460. 
+
+I1. FLETCHER, W. H. 1972. Gap junctions between the axolemma and myelin sheath in the central nervous system. *J. Cell Biol.* 55(2, Pt. 2):75 a. (Abstr.). 
+
+12. FRIEND, D. S,, and N. B. GILULA. 1972. A distinctive cell contact in the rat adrenal cortex. *J. Cell Biol.* 
+53:148-163. 
+
+13. GILULA, N. B. 1974. Junctions between cells. In Cell Communication, R. P. Cox, editor. John Wiley & 
+Sons, Inc., New York. 1-29. 
+
+14. GILULA, N. B., O. R. REEVES, and A. STEINBACH. 
+
+1972. Metabolic coupling ionic coupling and cell contacts. *Nature (Lond).* 235:262-265. 
+
+15. HERLANT, M. 1964. The cells of the adenohypophysis and their functional significance. Int. Rev. 
+
+Cytol. 17:299-334. 
+
+16. HERLANT, M., and J. L. PASTEELS. 1967. Histophysiology of the human anterior pituitary. Methods Achier. Exp. Pathol. 3:250 276. 
+
+17. HOPKINS, C. R., and M. G. FARQUHAR. 1973. 
+
+Hormone secretion by cells dissociated from rat anterior pituitaries. *J. Cell Biol.* 59:276 303. 
+
+18. HYMER, W. C., J. KRMCER, S. A. BENSCOME, and J. 
+
+S. HASKILL. 1972. Separation ofsommatotrops from the rat adenohypophysis by velocity and density gradient centrifugation. *Proc. Soc. Exp. Biol. Med.* 
+141:966 973. 
+
+19. KARNOVSKY, M. J. 1967. A formaldehyde-glutaraldehyde fixative of high osmolality for use in electron microscopy. J. *Cell Biol.* 27(2, Pt. 2):137 a. (Abstr.). 
+
+20. KOMNICK, H., and U. KOMNICg. 1961. Elektronen Mikroscopische Untersuchungen funktionellen morphologie des ionentransportes in der salzdruse von Laurus argentatus. Z. ZeHforsch. Mikrosk. Anat. 
+
+60:163 203. 
+
+21. LIVINGSTON, R. B., K. PFENNINGER, H. MOOR, and K. AKERT. 1974. Specialized paranodal and interparanodal glial-axonal junctions in the peripheral and central nervous system: a freeze-etching study. 
+
+Brain. Res. 58:1 24. 
+
+22. LOWENSTEIN, W. R. 1974. Membrane junctions in growth and differentiation. *Fed. Proc.* 32:60 64. 
+
+23. LUFT, J. H. 1971. Ruthenium red and violet: fine structure localization in animal tissues. *Anat. Rec.* 
+171:369 415. 
+
+24. MCN•TT, N. S., and R. S. WEINSTEnN. 1973. 
+
+Membrane ultrastructure at mammalian intercellular junctions. *Prog. Biophvs. Mol. Biol.* 26:45 101. 
+
+25. NAKANE, P. K. 1970. Classification of anterior pituitary cell types with immunoenzyme histochemistry. *J. Histochem. Cytochem.* 18:9 21. 
+
+26. OrcE, L., A. A. LIKE, M. AMHERDT, B. BLONDEr., Y. 
+
+KANAZAWA, E. B. MARLISS, A. E. LAMBERT, C. B. 
+
+WOLLHEIM, and A. E. RENOLD. 1973. Monolayer cell culture of neonatal rat pancreas: an ultrastructural and biochemical study of functioning endocrine cells. *J. Uhrastruct. Res.* 43:270-297. 
+
+27. PARSONS, J. A. 1969. Calcium ion requirement for prolactin secretion by rat adenohypophyses in vitro. 
+
+Am. J. Physiol. 217: 1,599-1,603. 
+
+28. PERRACHIA, C. 1973. Low resistance junctions in crayfish. 1. Two arrays of globules in junctional membranes. *J. Cell Biol.* 57:66-76. 
+
+29. PINTO DE SILVA, P., and D. BRANTON. 1970. Membrane splitting in freeze-etching: Covalently bound ferritin as a membrane marker. *J. Cell Biol.* 
+45:598 - 605. 
+
+30. RAVIOLA, E., and N. B. GILULA. 1973. Gap junctions between photoreceptor cells in the vertebrate retina. 
+
+Proc. Natl. Acad. Sci. U. S. A. 70:1,677-1,681. 
+
+31. REVEL, J. P., and M. J. KARNOVSKY. 1967. Hexagonal array of subunits in intercellular junctions of the mouse heart and liver. *J, Cell Biol.* 33:C7. 
+
+32. ROBERTSON, J. D. 1963. The occurrence ofa subunit pattern in the unit membranes of club endings in Mauthner cell synapses and nodes in goldfish brain. 
+
+J. Cell Biol. 19:201 223. 
+
+33. RUBIN, R. P., S. D. JAANL'S, R. A. CARCH~AN, and M. PUIG. 1973. Reversible inhibition of ACTHinduced corticosteroid release by cyclohexamide: 
+evidence for an unidentified cellular messenger. 
+
+Endocrinology. 93:575-580. 
+
+34. SAMLI, M. H., and i. I. GESCHWIND. 1968. Some effects of energy transfer inhibitors and of Ca + +-free or K § enhanced media on the release of luteinizing hormone (LH) from rat anterior pituitaries in vitro. 
+
+Endocrinology. 82:225-231. 
+
+35. SATIn, P., and N. B. GILULA. 1973. The fine structure of membranes and intercellular communication in insects. *Ann. Rev. Entomol.* 18:143 166. 
+
+36. SAVERS, G., R. J. BEAIL, and S. SEED. 1972. Isolated adrenal cells: adrenocorticotropic hormone, calcium, steroidogenesis and cyclic adenosine monophosphate. *Science (Wash. D. C.).* 175:1,131 1,133. 
+
+37. SHERIDAN, J. D. 1971. Electrical coupling between brown fat cells in newt fat body and mouse brown fat. *J. Cell Biol.* 50:795 803. 
+
+38. STAEHELIN, L. A. 1972. Three types of gap junctions interconnecting intestinal epithelial cells visualized by freeze-etching. *Proc. Natl. Acad. Sci. U. S. A.* 
+69:1,318- 1,32 I. 
+
+39. SUBAK-SHARP, H. P., P. BURK, and T. D. PITTS. 
+
+1969. Metabolic cooperation between biochemically marked mammalian cells in tissue culture. J. Cell Sci. 4:353-367. 
+
+40. TRACttTENBERG, M. C., and D. A. POLLEN. 1970. 
+
+Neuroglia: biophysical properties and physiological function. *Science (Wash. D. C.).* 167:1,248 1,252. 
+
+41. YORK, D. H., F. L. BAKER, and J. KRAICER. 1973. 
+
+Electrical changes induced in rat adenohypophyses in vivo, with hypothalamic extract. *Neuroendocrinology.* 11:212-228. 

medical/md/PMC2693848.md

@@ -0,0 +1,320 @@
+
+## Tap1 And Tap2 Gene Polymorphisms In Korean Patients With Allergic Rhinitis
+
+Antigen peptides are actively transported across the endoplasmic reticulum by the transporters associated with antigen presentation (TAP). TAP genes polymorphism could influence the selection process that determines which antigen peptides play a role in the pathogenesis of allergic rhinitis. The aim of this study was to investigate the association of TAP genes polymorphism with allergic rhinitis. TAP1 and TAP2 genotyping were performed on 110 allergic rhinitis patients and 107 healthy controls. TAP1 polymorphic residues at codons 333 and 637, and TAP2 polymorphic residues at codons 379, 565, 651, and 665 were analyzed by the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). Analysis of TAP1 gene polymorphism demonstrated decreased frequencies of Ile/Val genotype at codon 333, Asp/Gly genotype at codon 637, and haplotype A and B in allergic rhinitis patients when compared to controls (p<0.05). However, there was no significant difference in the genotype, phenotype, or allele frequencies at four TAP2 codons between controls and allergic rhinitis patients. In conclusion, TAP1 gene polymorphism may be an important factor contributing to the genetic susceptibility in the development of allergic rhinitis in the Korean population. 
+
+Key Words : *Allergic Rhinitis; TAP1; TAP2; Polymorphism*
+
+## Introduction
+
+Allergic rhinitis (AR) is an immunologic nasal response, primarily mediated by immunoglobulin E (IgE). It is considered as a heterogenous state, determined by genetic and environmental interactions. Previous studies have shown the relationships between allergies and polymorphisms in many candidate genes such as IgE, transporters associated with antigen processing (TAP), T cell receptors, and cytokines and their receptors (1-5).
+
+The inhalent antigens are presented to CD4+ T cell by MHC class II in AR (6). However, it was suggested that exogenous antigens can be channeled into the endogenous pathway (MHC class I) by TAP molecules (7). Therefore, it would be very interesting to determine the other possible antigenic presentation pathway, mediated by TAP in AR.
+
+TAP1 and *TAP2* genes encode heterodimeric molecules involved in endogenous antigen processing. Antigen peptides are degraded from cytosolic proteins, assembled with MHC class I heavy chain and 2-microglobulin in the endoplasmic reticulum, and actively transported across the endoplasmic reticulum membrane by TAP (8, 9). It is possible that TAP gene polymorphisms can influence the antigen peptide selection and transport process and alter immune response regulation (2).
+
+Kyung Rae Kim*, Seok Hyun Cho*, 
+Suk Joo Choi, Jin Hyeok Jeong, Seung Hwan Lee, Chul Won Park, Kyung Tae Department of Otolaryngology-Head and Neck Surgery, School of Medicine, Hanyang University, Seoul, Korea *Equally contributed.
+
+Received : 26 October 2006 Accepted : 13 February 2007 Address for correspondence Kyung Tae, M.D. Department of Otolaryngology-Head and Neck Surgery, School of Medicine, Hanyang University, 17 Haengdang-dong, Sungdong-gu, Seoul 133-792, Korea Tel : +82.2-2290-8585, Fax : +82.2-2293-3335 E-mail : kytae@hanyang.ac.kr *This work was supported by the research fund of Hanyang University (Grant No. HY-2002-I).
+
+The TAP gene is considered to be one of the candidates for disease susceptibility gene or one of the additional genes conferring susceptibility. Polymorphisms of the TAP gene have been investigated in several HLA-associated diseases such as atopic dermatitis, asthma, rheumatoid arthritis, and systemic lupus erythematosus (10, 11). There have been few studies on the relationship between AR and TAP genes polymorphism, and it still remained controversial. Ismail et al.
+
+(2) reported evidence of a strong association between *TAP1* polymorphism and atopy in a Tunisian population. However, Tacheuchi et al. (12) reported no association between *TAP1* gene polymorphism and AR in a Japanese population. 
+
+Until now, there has been no study on the TAP genes polymorphism in Korean patients with AR. Therefore, we designed a case-control study to investigate the *TAP1* and *TAP2* polymorphisms and their association with AR in a Korean population.
+
+## Subjects Materials And Methods
+
+One hundred and ten consecutive and unrelated patients with AR were included in this study. They consisted of 40 females and 70 males, ranging in age from 5 to 72 yr old (mean, 24.1 yr). All patients had nasal symptoms such as watery rhinorrhea, sneezing, itching and/or nasal obstruction, and positive skin prick tests (Allergopharma�, Hamburg, Germany) for one or more inhalant allergens including house dust mites. There was no co-morbid condition such as allergic asthma or atopic dermatitis. The control group consisted of 107 healthy subjects with no personal or family history of allergic diseases, cancers or genetic diseases. There were 40 females and 67 males ranging from 7-65 yr old (mean, 26.2 yr). All control subjects were negative for all nasal symptoms and skin prick tests. Prior to the experiment, informed consents were obtained from all patients and controls.
+
+## Dna Extraction
+
+Heparinized peripheral venous blood (about 10 mL) was drawn from each individual and stored at -70℃ before being used in the experiment. Genomic DNA was extracted from leukocytes in the collected blood with the WizardTM Genomic DNA purification kit (Promega, Madison, WI, U.S.A.).
+
+## Arms-Pcr
+
+Polymorphic residues at codons 333 and 637 in *TAP1*,
+and codons 379, 565, 651 and 665 in *TAP2* were analyzed.
+
+The dimorphic sites were: *TAP1*333 (A→G, Ile→Val, exon 4), *TAP1*637 (A→G, Asp→Gly, exon 10), *TAP2*379 (G→A,
+Val→Ile), *TAP2*565 (G→A, Ala→Thr), *TAP2*651 (C→T, Arg→Cys) and *TAP2*665 (A→G, Thr→Ala) (13). *TAP1* and *TAP2* polymorphism analyses were performed by the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR), described by Newton et al. (14). Four primers were used for each dimorphic site (Table 1). Two of these were complementary to one of the dimorphic sites, while the other two allele-nonspecific primers were used as an internal control. The *TAP1*333, *TAP1*637, *TAP2*379, *TAP2*565 and TAP2665 primers were designed as described by Powis et al. (15). The *TAP2*651 primers were designed as described by Jackson et al. (16). 
+
+Genomic DNA samples (1 L) were amplified in a 20 L
+reaction mixture containing 1 L each of all four oligonucleotide primers, 2 L dNTPs mix (Cat. No. BIO-39029, London, U.K.), 1 L DNA template, and 13 L of distilled water. A thermal cycler (GeneAmp PCR system 2400, Perkin Elmer, MA, U.S.A.) was used with the following specifications: 94℃ for 6 min; 35 cycles of 94℃ for 1 min, 62℃
+for 1 min and 72℃ for 1 min; there was a final 72℃ incubation for 7 min. The reaction products were separated on a 2% agarose gel stained with ethidium bromide. 
+
+## Determination Of Genotypes And Haplotypes
+
+Genotyping of the *TAP1*333 was done as follows: Ile/Val if 241, 351 and 533 bp bands were visible, Ile/Ile if 241 and 533 bp bands were visible, and Val/Val if 351 and 533 bp bands were visible (Fig. 1). Genotyping of the *TAP1*637 was
+
+| Table 1. Oligonucleotide primers used for ARMS-PCR TAP1 and TAP2 typing Codon Sequence (5′to 3′)   | Specificity                    | Size (bp)    |              |
+|----------------------------------------------------------------------------------------------------|--------------------------------|--------------|--------------|
+| TAP1333                                                                                            | CCCTGCACTGAGATTTGCAGACCTCTGGAG | 5′flanking   | Control; 533 |
+| GATCAGTGTCCCTCACCATGGTCACCCGGA                                                                     | Ile-333                        | Ile-333; 241 |              |
+| GGGCAGAAGGAAAAGCAGAGGCAGGGTCAC                                                                     | Val-333                        | Val-333; 351 |              |
+| ACCTGGGAACATGGACCACAGGGACAGGGT                                                                     | 3′flanking                     |              |              |
+| TAP1637                                                                                            | CATCTTCCCAGAATCTCCCCTATCCAGCTA | 5′flanking   | Control; 429 |
+| CATCTTGGCCCTTTGCTCTGCAGAGGTACA                                                                     | Asp-637                        | Asp-637; 307 |              |
+| ACCCCCTGACAGCTGGCTCCCAGCCTCCC                                                                      | Gly-637                        | Gly-637; 180 |              |
+| TGGGGAGGCATCCAATGGAACTGGATTTGG                                                                     | 3′flanking                     |              |              |
+| TAP2379                                                                                            | TTGGAGGGCTGCAGACCGTTCGCAGTTTTG | 5′flanking   | Control; 427 |
+| GAGACCTGGAACGCGCCTTGTACCTGCGCG                                                                     | Val-379                        | Val-379; 328 |              |
+| ACAACCACTCTGGTATCTTACCCTCCTGAT                                                                     | Ile-379                        | Ile-379; 158 |              |
+| ACATAGCTCCCCACGCTCTCCTGGTAGATC                                                                     | 3′flanking                     |              |              |
+| TAP2565                                                                                            | CTCACAGTATGAACACTGCTACCTGCACAG | 5′flanking   | Control; 400 |
+| TGTTCTCCGGTTCTGTGAGGAACAACAGTA                                                                     | Thr-565                        | Thr-565; 161 |              |
+| ATCATCTTCGCAGCTCTGCAGCCCATAAAC                                                                     | Ala-565                        | Ala-565; 298 |              |
+| GGAGCAAGCTTACAATTTGTAGAAGATACC                                                                     | 3′flanking                     |              |              |
+| TAP2651                                                                                            | AGAGGGAGGACGAAGGACCTACTAGTGGAA | 5′flanking   | Control; 471 |
+| CACCCCTTCAGCTGCAGGACTGGAATTACC                                                                     | Arg-651                        | Arg-651; 195 |              |
+| AGCAATCACCAGCACTGTGCGATCCCCTCA                                                                     | Cys-651                        | Cys-651; 335 |              |
+| GGCCTCAGTCCATCAGCCGCTGCTGCACCA                                                                     | 3′flanking                     |              |              |
+| TAP2665                                                                                            | TTGGGGAATGGAATCCGGTGGTGTGAGGGC | 5′flanking   | Control; 408 |
+| CAGTGCTGGTGATTGCTCACAGGCTGCAAA                                                                     | Thr-665                        | Thr-665; 141 |              |
+| CACCAGGATCTGGTGGGCGCGCTGAACTAC                                                                     | Ala-665                        | Ala-665; 326 |              |
+| TCAGCCGCTGCTGCACCAGGCGGGAATAGA                                                                     | 3′flanking                     |              |              |
+| ARMS-PCR, amplification refractory mutation system-polymerase chain reaction.                      |                                |              |              |
+
+done as follows: Asp/Gly if 180, 307 and 429 bp bands were visible, Asp/Asp if 307 and 429 bp bands were visible, and Gly/Gly if 180 and 429 bp bands were visible. The *TAP2* genotypes were also classified using the same methods.
+
+Four possible *TAP1* haplotypes (A-D) were determined by a combination of the dimorphic sites at codons 333 and 637. Eight possible *TAP2* haplotypes (A-H) were determined by combination of four dimorphic sites at codons 379, 565, 651 and 665. We used *TAP1* and *TAP2* haplotype nomenclature as proposed by Powis et al. (15) and Jackson et al. (16) (Table 2).
+
+## Statistical Analysis
+
+All statistical analyses were performed with SPSS 10.0 (Chicago, IL, U.S.A.). A chi-square test was used to compare the distribution of *TAP1* and *TAP2* genotypes between control and AR groups. Odds ratios (OR) with a 95% confidence interval (CI) were calculated using the Mantel-Haenzel chisquare test. Differences were significant if p<0.05.
+
+## Results Tap1 Polymorphisms And Allergic Rhinitis
+
+Three *TAP1* genotypes (Ile/Ile, Ile/Val and Val/Val) were
+
+![2_image_0.png](2_image_0.png)
+
+found at codon 333 (Table 3). The Ile/Val genotype was significantly decreased in the AR group when compared to Ile/
+Ile (OR=0.32, 95% CI=0.17-0.60, p=0.001). The Val phenotype was significantly decreased in the AR group when compared to the Ile phenotype (OR=0.52, 95% CI=0.300.92, p=0.016). The Val allele was also significantly decreased in AR patients when compared to the Ile allele (OR=0.48, 95% CI=0.28-0.81, p=0.003).
+
+Three *TAP1* genotypes (Asp/Asp, Asp/Gly and Gly/Gly)
+were seen at codon 637 (Table 3). The Asp/Gly genotype was significantly decreased in the AR group when compared to Asp/Asp (OR=0.43, 95% CI=0.24-0.80, p=0.011). In AR
+patients, the Gly allele was significantly decreased when compared to the Asp (OR=0.62, 95% CI=0.38-1.01, p=0.04).
+
+However, there was no difference between the two *TAP1*637 phenotypes, Asp and Gly. 
+
+Four possible *TAP1* haplotypes (A-D) were found in this study (Table 4). The C and D haplotypes were significantly less than A in the AR group (phenotype, p=0.006; allele, p=
+0.0002). By combining the four haplotypes, the following seven genotypes were found: AA, AB, AC, AD, BC, BD, and DD. The AB (OR=0.31), AC (OR=0.08), and AD (OR= 0.13) genotypes were significantly decreased in the AR group when compared with the AA genotype.
+
+## Tap2 Polymorphisms And Allergic Rhinitis
+
+There was no significant difference in the genotype, phenotype, and allele frequencies of *TAP2* at codons 379, 565, 651 and 665 between the AR and control groups (Table 5). The previously reported seven *TAP2* haplotypes (A, B, C,
+D, E, F, and G) were observed; however haplotype H (Ile379-
+Thr565-Arg651-Ala665), reported by Tacheuchi et al. (17) was not found in this study. A new haplotype (Val379-Thr565-Arg651
+-Ala665) was observed in one person (controls), and we named it as haplotype I (Table 2). By combining the eight *TAP2* haplotypes, 18 genotypes could be possible from AA to FG. However, their distributions were not different between the AR and control group (Table 6).
+
+| 333   | 637   | 379   | 565   | 651   | 665   |     |     |     |     |     |     |
+|-------|-------|-------|-------|-------|-------|-----|-----|-----|-----|-----|-----|
+| TAP1  | TAP2  |       |       |       |       |     |     |     |     |     |     |
+| ATC   | GTC   | GAC   | GGC   | GTA   | ATA   | GTA | ATA | GTA | ATA | GTA | ATA |
+| A     | Ile   | Asp   | A     | Val   | Ala   | Arg | Thr |     |     |     |     |
+| B     | Val   | Gly   | B     | Val   | Ala   | Arg | Ala |     |     |     |     |
+| C     | Val   | Asp   | C     | Ile   | Ala   | Arg | Thr |     |     |     |     |
+| D     | Ile   | Gly   | D     | Ile   | Thr   | Arg | Thr |     |     |     |     |
+| E     | Val   | Thr   | Arg   | Thr   |       |     |     |     |     |     |     |
+| F     | Val   | Ala   | Cys   | Thr   |       |     |     |     |     |     |     |
+| G     | Ile   | Ala   | Arg   | Ala   |       |     |     |     |     |     |     |
+| H     | Ile   | Thr   | Arg   | Ala   |       |     |     |     |     |     |     |
+| I     | Val   | Thr   | Arg   | Ala   |       |     |     |     |     |     |     |
+
+| Table 3. TAP1 polymorphisms in allergic rhinitis patients and controls TAP1 Controls Allergic rhinitis   | Odds ratio   | CI*   | p value   |      |      |            |
+|----------------------------------------------------------------------------------------------------------|--------------|-------|-----------|------|------|------------|
+| Genotype                                                                                                 | (n=107)      | (%)   | (n=110)   | (%)  |      |            |
+| TAP1333                                                                                                  | Ile/Ile      | 54    | 50.5      | 82   | 74.5 | 0.001      |
+| Ile/Val                                                                                                  | 53           | 49.5  | 26        | 23.7 | 0.32 | 0.17-0.60  |
+| Val/Val                                                                                                  | 0            | 0     | 2         | 1.8  |      |            |
+| TAP1637                                                                                                  | Asp/Asp      | 55    | 51.4      | 76   | 69   | 0.011      |
+| Asp/Gly                                                                                                  | 50           | 46.7  | 30        | 27.3 | 0.43 | 0.24-0.80  |
+| Gly/Gly                                                                                                  | 2            | 1.9   | 4         | 3.7  | 1.45 | 0.22-11.85 |
+| Phenotype                                                                                                | (n=107)      | (%)   | (n=110)   | (%)  |      |            |
+| TAP1333                                                                                                  | Ile          | 107   | 100       | 108  | 98.2 | 0.016      |
+| Val                                                                                                      | 53           | 49.5  | 28        | 25.5 | 0.52 | 0.30-0.92  |
+| TAP1637                                                                                                  | Asp          | 105   | 98.1      | 106  | 96.4 | 0.094      |
+| Gly                                                                                                      | 52           | 48.6  | 34        | 30.9 | 0.65 | 0.38-1.11  |
+| Allele                                                                                                   | (2n=214)     | (%)   | (2n=220)  | (%)  |      |            |
+| TAP1333                                                                                                  | Ile          | 161   | 75.2      | 190  | 86.4 | 0.003      |
+| Val                                                                                                      | 53           | 24.8  | 30        | 13.6 | 0.48 | 0.28-0.81  |
+| TAP1637                                                                                                  | Asp          | 160   | 74.8      | 182  | 82.7 | 0.04       |
+| Gly                                                                                                      | 54           | 25.2  | 38        | 17.3 | 0.62 | 0.38-1.01  |
+| *, 95% confidence interval.                                                                              |              |       |           |      |      |            |
+
+Table 4. *TAP1* haplotypes in allergic rhinitis patients and controls
+
+| TAP1      | Controls   | Allergic rhinitis   | Odds ratio   | CI*   | p value   |            |
+|-----------|------------|---------------------|--------------|-------|-----------|------------|
+| Genotype  | (n=107)    | (%)                 | (n=110)      | (%)   |           |            |
+| AA        | 29         | 27.1                | 71           | 64.5  |           |            |
+| AB        | 28         | 26.2                | 21           | 19.1  | 0.31      | 0.14-0.66  |
+| AC        | 26         | 24.3                | 5            | 4.5   | 0.08      | 0.02-0.24  |
+| AD        | 22         | 20.6                | 7            | 6.4   | 0.13      | 0.04-0.37  |
+| BC        | 0          | 0                   | 2            | 1.8   |           |            |
+| BD        | 1          | 0.9                 | 0            | 0     | 0         | 0.00-7.38  |
+| DD        | 1          | 0.9                 | 4            | 3.7   | 1.63      | 0.16-41.08 |
+| Phenotype | (n=107)    | (%)                 | (n=110)      | (%)   |           |            |
+| A         | 104        | 97.2                | 104          | 94.5  | 0.006     |            |
+| B         | 29         | 27.1                | 23           | 20.9  | 0.76      | 0.41-1.52  |
+| C         | 26         | 24.3                | 7            | 6.4   | 0.27      | 0.10-0.69  |
+| D         | 24         | 22.4                | 11           | 10.0  | 0.46      | 0.20-1.04  |
+| Allele    | (2n=214)   | (%)                 | (2n=220)     | (%)   |           |            |
+| A         | 134        | 62.6                | 175          | 79.5  | 0.0002    |            |
+| B         | 29         | 13.6                | 23           | 10.5  | 0.61      | 0.32-1.14  |
+| C         | 26         | 12.1                | 7            | 3.2   | 0.21      | 0.08-0.52  |
+| D         | 25         | 11.7                | 15           | 6.8   | 0.46      | 0.22-0.95  |
+
+*, 95% confidence interval.
+
+## Discussion
+
+It is well known that the major histocompatibility complex (MHC) class I and II have fundamentally different antigen processing pathways. The exogenous antigens such as bacteria are degraded into antigenic peptides within the lysosomes. Upon fusion with endosomes, these peptides may bind MHC II molecules (18). Finally, peptide-loaded MHC
+class II molecules are delivered to the cell surface, and presented to CD4+ helper T cells. However, the endogenous antigens such as virus and tumor antigens are degraded within the proteasomes and actively transported across the endoplasmic reticulum membrane by TAP (8, 9). These peptides are then assembled with the MHC class I heavy chain and 2-microglobulin. This complex is expressed on the cell surface, where it is recognized by CD8+ T cells. Suto et al. (7)
+suggested, however, that exogenous antigens can be channeled into the endogenous pathway where antigen presentation is mediated by MHC class I molecules. Therefore, TAP might participate in both endogenous and exogenous antigen processing. Because AR is a disease caused by inhalant exogenous antigens such as pollens and house dust mites, the preferential pathway of antigen processing is known to be MHC class II.
+
+However, it would be possible that inhalant antigenic peptides can be routed into the MHC class I (endogenous) path-
+
+| Table 5. TAP2 polymorphisms in allergic rhinitis patients and controls TAP2 Controls Allergic rhinitis   | Odds ratio   | CI*   | p value   |      |      |           |
+|----------------------------------------------------------------------------------------------------------|--------------|-------|-----------|------|------|-----------|
+| Genotype                                                                                                 | (n=107)      | (%)   | (n=110)   | (%)  |      |           |
+| TAP2379                                                                                                  | Val/Val      | 84    | 78.5      | 81   | 73.6 | 0.373     |
+| Val/Ile                                                                                                  | 22           | 20.6  | 29        | 26.4 | 1.37 | 0.69-2.70 |
+| Ile/Ile                                                                                                  | 1            | 0.9   | 0         | 0    |      |           |
+| TAP2565                                                                                                  | Ala/Ala      | 89    | 83.2      | 95   | 86.4 | 0.513     |
+| Ala/Thr                                                                                                  | 18           | 16.8  | 15        | 13.6 | 0.8  | 0.35-1.74 |
+| Thr/Thr                                                                                                  | 0            | 0     | 0         | 0    |      |           |
+| TAP2651                                                                                                  | Arg/Arg      | 83    | 77.6      | 81   | 73.6 | 0.789     |
+| Arg/Cys                                                                                                  | 23           | 21.5  | 28        | 25.5 | 1.25 | 0.63-2.46 |
+| Cys/Cys                                                                                                  | 1            | 0.9   | 1         | 0.9  | 1.02 | 0.00-3.82 |
+| TAP2665                                                                                                  | Thr/Thr      | 39    | 36.4      | 41   | 37.3 | 0.548     |
+| Thr/Ala                                                                                                  | 51           | 47.7  | 57        | 51.8 | 1.06 | 0.57-1.98 |
+| Ala/Ala                                                                                                  | 17           | 15.9  | 12        | 10.9 | 0.67 | 0.26-1.72 |
+| Phenotype                                                                                                | (n=107)      | (%)   | (n=110)   | (%)  |      |           |
+| TAP2379                                                                                                  | Val          | 106   | 99.1      | 110  | 100  | 0.53      |
+| Ile                                                                                                      | 23           | 21.5  | 29        | 26.4 | 1.22 | 0.63-2.33 |
+| TAP2565                                                                                                  | Ala          | 107   | 100       | 110  | 100  | 0.58      |
+| Thr                                                                                                      | 18           | 16.8  | 15        | 13.6 | 1.23 | 0.56-2.74 |
+| TAP2651                                                                                                  | Arg          | 106   | 99.1      | 109  | 99.1 | 0.60      |
+| Cys                                                                                                      | 24           | 22.4  | 29        | 26.4 | 1.18 | 0.62-2.24 |
+| TAP2665                                                                                                  | Thr          | 90    | 84.1      | 98   | 89.1 | 0.75      |
+| Ala                                                                                                      | 68           | 63.6  | 69        | 62.7 | 0.93 | 0.59-1.48 |
+| Allele                                                                                                   | (2n=214)     | (%)   | (2n=220)  | (%)  |      |           |
+| TAP2379                                                                                                  | Val          | 190   | 88.8      | 191  | 86.8 | 0.53      |
+| Ile                                                                                                      | 24           | 11.2  | 29        | 13.2 | 1.2  | 0.65-2.22 |
+| TAP2565                                                                                                  | Ala          | 196   | 91.6      | 205  | 93.2 | 0.53      |
+| Thr                                                                                                      | 18           | 8.4   | 15        | 6.8  | 0.8  | 0.37-1.17 |
+| TAP2651                                                                                                  | Arg          | 189   | 88.3      | 190  | 86.4 | 0.54      |
+| Cys                                                                                                      | 25           | 11.7  | 30        | 13.6 | 1.19 | 0.65-2.19 |
+| TAP2665                                                                                                  | Thr          | 129   | 60.3      | 139  | 63.2 | 0.53      |
+| Ala                                                                                                      | 85           | 39.7  | 81        | 36.8 | 1.13 | 0.75-1.70 |
+| *, 95% confidence interval.                                                                              |              |       |           |      |      |           |
+
+way, involving TAP molecules in AR (2). The genes encoding the two TAP subunits (*TAP1* and *TAP2*) are located within the MHC class II region between the DPB1 and DQB1 loci (8, 9). Two *TAP1* dimorphic sites (Ile/Val-333 and Asp/Gly-637) and five *TAP2* dimorphic sites (Val/Ile379, Ala/Thr-565, Arg/Cys-651, Thr/Ala-665 and Stop/
+Gln-687) have been widely investigated. It is possible that these genetic variations may modify the TAP molecular structures, influencing antigen peptide selection. 
+
+TAP gene polymorphisms have been investigated in several MHC-associated diseases (multiple sclerosis, Grave's disease, and insulin-dependent diabetes mellitus), mostly in Caucasian patients (19-21). Until now, there have been few studies on AR in an Asian population. Ismail et al. (2) provided evidence of a strong association between *TAP1* polymorphism and atopy in a Tunisian population. Tacheuchi et al. (12) reported no association between *TAP1* gene polymorphism and AR in a Japanese population. Therefore, we believe that it is one of the controversial issues in the pathogenetic mechanism of the AR. In this study, we demonstrated a strong association between AR and *TAP1* polymorphism, but not *TAP2*. In the AR group, Ile/Val at *TAP1*333, Asp/Gly at *TAP1*637, and *TAP1* haplotypes C and D were significantly decreased when compared to controls. These results are different from those of previous studies. To find any causes of such discrepancy, we compared the results of controls in different ethnics. In our study, a decreased *TAP1* haplotype A frequency and increased haplotype C and D frequencies were observed when compared to the Tunisian (2) and Japanese (12) controls. *TAP1* haplotype D also deserves to be mentioned. In control groups, *TAP1* haplotype D was found in 5% of Tunisians (2), 7.3% of Japanese (12). However, in our study, *TAP1* haplotype D was found in 11.7% of controls. There might be the various spectrums of genetic pools among different ethnic groups, and therefore, it may be not meaningful to simply compare the results of genetic polymorphisms that have been done in different ethnic groups.
+
+Other possible reasons for such discrepancies might be due to multiple factors such as different phenotypic characteristics, heterogeneity within groups of patients and controls, and different genotyping methods.
+
+In this study, we also analyzed the relationships between TAP1 gene polymorphisms and the results of allergy tests such as total serum IgE, and the strength and the multiplic-
+
+| Table 6. TAP2 haplotypes in allergic rhinitis patients and controls TAP2 Controls Allergic rhinitis   | Odds ratio   | CI*   | p value   |      |      |            |
+|-------------------------------------------------------------------------------------------------------|--------------|-------|-----------|------|------|------------|
+| Genotype                                                                                              | (N=107)      | (%)   | (N=110)   | (%)  |      |            |
+| AA                                                                                                    | 13           | 12.1  | 11        | 10.0 |      |            |
+| AB                                                                                                    | 23           | 21.5  | 28        | 25.5 | 1.44 | 0.49-4.27  |
+| AC                                                                                                    | 6            | 5.7   | 5         | 4.5  | 0.98 | 0.19-5.16  |
+| AD                                                                                                    | 2            | 1.9   | 5         | 4.5  | 2.95 | 0.38-27.84 |
+| AE                                                                                                    | 5            | 4.7   | 3         | 2.7  | 0.71 | 0.10-4.68  |
+| AF                                                                                                    | 5            | 4.7   | 10        | 9.1  | 2.36 | 0.51-11.29 |
+| BB                                                                                                    | 16           | 15.0  | 12        | 10.9 | 0.89 | 0.26-3.06  |
+| BC                                                                                                    | 8            | 7.5   | 11        | 10.0 | 1.63 | 0.41-6.56  |
+| BD                                                                                                    | 0            | 0     | 2         | 1.9  |      |            |
+| BE                                                                                                    | 8            | 7.5   | 4         | 3.7  | 0.59 | 0.11-3.08  |
+| BF                                                                                                    | 11           | 10.3  | 11        | 10.0 | 1.18 | 0.32-4.43  |
+| BI                                                                                                    | 1            | 0.9   | 0         | 0    | 0    | 0.00-23.81 |
+| CC                                                                                                    | 1            | 0.9   | 0         | 0    | 0    | 0.00-23.81 |
+| CF                                                                                                    | 4            | 3.7   | 5         | 4.5  | 1.48 | 0.25-8.98  |
+| DF                                                                                                    | 1            | 0.9   | 0         | 0    | 0    | 0.00-23.81 |
+| EF                                                                                                    | 1            | 0.9   | 1         | 0.9  | 1.18 | 0.00-50.21 |
+| FF                                                                                                    | 1            | 0.9   | 1         | 0.9  | 1.18 | 0.00-50.21 |
+| FG                                                                                                    | 1            | 0.9   | 1         | 0.9  | 1.18 | 0.00-50.21 |
+| Phenotype                                                                                             | (n=107)      | (%)   | (n=110)   | (%)  |      |            |
+| A                                                                                                     | 53           | 49.5  | 62        | 56.4 | 1    | 0.892      |
+| B                                                                                                     | 67           | 62.6  | 68        | 61.8 | 0.87 | 0.51-1.47  |
+| C                                                                                                     | 19           | 17.8  | 21        | 19.1 | 0.94 | 0.43-2.07  |
+| D                                                                                                     | 3            | 2.8   | 7         | 6.4  | 9.0  | 0.43-10.31 |
+| E                                                                                                     | 14           | 13.1  | 8         | 7.3  | 0.49 | 0.17-1.37  |
+| F                                                                                                     | 23           | 21.5  | 29        | 26.4 | 1.08 | 0.53-2.20  |
+| G                                                                                                     | 1            | 0.9   | 1         | 0.9  | 0.85 | 0.02-3.21  |
+| I                                                                                                     | 1            | 0.9   | 0         | 0    | 0    | 0.00-1.52  |
+| Allele                                                                                                | (2n=214)     | (%)   | (2n=220)  | (%)  |      |            |
+| A                                                                                                     | 67           | 31.3  | 73        | 33.2 | 1    | 0.864      |
+| B                                                                                                     | 83           | 38.8  | 80        | 36.4 | 0.88 | 0.55-1.43  |
+| C                                                                                                     | 20           | 9.3   | 21        | 9.5  | 0.96 | 0.45-2.05  |
+| D                                                                                                     | 3            | 1.4   | 7         | 3.2  | 2.14 | 0.47-10.95 |
+| E                                                                                                     | 14           | 6.5   | 8         | 3.6  | 0.52 | 0.19-1.44  |
+| F                                                                                                     | 25           | 11.7  | 30        | 13.6 | 1.1  | 0.56-2.16  |
+| G                                                                                                     | 1            | 0.5   | 1         | 0.5  | 0.92 | 0.02-34.35 |
+| I                                                                                                     | 1            | 0.5   | 0         | 0    | 0    | 0.00-16.26 |
+| *, 95% confidence interval.                                                                           |              |       |           |      |      |            |
+
+ity of positive allergens in skin prick tests; however, there was no association between them (data not shown). 
+
+In conclusion, this study showed a meaningful association between AR and a *TAP1* polymorphism, but not *TAP2*. Therefore, it is suggested that a *TAP1* gene polymorphism may be an important factor in AR pathogenesis in a Korean population.
+
+## References
+
+1. Cox HE, Moffatt MF, Faux JA, Walley AJ, Coleman R, Trembath RC, Cookson WO, Harper JI. Association of atopic dermatitis to the beta subunit of the high affinity immunoglobulin E receptor. Br J Dermatol 1998; 138: 182-7. 
+
+2. Ismail A, Bousaffara R, Kaziz J, Jili J, el Kamel A, Tahar Sfar M,
+Remadi S, Chouchane L. Polymorphism in transporter antigen peptides gene (TAP1) associated with atopy in Tunisians. J Allergy Clin Immunol 1997; 99: 216-23. 
+
+3. Moffatt MF, Traherne JA, Abecasis GR, Cookson WO. Single nucleotide polymorphism and linkage disequilibrium within the TCR
+alpha/delta locus. Hum Mol Genet 2000; 9: 1011-9. 
+
+4. Kim JJ, Kim MS, Lee JH, Choi TW, Choi SH, Chung HT. *STAT6* gene polymorphisms in allergic rhinitis. Genomics Inform 2004; 2: 126-30.
+
+5. Chae SC, Park YR, Li CS, Lee JH, Yang YS, Zhang Q, Kim KS,
+Chung HT. Analysis of the variations in IL-28RA gene and their association with allergic rhinitis. Exp Mol Med 2006; 38: 302-9.
+
+6. Middleton E Jr. *Antigen presentation. In: Adkinson NF Jr, Yunginger JW, Busse WW, Bochner BS, Holgate ST, Simons FE, editors,*
+Middleton's allergy-principle and practice. 6th edition, Vol 1, PA, Mosby, 2003; 177-88.
+
+7. Suto R, Srivastava PK. A mechanism for the specific immunogenicity of heat shock protein-chaperoned peptides. Science 1995; 269: 1585-8.
+8. Deverson EV, Gow IR, Coadwell WJ, Monaco JJ, Butcher GW,
+Howard JC. *MHC class II region encoding proteins related to the* multidrug resistance family of transmembrane transporters. Nature 1990; 348: 738-41. 
+
+9. Trowsdale J, Hanson I, Mockridge I, Beck S, Townsend A, Kelly A. Sequences encoded in the class II region of the MHC related to the ''ABC'' superfamily of transporters. Nature 1990; 348: 741-4. 
+
+10. Yu MC, Huang CM, Wu MC, Wu JY, Tsai FJ. Association of TAP2 gene polymorphisms in Chinese patients with rheumatoid arthritis. Clin Rheumtol 2004; 23: 35-9.
+
+11. Correa RA, Molina JF, Pinto LF, Arcos-Burgos M, Herrera M, Anaya JM. TAP1 and TAP2 polymorphisms analysis in northwestern Colombian patients with systemic lupus erythematosus. Ann Rheum Dis 2003; 62: 363-5.
+
+12. Takeuchi K, Abe S, Masuda S, Yuta A, Majima Y, Sakakura Y. *Lack* of association between gene polymorphism of transporters associated with antigen processing and allergic rhinitis in a Japanese population. Ann Otol Rhinol Laryngol 2002; 111: 460-3. 
+
+13. Zhang SL, Chabod J, Penfornis A, Reviron D, Tiberghien P, Wendling D, Toussirot E. *TAP1 and TAP2 gene polymorphism in rheumatoid arthritis in a population in eastern France. Eur J Immunogenet 2002; 29: 241-9.*
+14. Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C,
+Kalsheker N, Smith JC, Markham AF. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 1989; 11: 2503-16. 
+
+15. Powis SH, Tonks S, Mockridge I, Kelly AP, Bodmer JG, Trowsdale J. *Alleles and haplotypes of the MHC-encoded ABC transporters* TAP1 and TAP2. Immunogenetics 1993; 37: 373-80. 
+
+16. Jackson DG, Capra JD. *TAP2 association with insulin-dependent* diabetes mellitus is secondary to HLA-DQB1. Hum immunol 1995; 43: 57-65. 
+
+17. Takeuchi F, Kuwata S, Nakano K, Nabeta H, Hong GH, Shibata Y,
+Tanimoto K, Ito K. Association of TAP1 and TAP2 with systemic sclerosis in Japanese. Clin Exp Rheumatol 1996; 14: 513-21.
+
+18. Cresswell P. Invariant chain structure and MHC class II function.
+
+Cell 1996; 23: 505-7.
+
+19. Kellar-Wood HF, Powis SH, Gray J, Compston DA. MHC-encoded TAP1 and TAP2 dimorphisms in multiple sclerosis. Tissue Antigens 1994; 43: 129-32. 
+
+20. Rau H, Nicolay A, Usadel KH, Finke R, Donner H, Walfish PG,
+Badenhoop K. Polymorphisms of TAP1 and TAP2 genes in Grave's disease. Tissue Antigens 1997; 49: 16-22. 
+
+21. van Endert PM, Liblau RS, Patel SD, Fugger L, Lopez T, Pociot F,
+Nerup J, McDevitt HO. *Major histocompatibility complex-encoded* antigen processing gene polymorphism in IDDM. Diabetes 1994; 43: 110-7. 

medical/md/PMC4286842.md

@@ -0,0 +1,365 @@
+Departments of Intensive Care, 1Radiology, 5Pathology, College of Medicine, King Saud bin Abdulaziz University for Health Sciences, King Abdulaziz Medical City, National Guard Health Affairs, 2Departments of Medicine, King Fahad General Hospital, Jeddah, 3*Medicine, King Fahad* Medical City, Ministry of Health, Riyadh, 4*Department* of Surgery, Um Al Qura University, Makkah, 6Department of Medicine, King Abdulaziz Medical City, Riyadh, College of Medicine, King Saud bin Abdulaziz University for Health Sciences, 7King Saud University, Saudi Arabia, 8Departments of Clinical Epidemiology and Biostatistics and 9*Medicine,* 
+McMaster University, Hamilton, Canada, 10Department of Internal Medicine and Nephrology, University of MissouriKansas City, Kansas City, Missouri, United States, 11Institute for Education and Research, Hospital Moinhos de Vento, Porto Alegre, Brazil
+
+# The Saudi Clinical Practice Guideline For The Diagnosis Of The First Deep Venous Thrombosis Of The Lower Extremity
+
+Fahad Al-Hameed, Hasan M Al-Dorzi, Abdulrahman Shamy1, Abdulelah Qadi2, Ebtisam Bakhsh3, Essam Aboelnazar4, Mohamad Abdelaal5, Tarig Al **Khuwaitir2**, Mohamed S. Al-Moamary6, Mohamed S. Al-Hajjaj7**, Jan Brozek8,9,** Holger **Schünemann8,9, Reem Mustafa8,10, Maicon Falavigna8,11**
+
+## Abstract:
+
+The diagnosis of deep venous thrombosis (DVT) may be challenging due to the inaccuracy of clinical assessment and diversity of diagnostic tests. On one hand, missed diagnosis may result in life-threatening conditions. On the other hand, unnecessary treatment may lead to serious complications. As a result of an initiative of the Ministry of Health of the Kingdom of Saudi Arabia (KSA), an expert panel led by the Saudi Association for Venous Thrombo-Embolism (SAVTE; a subsidiary of the Saudi Thoracic Society) with the methodological support of the McMaster University Working Group, produced this clinical practice guideline to assist healthcare providers in evidence-based clinical decision-making for the diagnosis of a suspected first DVT of the lower extremity. Twenty-four questions were identified and corresponding recommendations were made following the Grading of Recommendations, Assessment, Development and Evaluation (GRADE) approach. These recommendations included assessing the clinical probability of DVT using Wells criteria before requesting any test and undergoing a sequential diagnostic evaluation, mainly using highly sensitive D-dimer by enzyme-linked immunosorbent assay (ELISA) and compression ultrasound. Although venography is the reference standard test for the diagnosis of DVT, its use was not recommended. Key words: Clinical practice guideline, deep venous thrombosis, diagnosis, Saudi Arabia, venous thromboembolism Address for correspondence:
+Dr. Fahad Al-Hameed, Chairman of the Saudi Association for VenousThrombo-Embolism (SAVTE), 
+Department of Intensive Care, College of Medicine, King Saud bin Abdul-Aziz University for Health Sciences KSAU-HS, 
+King Abdul-Aziz Medical City, National Guard Health Affairs, Jeddah, Saudi Arabia.
+
+E-mail: fahadalhameed@
+hotmail.com Submission: 28-09-2014 Accepted: 16-10-2014 Access this article online
+
+![0_image_0.png](0_image_0.png)
+
+DOI: 10.4103/1817-1737.146849
+Venous thromboembolism (VTE), comprised of deep venous thrombosis (DVT) and pulmonary embolism (PE), is a common condition, affecting approximately 100 per 100,000 people per year.[1-3] Its incidence increases with age, rising exponentially from less than 5 per 100,000 per year in those aged under 15 to over 500 per 100,000 per year in those aged over 80 years.[4,5] The major risk factors other than age include surgery, hospitalization, immobility, trauma, pregnancy and puerperium, hormone use, cancer, obesity, and inherited and acquired hypercoagulable states.[6] VTE incidence varies among the different ethnic groups. Compared to whites, blacks have higher incidence (ageadjusted hazard ratio, 1.6; 95% confidence interval (CI), 1.2-2.2);[7] while Asians, Pacific Islanders, and Hispanics have lower incidence, at least in the United States.[8] The true incidence of VTE in the Kingdom of Saudi Arabia (KSA) is unknown. Assuming similar rate to those present in other parts of the world, approximately 25,000 people are affected in the KSA annually. For DVT, patients may present with swelling, redness, and pain of the leg; but are frequently asymptomatic. Clinical assessment is frequently inaccurate,[9] leading to important concerns about misdiagnosis. Complications of lower extremity 
+
+![0_image_1.png](0_image_1.png)
+
+DVT include PE in 15-32%,[10,11] recurrence at 12 months in 10%,[12] and post-thrombotic syndrome in up to 56%.[13] Death within 1 month of a DVT 
+episode occurs in about 6%, compared with 10% in those with PE.[14] While not treating DVT may result in serious complications, overtreatment is associated with higher bleeding rates, including intracranial and gastrointestinal hemorrhages.[15-18]
+As physical examination frequently fails to diagnose DVT, several strategies have been developed to improve diagnostic accuracy and minimize health consequences of misdiagnosis and overtreatment. The diagnostic strategies for DVT usually consist of clinical pretest probability assessment, using structured scoring systems, followed by sequential testing using the D-dimer assay and imaging studies. The Wells score 
+[Table 1][19,20] is the most studied structured scoring systems and categorizes patients as having low (5.0%; 95% CI, 4.0-8.0%), moderate (17%; 95% CI, 13-23%), or high probability of having DVT (53%; 95% CI, 44-61%).[20]
+Compression ultrasound (CUS) of the proximal veins is the commonly used imaging test. Other tests, such as contrast venography, which is still considered the reference standard for DVT 
+
+| Table 1: Wells model for assessment of deep venous thrombosis Clinical variable                                                                                                                            | Score*   |
+|------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|----------|
+| Active cancer (treatment ongoing or within previous 6 months or palliative)                                                                                                                                | 1        |
+| Paralysis, paresis, or recent plaster immobilization of the lower extremities                                                                                                                              | 1        |
+| Recently bedridden for 3 days or more, or major surgery within the previous 12 weeks requiring general or regional anesthesia                                                                              | 1        |
+| Localized tenderness along the distribution of the deep venous system                                                                                                                                      | 1        |
+| Entire leg swelling                                                                                                                                                                                        | 1        |
+| Calf swelling at least 3 cm larger than that on the asymptomatic leg (measured 10 cm below the tibial tuberosity)†                                                                                         | 1        |
+| Pitting edema confined to the symptomatic leg                                                                                                                                                              | 1        |
+| Collateral superficial veins (nonvaricose)                                                                                                                                                                 | 1        |
+| Previously documented deep venous thrombosis                                                                                                                                                               | 1        |
+| Alternative diagnosis at least as likely as deep venous thrombosis                                                                                                                                         | -2       |
+| *Scoring method indicates high probability if score is 3 or more; moderate if score is 1 or 2; and low if score is 0 or less, † in patients with symptoms in both legs, the  more symptomatic leg was used |          |
+
+diagnosis, computed tomography, and magnetic resonance imaging may be occasionally used.[1,4]
+The Ministry of Health in the KSA had begun an initiative to promote evidence-based practice across the country and provide guidance for the diagnosis and management of several common diseases, which included DVT. In this document, we report the recommendations of the Saudi Expert Panel for the diagnosis of the first DVT of the lower extremity. The full guideline is available at: http://www.moh.gov.sa/depts/ Proofs/Pages/Guidelines.aspx.
+
+## Methods
+
+This clinical practice guideline was a part of the larger initiative of the KSA Ministry of Health to provide guidance for clinicians to ensure high quality of care and reduce variability in clinical practice across the Kingdom. For this purpose, the KSA Ministry of Health, through the Saudi Center for Evidence Based Healthcare, partnered with the McMaster University Working Group to provide methodological support and contacted the Saudi Association for Venous ThromboEmbolism (SAVTE) to nominate a group of clinicians from various specialties to serve as an expert panel for guideline development on DVT diagnosis. We present the detailed methodology in a separate publication.[21]
+First, the invited KSA guideline panel selected all clinical questions addressed herein using a formal prioritization process. For all selected questions, the McMaster University working group updated the existing systematic reviews that were used for the "Diagnosis of DVT" chapter of the 2012 Antithrombotic Therapy and Prevention of Thrombosis Guidelines, 9th edition (AT9).[1] To develop a complete guideline for the KSA, the group also conducted systematic searches for information that were specific to the Saudi context including searches for information about patient values and preferences, cost and resource use. Thereafter, summaries of available evidence related to the selected questions were prepared following the Grading of Recommendations, Assessment, Development and Evaluation 
+(GRADE) approach.[22] The quality of evidence was assessed according to the GRADE system[23] and was classified as 
+"high", "moderate", "low", or "very low" based on the methodological characteristics of the available evidence. The definition of each category is as follows: 
+
+- High: We are very confident that the true effect lies close to that of the effect estimate.
+
+- Moderate: We are moderately confident in the effect estimate and in that the true effect is likely to be close to the effect estimate, but there is a possibility that it is substantially different.
+
+- Low: Our confidence in the effect estimate is limited, such that the true effect may be substantially different from the effect estimate.
+
+- Very low: We have very little confidence in the effect estimate, such that the true effect is likely to be substantially different from the estimate of effect.
+The guideline panel met in Riyadh on December 2 and 3, 2013. On the 1st day, the panel was educated on the GRADE approach. On the 2nd day, the McMaster Working Group provided the panel with pertinent literature summary in the form of GRADE evidence profiles. The assumed rates of fatal and nonfatal PE were 0.3 and 1.4% for treated patients and 1.9 and 9.3% for untreated patients, respectively.[1,4] The assumed risk for fatal bleeding, nonfatal intracranial bleeding, and nonfatal non-intracranial bleeding were 0.3, 0.1, and 2.1%, 
+respectively, for patients given antithrombotic therapy.[1,4] The values and preferences of patients considering antithrombotic therapy were identified using a recent systematic review.[24]
+Utility values for outcomes considered critical for decision making are summarized in Table 2. The results of diagnostic accuracy studies were summarized as sensitivity, specificity, and post-test probabilities of having DVT during the followup period. Figure 1 demonstrates how to calculate these and other diagnostic properties of tests and provides an example. In order to estimate the impact on patient-important outcomes, crude rates of events were provided for the panel members to support the clinical judgment using simulation (Table 3 for events due to lack of treatment and Table 4 for events due to unnecessary treatment). All of the above allowed the guideline panel to follow a structured consensus process and formulate all recommendations according to the GRADE approach, facilitated by the use of evidence-todecision tables, with each recommendation being either strong or conditional (weak) as described in Table 5. Due to the lack of evidence coming from the Middle East, the panel members assumed that the values placed on outcomes by the patients in the KSA were probably similar to those of other populations. Based on the presented evidence, the panel concluded that there might be some degree of variability in values and preferences of patients, that the importance of major bleeding 
+
+| antithrombotic therapy Outcome                                                                            | Utility (range)   |
+|-----------------------------------------------------------------------------------------------------------|-------------------|
+| Death                                                                                                     | 0                 |
+| Nonfatal intracranial bleed (severe)                                                                      | 0.1-0.51          |
+| Nonfatal intracranial bleed (moderate)                                                                    | 0.29-0.77         |
+| Nonfatal intracranial bleed (mild)                                                                        | 0.47-0.94         |
+| Nonfatal pulmonary embolism                                                                               | 0.63              |
+| Non-intracranial nonfatal major bleeding event                                                            | 0.44-0.84         |
+| Utility values range from 0 to 1. Zero is attributed to death while 1 represents  perfect state of health |                   |
+
+Figure 1: Diagnostic properties of a given test. For example, if 1,000 people with low pretest probability for DVT (DVT present in 5% or 50 out of 1,000 people) 
+underwent highly sensitive D-dimer assay (assumed sensitivity = 90% and specificity = 50%), A (true positives) will be 45, B (false positives) = 450, C (false negatives) = 5, D (true negatives) = 450, positive predictive value = 45/495 × 100 = 
+9.1%, and negative predictive value = 450/455 × 100 = 98.9%
+was equivalent to PE, that intracranial bleeding is two to three times worse than major non-intracranial bleeding or PE, and that DVT treatment was generally well accepted by affected patients. All decisions made during the meeting were transparently documented. Potential conflicts of interests of all panel members were managed according to the World Health Organization rules.[25]
+
+## Results
+
+The panel provided recommendations on four major issues: I: The need for clinical assessment of the pretest probability of first lower extremity DVT (Question 1), II: The diagnostic strategy in patients with low pretest probability of first lower extremity DVT (Questions 2-8), III: The diagnostic strategy in patients with moderate pretest probability of first lower extremity DVT (Questions 9-16) and IV: The diagnostic strategy in patients with high pretest probability of first lower extremity DVT (Questions 17-24). The recommendations were made taking into account the available evidence, resource use, and the Saudi context. The full document related to this guideline development and recommendations is available online at http://www.moh.gov.sa I - Clinical assessment of pretest probability of first lower extremity DVT
+One important question is related to the clinical assessment of pretest probability of first lower extremity DVT. Question 1: In patients with a suspected first lower extremity DVT, should the choice of diagnostic tests be guided by the clinical assessment of pretest probability instead of performing the same diagnostic tests in all patients?
+
+  5 Summary of findings Pretest probability assessment is commonly used in practice associated to proximal CUS and D-dimer testing. A randomized controlled trial (RCT) which compared the clinical assessment of the pretest probability of having DVT followed by a diagnostic strategy with a uniform diagnotic strategy without clinical assessment was identified in our update of literature.[26]
+It randomized 1,723 patients (89% outpatients) and found no differences in VTE risk (0%; 95% CI, -0.8 to 0.8%), major bleeding events (0.1%; 95% CI, -0.5 to 0.7%), or death (0%; 95% 
+CI, -1.3 to 1.3%) during the 3 months of follow-up.[26] (Moderate quality of evidence) Resource use The number of tests required was lower for the strategy based on clinical assessment of pretest probability (-21.8%; 95% CI, -19.1 to -24.8% and -7.6%; 95% CI, -2.9% to -12.2% for D-dimer testing and ultrasound, respectively).[26] Although there was no formal economic assessment, the strategy was considered cost-saving as the number of tests required was lower and the rate of events was similar. Other considerations Although the recommendation was considered an acceptable option to stakeholders, there may be resistance to its use by some physicians. Implementation considerations Administrative empowerment and educational interventions may be needed to overcome potential expected initial resistance. When applicable, the use of new technologies may be helpful for the implementation (e.g., inclusion of the criteria in computerized patient data entry).
+
+## Recommendation 1
+
+The Saudi Expert Panel recommends the use of a clinical strategy to assess the pretest probability based on Wells criteria compared to not using a strategy, for the diagnosis of suspected first lower extremity DVT. (Strong recommendation, Moderate quality of evidence). II - Diagnostic strategy in patients with low pretest probability of first lower extremity DVT
+Questions 2-8 are related to the diagnostic strategy of DVT in patients with low clinical pretest probability of first lower extremity DVT. Figure 2 summarizes the diagnostic recommendations.
+
+Question 2: In patients with low pretest probability of first lower extremity DVT, should we use highly sensitive D-dimer by enzyme-linked immunosorbent assay (ELISA) as an initial test for the diagnosis of DVT?
+Summary of findings Our judgments were based on a systematic review published in 2006, including 217 management cohorts and accuracy studies evaluating diagnostic properties of D-dimer in patients with suspected VTE.[4] We identified seven additional studies that could not be pooled with the systematic review.[27-33] The ELISA 
+D-dimer assays are highly sensitive with pooled sensitivity and specificity for DVT of 94% (95% CI, 93-95%) and 45% (95% CI, 
+
+| Table 3: Number of thromboembolic events due to lack of treatment in patients with deep venous thrombosis  according to the adopted ruling out strategy Ruling out strategy for DVT Post-test  probability  of DVT (%) Events per 1,000 tested patients Quality of  Patients evidence False  Fatal PE Nonfatal  ruled out negatives PE Low clinical pretest probability of DVT (prevalence: 5%) No test and treatment - — - 0.8 3.6 - D-dimer negative 0.7 431 5 0.08 0.36 Moderate Proximal CUS negative 0.5 934 3 0.05 0.22 Low D-dimer negative + proximal CUS negative <0.1 418 0 0 0 Low (1) D-dimer negative or (2) D-dimer positive and proximal CUS negative (1) 0.7 947 10 0.16 0.72 Low (2) 0.88 Moderate clinical pretest probability of DVT (prevalence: 17%) No test and treatment - — - 2.72 12.24 - D-dimer negative 2.7 384 10 0.16 0.72 Moderate Proximal CUS negative 2 828 16 0.26 1.15 Low D-dimer negative + proximal CUS negative 0.3 366 1 0.02 0.07 Low (1) D-dimer negative or (2) D-dimer positive and proximal CUS negative (1) 2.7 846 26 0.42 1.87 Low (2) 3.4 Serial proximal CUS negative2 0.6-1.1 - 1-2 0.02-0.04 0.07-0.14 Moderate High clinical pretest probability of DVT (prevalence: 53%) No test and treatment - — - 8.64 38.88 - D-dimer negative 13.1 242 32 0.51 2.3 Moderate Proximal CUS negative 10.1 511 51 0.82 3.67 Moderate D-dimer negative + proximal CUS negative 1.5 210 3 0.05 0.22 Moderate (1) D-dimer negative or (2) D-dimer positive and proximal CUS negative (1) 13.1 543 80 1.28 5.76 Moderate (2) 16.5% Serial proximal CUS negative 0.9 - 3 0.05 0.22 Moderate Proximal CUS negative → D-dimer positive → proximal CUS negative 2.8 - 17 0.27 1.22 Low DVT = Deep venous thrombosis, CUS = compression ultrasound, PE = pulmonary embolism, 2 data from two different studies Table 4: Number of adverse events due to overtreatment in patients without deep venous thrombosis according  to the diagnostic strategy adopted Diagnostic strategy Events per 1000 tested patients1 Quality  False of evidence Fatal  Nonfatal  positives bleeding intracranial  bleeding Nonfatal nonintracranial  major bleeding Low clinical pretest probability of DVT (prevalence: 5%) Proximal CUS positive 21 0.06 0.02 0.44 Low D-dimer positive + proximal CUS positive (D-dimer negative  11 0.03 0.01 0.23 Low ruled out) Moderate clinical pretest probability of DVT (prevalence: 17%) Proximal CUS positive 18 0.05 0.02 0.38 Low D-dimer positive+proximal CUS positive (D-dimer negative  10 0.03 0.01 0.21 Low ruled out) High clinical pretest probability of DVT (prevalence: 53%) Proximal CUS positive 10 0.03 0.01 0.21 Moderate DVT = Deep venous thrombosis, CUS = Compression ultrasound, 1 Bleeding events among patients without DVT (false positives)   |
+|---|
+
+3.6 additional cases of fatal and nonfatal PE per 1,000 patients initially tested (Moderate quality of evidence).
+
+44-46%), respectively (Moderate quality of evidence). These data were used for the assessment of all questions related to D-dimer testing as a standalone test or combined with a single proximal CUS. Based on these findings, only 3 patients per 1,000 tested would be incorrectly classified as not having DVT (false negatives). On the other hand, 523 patients would be incorrectly classified as having DVT (false positives), requiring further investigation. The probability of having DVT after a negative test is 0.70% and after a positive test is 8.25%. With no testing or treatment, we would have respectively, 0.8 and Resource use The cost of ELISA D-dimer assay was considered low for the Saudi context by the panel members. Recommendation 2 The Saudi Expert Panel recommends the use of highly sensitivity D-dimer (ELISA) as an initial test for the diagnosis 6  
+
+Table 5: Interpretation of strong and conditional (weak) recommendations Implications Strong recommendation **Conditional (weak) recommendation** For patients Most individuals in this situation would want the recommended course of action and only a small proportion would not. Formal decision aids are not likely to be needed to help individuals make decisions consistent with their values and preferences The majority of individuals in this situation would want the suggested course of action, but many would not For clinicians Most individuals should receive the intervention. Adherence to 
+
+![4_image_0.png](4_image_0.png)
+
+this recommendation according to the guideline could be used as a quality criterion or performance indicator Recognize that different choices will be appropriate for individual patients and that you must help each patient arrive at a management decision consistent with his or her values and preferences. Decision aids may be useful helping individuals making decisions consistent with their values and preferences For policy makers The recommendation can be adapted as policy in most situations Policy making will require substantial debate and involvement of various stakeholders
+Figure 2: Recommendations for evaluation of suspected first lower extremity DVT
+in patients with low pretest probability
+of DVT in patients with low pretest probability of first lower extremity DVT. (Strong recommendation, Moderate quality of evidence). Question 3: In patients with low pretest probability of first lower extremity DVT, should we use proximal CUS as an initial test for the diagnosis of DVT?
+
+Summary of findings Our judgments were based on the systematic review cited for Question 2.[4] The meta-analysis pooled 22 studies specifically evaluating proximal CUS.[4] We identified four additional studies, which could not be pooled with the systematic review.
+
+[34-37] The pooled sensitivity and specificity of CUS for DVT 
+diagnosis was 90.3% (95% CI, 88.4-92%) and 97.8% (95% CI, 97-98.4%) respectively (Low quality of evidence). Quality of evidence was downgraded due to inconsistency specifically for patients with low and moderate pretest probability because the test sensitivity tended to be higher in patients with higher pretest probability. These data were used for the assessment of all questions related to proximal CUS as a standalone test or combined with D-dimer testing. Based on the above, only 5 per 1,000 tested patients would be incorrectly classified as not having DVT (false negatives). On the other hand, 21 per 1,000 tested patients would be incorrectly classified as having DVT (false positives). The probability of having DVT after a negative test is 0.52% and after a positive test is 68.4%. Treating those patients with a positive test and discharging those with negative test, would result on 0.14 deaths, 0.36 cases of nonfatal PE, and 0.35 major bleeding episodes (0.02 intracranial) per 1,000 patients. With no testing or treatment, we would have respectively, 0.8 and 3.6 additional cases of fatal and nonfatal PE per 1,000 patients (Low quality of evidence). Resource use The cost of proximal CUS was considered low for the Saudi context by the panel members. Recommendation 3 The Saudi Expert Panel recommends the use of proximal CUS as an initial test for the diagnosis of DVT in patients with low pretest probability of first lower extremity DVT. (Strong recommendation, Low quality of evidence). Question 4: In patients with low pretest probability of first lower extremity DVT, should we use D-dimer (ELISA) instead of proximal CUS as initial test for the diagnosis of DVT?
+
+Summary of findings No evidence directly combining D-dimer test and proximal CUS was identified. To make judgments, we indirectly combined data available from questions 2 and 3. Resource use The cost of D-dimer is lower than the cost of proximal CUS. Using D-dimer as an initial test probably would be cost-saving in the Saudi setting. Recommendation 4 The Saudi Expert Panel suggests the use of D-dimer (ELISA) instead of proximal CUS as an initial test for the diagnosis of DVT in patients with low pretest probability of first lower extremity DVT. (Weak recommendation, Low quality of evidence).
+
+Question 5: In patients with low pretest probability of first lower extremity DVT and negative D-dimer test (ELISA), should we perform proximal CUS instead of discharge with no additional evaluation?
+Summary of findings As reported in question 2, using D-dimer as the initial test, 3 patients per 1,000 tested would be incorrectly classified as not having DVT. The probability of having DVT after a negative test is 0.70%. If patients with D-dimer negative be discharged with no additional testing, we would have 0.05 and 0.22 additional cases of fatal and nonfatal PE among the false negatives per 1,000 patients tested (Moderate quality of evidence).[4] In patients with sequential D-dimer and proximal CUS that are negative, the post-test probability of DVT would be negligible (0.07%). However, performing the two tests sequentially would lead to an increase of 9 patients with false positive tests per 1,000 tested. Thus, we would expect an increase of 0.03 deaths and 0.2 nonfatal major bleeding events per 1,000 tested patients (Low quality of evidence).[4]
+Resource use Performing proximal CUS in these patients would increase costs: 428 additional ultrasounds would be needed per 1,000 tested patients. Recommendation 5 The Saudi Expert Panel recommends no additional investigation over additional investigation with proximal CUS in patients with low pretest probability of first lower extremity DVT and negative D-dimer test (ELISA). (Strong recommendation, Low quality of evidence). Question 6: In patients with low pretest probability of first lower extremity DVT and negative proximal CUS, should we perform venography instead of discharge with no additional evaluation?
+
+Summary of findings For contrast venography, only a single-arm prospective cohort study evaluating 160 patients with unknown clinical pretest probability was identified. The prevalence of DVT in the study population was not described. After a negative test, the probability of having recurrent VTE during the following 3 months was 1.2% (95% CI, 0.2-4.4%) (Moderate quality of evidence).[38]
+Resource use Contrast venography is an expensive diagnostic test compared to proximal CUS. Other considerations Venography is considered the reference standard for DVT, however, it is subject to considerable variation. Although often considered as 100%, the post-test probability of a positive test cannot be estimated with confidence. There are no studies evaluating contrast venography in patients with low DVT risk. Additionally, venography is associated with 1-4% incidence of adverse reactions to contrast media, including dizziness and nausea, severe allergic reaction in 0-0.4%, and post-venography DVT in 0-2% of patients.[1]
+Implementation considerations The required technology for performing contrast venography is not widely available in the KSA.
+
+Recommendation 6 The Saudi Expert Panel recommends no additional investigation over additional investigation with venography in patients with low pretest probability of first lower extremity DVT, after negative initial proximal CUS. (Strong recommendation, Low quality of evidence). Question 7: In patients with low pretest probability of first lower extremity DVT and positive D-dimer test (ELISA), should we perform proximal CUS instead of venography?
+
+Summary of findings As described in question 6, after a negative contrast venography, the probability of having recurrent VTE during 3 months of follow-up is 1.2% (95% CI, 0.2-4.4%) (Moderate quality of evidence).[38] In patients with low pretest clinical probability and positive D-dimer test, the probability of having DVT after a negative proximal CUS is 0.88% and after a positive CUS is 78.69%. Per 1,000 patients initially tested, 11 patients without DVT would be treated and 5 patients with DVT and D-dimer positive would be discharged as false negatives. Due to misdiagnosis, we would have additionally 0.11 deaths, 0.36 cases of nonfatal PE, and 0.23 major bleeding episodes (0.01 intracranial) per 1,000 patients (Low quality of evidence). Resource use and other considerations Please refer to those described for question 6. Recommendation 7 The Saudi Expert Panel recommends performing proximal CUS instead of venography in patients with low pretest probability of first lower extremity DVT and positive D-dimer test (ELISA). (Strong recommendation, Low quality of evidence). Question 8: In patients with low pretest probability of first lower extremity DVT and positive proximal CUS, should we perform contrast venography instead of treatment, without additional investigation?
+
+Summary of findings As described in question 6, after a negative contrast venography, the probability of having recurrent VTE during 3 months of follow-up is 1.2% (95% CI, 0.2-4.4%) 
+(Moderate quality of evidence).[38] As reported in question 3, 21 patients per 1,000 tested with proximal CUS would be incorrectly classified as not having DVT. Treating unnecessarily these patients would result in 0.06 deaths and 0.46 major bleeding episodes (0.02 intracranial) (Moderate quality of evidence). Resource use and other considerations Please refer to those described for question 6.
+
+## Recommendation 8
+
+The Saudi Expert Panel recommends no additional investigation, instead of confirmatory venography, in patients with low pretest probability of first lower extremity DVT and positive proximal CUS. (Strong recommendation, Low quality of evidence).
+
+8  
+III - Diagnostic strategy in patients with moderate pretest probability of first lower extremity DVT
+Questions 9-16 are related to the diagnostic strategy of DVT in patients with moderate clinical pretest probability of first lower extremity DVT. Figure 3 summarizes the diagnostic recommendations. Question 9: In patients with moderate pretest probability of first lower extremity DVT, should we use D-dimer (ELISA) as an initial test for the diagnosis of DVT?
+
+Summary of findings With D-dimer testing, only 10 patients per 1,000 tested would be incorrectly classified as not having DVT (false negatives).[4]
+On the other hand, 457 patients would be incorrectly classified as having DVT (false positives). The probability of having DVT after a negative test is 2.7% and after a positive test is 25.9%. With no testing or treatment, we would have respectively, 2.7 and 12.2 additional cases of fatal and nonfatal PE per 1,000 patients. Resource use The cost of ELISA D-dimer assay was considered low. Recommendation 9 The Saudi Expert Panel recommends the use of highly sensitivity D-dimer (ELISA) as an initial test for the diagnosis of DVT in patients with moderate pretest probability of first lower extremity DVT. (Strong recommendation, Moderate quality of evidence).
+
+Summary of findings Ruling out DVT with a negative D-dimer, 10 per 1,000 tested patients would be incorrectly classified as not having DVT. If patients with negative D-dimer are discharged with no further testing, we would have 0.16 and 0.72 additional cases of fatal and nonfatal PE, respectively, among the false negatives per 
+
+![6_image_0.png](6_image_0.png)
+
+Question 10: In patients with moderate pretest probability of first lower extremity DVT, should we use proximal CUS as an initial test for the diagnosis of DVT?
+
+Summary of findings With proximal CUS, 16 patients per 1,000 tested would be incorrectly classified as not having DVT (false negatives). On the other hand, 18 patients would be incorrectly classified as having DVT (false positives). The probability of having DVT after a negative test is 2% and after a positive test is 89.4%. Treating those patients with a positive test and discharging those with negative test, would result on 0.26 deaths, 1.15 cases of nonfatal PE, and 0.04 major bleeding episodes (0.002 intracranial) per 1,000 patients. With no testing or treatment, we would have respectively, 2.7 and 12.2 additional cases of fatal and nonfatal PE per 1,000 patients.
+
+## Resource Use The Cost Of Proximal Cus Was Considered Low.
+
+Recommendation 10 The Saudi Expert Panel recommends the use of proximal CUS as an initial test for the diagnosis of DVT in patients with moderate pretest probability of first lower extremity DVT. (Strong recommendation, Low quality of evidence). Question 11: In patients with moderate pretest probability of first lower extremity DVT, should we use D-dimer (ELISA) instead of proximal CUS as the initial test for the diagnosis of DVT?
+
+Summary of findings Ruling out patients with negative D-dimer, only 10 patients per 1,000 tested would be incorrectly classified as not having DVT. However, 374 patients would be discharged with no need of a further test.[4] With proximal CUS, 16 patients per 1,000 tested would be incorrectly classified as not having DVT.[4] On the other hand, 18 patients would be incorrectly classified as having DVT.[4]
+Resource use The cost of D-dimer is lower than the cost of proximal CUS. Using D-dimer ELISA as an initial test would probably be cost-saving in the Saudi setting. Recommendation 11 The Saudi Expert Panel suggests the use of D-dimer (ELISA) instead of proximal CUS as an initial test for the diagnosis of DVT in patients with moderate pretest probability of first lower extremity DVT. (Weak recommendation, Low quality of evidence).
+
+Question 12: In patients with moderate pretest probability of first lower extremity DVT and negative D-dimer test (ELISA), should we perform proximal CUS instead of discharge with no additional evaluation?
+1,000 tested patients (Moderate quality of evidence). Ruling out patients with sequential D-dimer and proximal CUS, only 1 per 1,000 tested patients would be the false negative (post-test probability = 0.27%). However, the number of false positives would increase to 8 per 1,000 tested patients. This would lead to an increase of 0.02 deaths and 0.2 nonfatal major bleeding events per 1,000 tested patients (Low quality of evidence).
+
+Resource use Performing proximal CUS in these patients would increase costs such that 374 additional ultrasounds would be needed per 1,000 patients initially tested. Recommendation 12 The Saudi Expert Panel recommends no additional investigation over additional investigation with proximal CUS in patients with moderate pretest probability of first lower extremity DVT and negative D-dimer test (ELISA). (Strong recommendation, Low quality of evidence). Question 13: In patients with moderate pretest probability of first lower extremity DVT and positive D-dimer test (ELISA), should we perform proximal CUS instead of venography?
+
+Summary of findings As described in question 6, after a contrast venography negative, the probability of having recurrent VTE during 3 months of follow-up is 1.2% (95% CI, 0.2-4.4%) (Moderate quality of evidence).[38] In patients with moderate pretest clinical probability and positive D-dimer test, the probability of having DVT after a negative CUS is 3.36% and after a positive CUS is 93.49%. Per 1,000 patients initially tested, 10 patients without DVT would be treated and 15 patients with DVT would be discharged. Misdiagnosing would lead to additional 0.23 deaths, 1.08 cases of nonfatal PE and fewer 0.11 major bleeding episodes per 1,000 patients (low level of evidence). Resource use and other considerations Please refer to those described for question 6. Recommendation 13 The Saudi Expert Panel recommends performing proximal CUS instead of venography in patients with moderate pretest probability of first lower extremity DVT and positive D-dimer test (ELISA). (Strong recommendation, Low quality of evidence). Question 14: In patients with moderate pretest probability of first lower extremity DVT, negative proximal CUS and negative D-dimer test (ELISA), should we repeat proximal CUS in 1 week instead of rule out without additional investigation?
+
+Summary of findings For single proximal CUS testing, as described in question 10, 16 per 1,000 tested patients would be incorrectly classified as not having DVT. The probability of having DVT after a negative test is 2%. Discharging those patients with negative test would result on 0.26 deaths, 1.15 cases of nonfatal PE per 1,000 patients initially tested (Low quality of evidence). For serial CUS in patients with moderate clinical pretest probability, three observational studies were identified. In these studies, the pooled prevalence of DVT was 15.8% and the probability of DVT post-negative serial CUS were 1.1% (95% CI, 0.4-2.5%) and 0.6% (95% CI, 0.4-0.9%) (Moderate quality of evidence).[39-41] It would represent 1-2 false negatives per 1,000 patients, resulting in additional 0.02-0.04 and 0.07-0.14 fatal and nonfatal PE, respectively.
+
+Resource use Repeating proximal CUS in patients with moderate clinical pretest probability and negative initial CUS would increase costs: 831 additional ultrasounds would be needed per 1,000 tested patients. Other considerations Repeating the proximal CUS would reduce the rate of false negatives; however, it may increase the number of false positives, resulting in higher bleeding rates. Recommendation 14 The Saudi Expert Panel suggests no additional investigation instead of repeat proximal CUS in patients with a moderate pretest probability of first lower extremity DVT and negative initial proximal CUS and negative D-dimer test (ELISA). (Weak recommendation, Low quality of evidence). Question 15: In patients with moderate pretest probability of first lower extremity DVT, negative proximal CUS and positive D-dimer test (ELISA), should we repeat proximal CUS in 1 week instead of rule out without additional investigation?
+
+Summary of findings In patients with moderate pretest clinical probability and positive D-dimer test, the probability of having DVT after a negative CUS is 3.36%. Hence, 16 will be discharged per 1,000 tested patients. Due to misdiagnosing, we would have additionally 0.25 deaths due to PE and 1.15 cases of nonfatal PE per 1,000 patients (Low quality of evidence). For repeated proximal CUS in patients with positive D-dimer test and negative initial proximal CUS, one study with 426 patients was identified. The prevalence of DVT was 18.8% and the probability of DVT after a positive D-dimer and serial CUS negative was 0% (95% CI, 0 to 3.1%) (Moderate quality of evidence).[39]
+Resource use Performing proximal CUS in patients with moderate clinical pretest probability and negative D-dimer would increase costs such that 616 additional CUS would be needed per 1000 tested patients. Other considerations Repeating the proximal CUS would reduce the rate of false negatives, however it may increase the number of false positives, resulting in higher bleeding rates. Recommendation 15 The Saudi Expert Panel suggests repeating proximal CUS in one week over no additional investigation in patients with moderate pretest probability of first lower extremity DVT and initial negative proximal CUS and positive D-dimer test (ELISA). (Weak recommendation, Low quality of evidence).
+
+10  
+
+![8_image_0.png](8_image_0.png)
+
+Question 16: In patients with moderate pretest probability of first lower extremity DVT and positive proximal CUS, should we perform venography instead of treatment, without additional investigation?
+
+Summary of findings As described in question 6, after a negative contrast venography, the probability of having recurrent VTE during 3 months of follow-up is 1.2% (95% CI, 0.2-4.4%) (Moderate quality of evidence).[38] Among patients with initial positive proximal CUS, 16 per 1,000 patients would be incorrectly classified as not having DVT. Treating them unnecessarily would result in 0.05 deaths and 0.34 major bleeding episodes (0.02 intracranial) per 1000 tested individuals (Low quality of evidence).
+
+Resource use and other considerations Please refer to those described for question 6. Recommendation 16 The Saudi Expert Panel recommends no additional investigation, instead of confirmatory venography, in patients with moderate pretest probability of first lower extremity DVT and positive proximal CUS. (Strong recommendation, Low quality of evidence). IV - Diagnostic strategy in patients with high pretest probability of first lower extremity DVT
+Questions 17-24 are related to the diagnostic strategy of DVT in patients with high clinical pretest probability of first lower extremity DVT. Figure 4 summarizes the diagnostic recommendations. Question 17: In patients with high pretest probability of first lower extremity DVT, should we use D-dimer (ELISA) as an initial test to rule out the diagnosis of DVT?
+
+Summary of findings Using D-dimer (ELISA) test, 32 per 1,000 tested patients would be incorrectly classified as not having DVT. The probability of having DVT after a negative test is 13.1%. Not treating these individuals would result in additional 0.51 and 2.3 fatal and nonfatal PE, respectively, per 1,000 tested patients (Moderate quality of evidence). Resource use The cost of ELISA D-dimer assay was considered low. Recommendation 17 The Saudi Expert Panel recommends against the use of highly sensitivity D-dimer (ELISA) as a standalone test to rule out DVT in patients with high pretest probability of first lower extremity DVT. (Strong recommendation, Moderate quality of evidence). Question 18: In patients with high pretest probability of first lower extremity DVT, should we use proximal CUS as initial test to rule out the diagnosis of DVT?
+
+Summary of findings For proximal CUS, the estimates for sensitivity and specificity for DVT are 90.3% (95% CI, 88.4% to 92%) and 97.8% (95% CI, 97% to 98.4%), respectively (Moderate quality of evidence). The sensitivity tends to be higher in individual with higher pretest probability of DVT. Fifty one per 1000 patients tested would be incorrectly classified as not having DVT. The probability of having DVT after a negative test is 10.1%. Not treating these individuals would result in additional 0.82 and 3.67 fatal and nonfatal PE, respectively, per 1,000 patients tested (Moderate quality of evidence). Resource use The cost of proximal CUS was considered low. Recommendation 18 The Saudi Expert Panel recommends against the use of proximal CUS as a standalone test to rule out DVT in patients with high pretest probability of first lower extremity DVT. (Strong recommendation, Moderate quality of evidence). Question 19: In patients with high pretest probability of first lower extremity DVT and positive proximal CUS, should we perform proximal venography instead of treatment without additional investigation?
+
+Summary of findings Among individuals with high pretest probability, 10 per 1,000 tested patients with proximal CUS would be incorrectly classified as having DVT.[38] Treating these patients unnecessarily would result in 0.03 deaths and 0.22 major bleeding episodes (0.01 intracranial) per 1,000 tested individuals (Moderate quality of evidence). Resource use and other considerations Please refer to those described for question 6.
+
+Recommendation 19 The Saudi Expert Panel recommends no additional investigation, instead of confirmatory venography, in patients with high pretest probability of first lower extremity DVT and positive proximal CUS. (Strong recommendation, Moderate quality of evidence). Question 20: In patients with high pretest probability of first lower extremity DVT and negative initial proximal CUS, should we repeat proximal CUS instead of rule out without additional investigation?
+
+Summary of findings In single proximal CUS testing, 51 per 1,000 tested patients would be incorrectly classified as not having DVT (false negatives). The probability of having DVT after a negative test is 10.1%. Not treating these individuals would result in additional 0.82 fatal and 3.67 nonfatal PE per 1,000 patients tested. For serial CUS in patients with high clinical pretest probability, four studies were identified and found a pooled DVT prevalence of 36.4% with probability of DVT 
+post-negative serial CUS of 0.9% (95% CI, 0.2-2.8%).[41-44]
+This would represent 3 patients per 1,000 tested. Not treating these individuals would result in additional 0.05 fatal and 0.22 nonfatal PE episodes (Moderate quality of evidence). Resource use Repeating proximal CUS in patients with high clinical pretest probability and initial CUS negative would increase costs such that 511 additional ultrasounds would be needed per 1,000 tested patients. Recommendation 20 The Saudi Expert Panel recommends repeating proximal CUS in 1 week instead of no additional investigation in patients with a high pretest probability of first lower extremity DVT and negative initial proximal CUS. (Strong recommendation, Moderate quality of evidence). Question 21: In patients with high pretest probability of first lower extremity DVT and negative initial proximal CUS, should we use D-dimer test (ELISA) instead of rule out without additional investigation?
+
+Summary of findings The probability of having DVT after a negative test is 10.1%. Not treating these individuals would result in additional 0.82 and 3.67 fatal and nonfatal PE, respectively, per 1,000 patients tested (Moderate quality of evidence). Among those individuals with negative initial proximal CUS and negative D-dimer (ELISA), only 3 per 1,000 tested patients would be classified as false negatives. The probability of having DVT after proximal CUS and D-dimer negatives is 1.47%. Not treating these individuals would result in additional 0.05 and 0.22 fatal and nonfatal PE, respectively, per 1,000 tested patients. However, 301 patients would present a positive D-dimer test, requiring additional evaluation (Low quality of evidence).
+
+Resource use With this strategy, 511 D-dimer tests would be required per 1,000 patients. The costs of D-dimer and proximal CUS were considered low. Recommendation 21 The Saudi Expert Panel recommends additional investigation with D-dimer (ELISA) instead of no additional investigation in patients with high pretest probability of first lower extremity DVT and initial negative proximal CUS. (Strong recommendation, Low quality of evidence). Question 22: In patients with high pretest probability of first lower extremity DVT, positive D-dimer test (ELISA) and negative CUS, should we repeat proximal CUS instead of venography?
+
+Summary of findings After a negative contrast venography, the probability of having recurrent VTE during 3 months of follow-up is 1.2% 
+(Moderate quality of evidence).[38] For repeating proximal CUS in patients with high clinical pretest probability, negative initial CUS and positive D-dimer, only one study was identified. In this study, the prevalence of DVT was 59.5% and the post-test probability was 2.8% (95% CI, 0.1-12.5%) 
+(Low quality of evidence).[45] It would represent 17 patients per 1,000 tested; not treating these individuals would result in additional 0.27 fatal and 1.22 and nonfatal PE episodes (Low quality of evidence). Resource use and other considerations Please refer to those described for question 6. Recommendation 22 The Saudi Expert Panel recommends repeating proximal CUS in 1 week over performing venography in patients with a high pretest probability of first lower extremity DVT, negative initial proximal CUS, and positive D-dimer test (ELISA). (Strong recommendation, Low quality of evidence). Question 23: In patients with high pretest probability of first lower extremity DVT and negative serial CUS, should we perform venography instead of rule out without additional investigation?
+
+Summary of findings After a negative contrast venography, the probability of having recurrent VTE during 3 months of follow-up is 1.2% (95% 
+CI, 0.2-4.4%) (Moderate quality of evidence).[38] After negative serial CUS in patients with high clinical pretest probability, the estimate probability of DVT is 0.9% (95% CI, 0.2-2.8%) 
+(Moderate quality of evidence).[41-44]
+Resource use and other considerations Please refer to those described for question 6.
+
+## Recommendation 23
+
+The Saudi Expert Panel recommends no additional investigation instead of venography in patients with high pretest probability of first lower extremity DVT and negative serial proximal CUS. (Strong recommendation, Moderate quality of evidence).
+
+12  
+Question 24: In patients with high pretest probability of first lower extremity DVT, negative D-dimer test (ELISA) and negative proximal CUS, should we perform venography instead of rule out without additional investigation?
+
+Summary of findings As described in question 6, after a negative contrast venography, the probability of having recurrent VTE during 3 months follow-up is 1.2% (95% CI, 0.2-4.4%) (Moderate quality of evidence).[38] As reported in question 21, among those individuals with negative initial proximal CUS and negative D-dimer (ELISA), only 3 per 1,000 tested patients would be classified as false negatives. The probability of having DVT after proximal CUS and D-dimer negatives is 1.47%. Not treating these individuals would result in additional 0.05 and 2.16 fatal and nonfatal PE, respectively, per 1,000 tested patients (Low quality of evidence). Resource use and other considerations Please refer to those described for question 6. Recommendation 24 The Saudi Expert Panel recommends no additional investigation instead of venography in patients with high pretest probability of first lower extremity DVT, negative D-dimer test, (ELISA), and negative proximal CUS. (Strong recommendation, Low quality of evidence).
+
+## Discussion
+
+A standardized diagnostic strategy for suspected DVT is crucial to prevent the complications of no treatment and to avoid the risks of unnecessary anticoagulation. This clinical practice guideline is the result of an initiative of the Saudi Ministry of Health to promote the practice of evidence-based medicine across the KSA, applies mainly to the ambulatory setting (i.e., outpatient or emergency department) and targets primary care physicians, specialists in Internal Medicine and Emergency Medicine. It is expected to reduce health inequities in Saudi Arabia. It should be noted that no guideline or recommendation can take into account all of the often-compelling unique features of individual clinical circumstances. Hence, clinicians, patients, third-party payers, institutional review committees, other stakeholders, or courts should never view these recommendations as dictates. Additionally, the values and preferences of individual patients should be taken into consideration in the diagnostic process of DVT. When developing this guideline, the Saudi expert panel considered the availability of DVT diagnostic tools in the different regions of KSA. It was considered that CUS and highly sensitive D-dimer by ELISA are widely available in KSA, but the panel recommends that the Ministry of Health should ensure the availability of these resources. The Saudi Expert Panel suggests periodic and formal evaluations of the adherence to the recommendations of this guideline according to their strength. Strong recommendations should be applied to the large majority of patients. Therefore, adherence to the course of action proposed by strong recommendations could be used as quality or performance indicators. For weak recommendations, however, it is important to recognize that different choices could be appropriate for different patients. Therefore, measuring the adherence to the course of action proposed by weak recommendations is not appropriate for quality criteria or performance indicators. The Saudi expert panel also suggests periodic updates of this guideline every 2-3 years. Early updates could be considered in case of the emergence of new evidence relevant to the interventions covered in the guideline. Finally, the Saudi expert panel suggests local research on the values and preferences of the Saudi population regarding the relative value of preventing DVT with anticoagulants versus bleeds, and on the burden of treatment with antithrombotic agents and performance of economic evaluations of the different strategies for DVT diagnosis.
+
+## Acknowledgments
+
+The authors would like to thank Dr Mohammed Zamakhshary, Dr Zulfa Alrayess, Dr Yaser Adi, and the members of the Saudi Center for Evidence Based Healthcare (EBHC), MoH, Saudi Arabia for their unlimited support.
+
+## References
+
+1. Bates SM, Jaeschke R, Stevens SM, Goodacre S, Wells PS, 
+Stevenson MD, *et al*. Diagnosis of DVT: Antithrombotic Therapy and Prevention of Thrombosis. 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2012;141(2 Suppl):e351-418S.
+
+2. Silverstein MD, Heit JA, Mohr DN, Petterson TM, O'Fallon WM, 
+Melton LJ 3rd. Trends in the incidence of deep vein thrombosis and pulmonary embolism: A 25-year population-based study. Arch Intern Med 1998;158:585-93.
+
+3. Anderson FA Jr, Wheeler HB, Goldberg RJ, Hosmer DW, 
+Patwardhan NA, Jovanovic B, *et al*. A population-based perspective of the hospital incidence and case-fatality rates of deep vein thrombosis and pulmonary embolism. The Worcester DVT Study. Arch Intern Med 1991;151:933-8.
+
+4. Goodacre S, Sampson F, Stevenson M, Wailoo A, Sutton A, Thomas S, *et al*. Measurement of the clinical and costeffectiveness of non-invasive diagnostic testing strategies for deep vein thrombosis. Health Technol Assess 2006;10:1-168, iii-iv.
+
+5. White RH. The epidemiology of venous thromboembolism. 
+
+Circulation 2003;107(23 Suppl 1):I4-8.
+
+6. Goldhaber SZ, Bounameaux H. Pulmonary embolism and deep vein thrombosis. Lancet 2012;379:1835-46.
+
+7. Tsai AW, Cushman M, Rosamond WD, Heckbert SR, 
+Polak JF, Folsom AR. Cardiovascular risk factors and venous thromboembolism incidence: The longitudinal investigation of thromboembolism etiology. Arch Intern Med 2002;162:1182-9.
+
+8. Stein PD, Kayali F, Olson RE, Milford CE. Pulmonary thromboembolism in Asians/Pacific Islanders in the United States: Analysis of data from the National Hospital Discharge Survey and the United States Bureau of the Census. Am J Med 2004;116:435-42.
+
+9. Oudega R, Moons KG, Hoes AW. Limited value of patient history and physical examination in diagnosing deep vein thrombosis in primary care. Fam Pract 2005;22:86-91.
+
+10. Kucher N, Tapson VF, Goldhaber SZ. DVT FREE Steering Committee. Risk factors associated with symptomatic pulmonary embolism in a large cohort of deep vein thrombosis patients. Thromb Haemost 2005;93:494-8.
+
+11. Stein PD, Matta F, Musani MH, Diaczok B. Silent pulmonary embolism in patients with deep venous thrombosis: A systematic review. Am J Med 2010;123:426-31.
+
+12. Heit JA, Mohr DN, Silverstein MD, Petterson TM, O'Fallon WM, 
+Melton LJ 3rd. Predictors of recurrence after deep vein thrombosis and pulmonary embolism: A population-based cohort study. Arch Intern Med 2000;160:761-8.
+
+13. Schulman S, Lindmarker P, Holmstrom M, Lärfars G, Carlsson A, 
+Nicol P, *et al*. Post-thrombotic syndrome, recurrence, and death 10 years after the first episode of venous thromboembolism treated with warfarin for 6 weeks or 6 months. J Thromb Haemost 2006;4:734-42.
+
+14. Cushman M, Tsai AW, White RH, Heckbert SR, Rosamond WD, 
+Enright P, *et al*. Deep vein thrombosis and pulmonary embolism in two cohorts: The longitudinal investigation of thromboembolism etiology. Am J Med 2004;117:19-25.
+
+15. Carrier M, Le Gal G, Wells PS, Rodger MA. Systematic review: 
+Case-fatality rates of recurrent venous thromboembolism and major bleeding events among patients treated for venous thromboembolism. Ann Intern Med 2010;152:578-89.
+
+16. Linkins LA, Choi PT, Douketis JD. Clinical impact of bleeding in patients taking oral anticoagulant therapy for venous thromboembolism: A meta-analysis. Ann Intern Med 2003; 139:893-900.
+
+17. Douketis JD, Kearon C, Bates S, Duku EK, Ginsberg JS. Risk of fatal pulmonary embolism in patients with treated venous thromboembolism. JAMA 1998;279:458-62.
+
+18. Prandoni P, Villalta S, Bagatella P, Rossi L, Marchiori A, Piccioli A, 
+et al. The clinical course of deep-vein thrombosis. Prospective long-term follow-up of 528 symptomatic patients. Haematologica 1997;82:423-8.
+
+19. Wells PS, Hirsh J, Anderson DR, Lensing AW, Foster G, Kearon C, 
+et al. Accuracy of clinical assessment of deep-vein thrombosis. 
+
+Lancet 1995;345:1326-30.
+
+20. Wells PS, Owen C, Doucette S, Fergusson D, Tran H. Does this patient have deep vein thrombosis? JAMA 2006;295:199-207.
+
+21. McMaster University Guideline Working Group. Methodology for the Development of the Saudi Center for EBHC and McMaster University Clinical Practice Guidelines. 2014. Available from: http://www.moh.gov.sa/endepts/Proofs/Pages/Guidelines. aspx [Last accessed on 2014 October 13].
+
+22. Guyatt G, Oxman AD, Akl EA, Kunz R, Vist G, Brozek J, *et al*. 
+
+GRADE guidelines: 1. Introduction-GRADE evidence profiles and summary of findings tables. J Clin Epidemiol 2011;64:383-94.
+
+23. Balshem H, Helfand M, Schunemann HJ, Oxman AD, Kunz R, 
+Brozek J, *et al*. GRADE guidelines: 3. Rating the quality of evidence. J Clin Epidemiol 2011;64:401-6.
+
+24. MacLean S, Mulla S, Akl EA, *et al*. Patient values and preferences in decision making for antithrombotic therapy: A systematic review: 
+Antithrombotic Therapy and Prevention of Thrombosis. 9th ed: 
+American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2012;141(2 Suppl):e1-23S.
+
+25. World Health Organization. WHO Handbook for Guideline Development. 2012. Available from: http://apps.who.int/iris/ bitstream/10665/75146/1/9789241548441_eng.pdf [Last accessed on 2014 Feb 7].
+
+26. Linkins LA, Bates SM, Lang E, Kahn SR, Douketis JD, Julian J, 
+et al. Selective D-dimer testing for diagnosis of a first suspected episode of deep venous thrombosis: A randomized trial. Ann Intern Med 2013;158:93-100.
+
+27. Di Nisio M, Squizzato A, Rutjes AW, Buller HR, Zwinderman AH, 
+Bossuyt PM. Diagnostic accuracy of D-dimer test for exclusion of venous thromboembolism: A systematic review. J Thromb Haemost 2007;5:296-304.
+
+28. Schouten HJ, Geersing GJ, Koek HL, Zuithoff NP, Janssen KJ, 
+Douma RA, *et al*. Diagnostic accuracy of conventional or age adjusted D-dimer cut-off values in older patients with suspected venous thromboembolism: Systematic review and meta-analysis. BMJ 2013;346:f2492.
+
+29. Der Sahakian G, Claessens YE, Allo JC, Kansao J, Kierzek G, 
+Pourriat JL. Accuracy of D-Dimers to rule out venous thromboembolism events across age categories. Emerg Med Int 2010;2010:185453.
+
+30. Elias-Hernandez T, Otero-Candelera R, Fernandez-Jimenez D, 
+Jara-Palomares L, Jimenez-Castro V, Barrot-Cortes E. Clinical usefulness of three quantitative D-dimers tests in outpatients with suspected deep vein thrombosis. Rev Clin Esp 2012;212:235-41.
+
+31. Luxembourg B, Schwonberg J, Hecking C, Schindewolf M, 
+Zgouras D, Lehmeyer S, *et al*. Performance of five D-dimer assays for the exclusion of symptomatic distal leg vein thrombosis. 
+
+Thromb Haemost 2012;107:369-78.
+
+32. Boeer K, Siegmund R, Schmidt D, Deufel T, Kiehntopf M. 
+
+Comparison of six D-dimer assays for the detection of clinically suspected deep venous thrombosis of the lower extremities. Blood Coagul Fibrinolysis 2009;20:141-5.
+
+33. Douma RA, Tan M, Schutgens RE, Bates SM, Perrier A, Legnani C, 
+et al. Using an age-dependent D-dimer cut-off value increases the number of older patients in whom deep vein thrombosis can be safely excluded. Haematologica 2012;97:1507-13.
+
+34. Pomero F, Dentali F, Borretta V, Bonzini M, Melchio R, 
+Douketis JD, *et al*. Accuracy of emergency physician-performed ultrasonography in the diagnosis of deep-vein thrombosis: A systematic review and meta-analysis. Thromb Haemost 2013;109:137-45.
+
+35. Kory PD, Pellecchia CM, Shiloh AL, Mayo PH, DiBello C, 
+Koenig S. Accuracy of ultrasonography performed by critical care physicians for the diagnosis of DVT. Chest 2011;139:538-42.
+
+36. Crisp JG, Lovato LM, Jang TB. Compression ultrasonography of the lower extremity with portable vascular ultrasonography can accurately detect deep venous thrombosis in the emergency department. Ann Emerg Med 2010;56:601-10.
+
+37. Gibson NS, Schellong SM, Kheir DY, Beyer-Westendorf J, 
+Gallus AS, McRae S, *et al*. Safety and sensitivity of two ultrasound strategies in patients with clinically suspected deep venous thrombosis: A prospective management study. J Thromb Haemost 2009;7:2035-41.
+
+38. Hull R, Hirsh J, Sackett DL, Taylor DW, Carter C, Turpie AG, 
+et al. Clinical validity of a negative venogram in patients with clinically suspected venous thrombosis. Circulation 1981;64: 622-5.
+
+39. Anderson DR, Wells PS, Stiell I, MacLeod B, Simms M, Gray L, 
+et al. Thrombosis in the emergency department: Use of a clinical diagnosis model to safely avoid the need for urgent radiological investigation. Arch Intern Med 1999;159:477-82.
+
+40. Wells PS, Anderson DR, Bormanis J, Guy F, Mitchell M, Gray L, 
+et al. Value of assessment of pretest probability of deep-vein thrombosis in clinical management. Lancet 1997;350:1795-8.
+
+41. Kearon C, Ginsberg JS, Douketis J, Crowther MA, Turpie AG, 
+Bates SM, *et al*. A randomized trial of diagnostic strategies after normal proximal vein ultrasonography for suspected deep venous thrombosis: D-dimer testing compared with repeated ultrasonography. Ann Intern Med 2005;142:490-6.
+
+42. Bates SM, Kearon C, Crowther M, Linkins L, O'Donnell M, 
+Douketis J, *et al*. A diagnostic strategy involving a quantitative latex D-dimer assay reliably excludes deep venous thrombosis. Ann Intern Med 2003;138:787-94.
+
+43. Ruiz-Gimenez N, Friera A, Artieda P, Caballero P, Sanchez MoliníP, 
+Morales M, *et al*. Rapid D-dimer test combined a clinical model for 
+
+deep vein thrombosis. Validation with ultrasonography and clinical follow-up in 383 patients. Thromb Haemost 2004;91:1237-46.
+
+44. Dewar C, Selby C, Jamieson K, Rogers S. Emergency department nurse-based outpatient diagnosis of DVT using an evidence-based protocol. Emerg Med J 2008;25:411-6.
+
+45. Schutgens RE, Ackermark P, Haas FJ, Nieuwenhuis HK, 
+Peltenburg HG, Pijlman AH, *et al*. Combination of a normal D-dimer concentration and a non-high pretest clinical probability score is a safe strategy to exclude deep venous thrombosis. Circulation 2003;107:593-7.
+How to cite this article: Al-Hameed F, Al-Dorzi HM, Shamy A, Qadi A, Bakhsh E, Aboelnazar E, *et al.* The Saudi clinical practice guideline for the diagnosis of the first deep venous thrombosis of the lower extremity. Ann Thorac Med 2015;10:3-15.
+
+Source of Support: This clinical practice guideline was funded by the Ministry of Health, Saudi Arabia, **Conflict of Interest:** Ebtisam Bakhsh, Hasan M Al Dorzi, and Essam Aboelnazar re-ceived payment as speakers and research grants for issues related to treatment of venous throm-boembolism.

medical/md/PMC4446999.md

@@ -0,0 +1,337 @@
+Open Access Full Text Article Jong-Mi Lee1 May H Han1,2 1Stanford Healthcare, Multiple Sclerosis Center, 2Department of Neurology and Neurological Sciences, Stanford University School of Medicine, Stanford University, Stanford, CA, USA Correspondence: May H Han Department of Neurology and Neurological Sciences, Stanford University School of Medicine, Stanford University, 1201 Welch Road, Stanford, CA 94305, USA Email mayhan@stanford.edu http://dx.doi.org/10.2147/PPA.S57354 Abstract: Targeting sphingosine-1-phosphate pathway with orally available immune-modulatory fingolimod (Gilenya™) therapy ameliorates relapsing–remitting multiple sclerosis (RRMS) by decreasing relapse rate as shown in FREEDOMS and TRANSFORMS. Fingolimod has also been shown to be superior to interferon-beta therapy as evidenced by TRANSFORMS. Albeit multiple benefits in treatment of multiple sclerosis including high efficacy and ease of administration, potential untoward effects such as cardiotoxicity, risk of infection, and cancer exist, thus mandating careful screening and frequent monitoring of patients undergoing treatment with fingolimod. This review outlines mechanism of action, observations, side effects, and practice guidelines on use of fingolimod in treatment of RRMS.
+
+Keywords: sphingosine-1-phosphate, RRMS, FREEDOMS, TRANSFORMS, side effects, IFNβ
+
+## Introduction
+
+Fingolimod (Gilenya™) is the first US Food and Drug Administration (FDA)- approved oral therapy for treatment of multiple sclerosis (MS) based on two Phase III pivotal trials, FREEDOMS and TRANSFORMS.1–4 Fingolimod targets the sphingosine-1-phosphate (S1P) pathway by regulation of lymphocyte trafficking from secondary lymphoid organs into the systemic circulation (Table 1).5–8 Interaction of the sphingolipid ligand, S1P, in the blood or lymph with the G protein-coupled receptor S1P receptor 1 (S1PR1) on lymphocytes is necessary for lymphocyte egress from lymph nodes into blood and lymph.9–11 The critical role played by S1P–S1PR1 interaction in immune trafficking is perturbed by fingolimod, a functional antagonist of S1PR.12,13 Fingolimod sequesters lymphocytes in the spleen and lymph nodes by inducing receptor internalization and degradation, causing lymphopenia and sparing the central nervous system from immune attack by myelin-reactive lymphocytes.11 Fingolimod has been shown to effectively decrease relapse rate up to 50% and is superior to interferon-beta (IFNβ) therapy.14–17 However, since fingolimod signals via most of the S1PRs (S1PR1 and 3–5), untoward effects in systems expressing these receptors, including cardiovascular and visual systems (such as cardiac rhythm abnormalities and macular edema), have been observed in patients treated with fingolimod.18–21 Furthermore, due to fingolimod's action on lymphopenia, side effects related to serious infections and cancer risk, possibly by interfering immune surveillance function of lymphocytes, are also observed.18 In the post-market experience, rebound disease activity (most likely due to reversing fingolimod's effect on lymphocyte egress) is observed upon discontinuation of the therapy.22–25 Thus, careful patient selection with rigorous and frequent monitoring and pre-consideration of optimal treatment sequencing are required for patients undergoing fingolimod Review open access to scientific and medical research
+
+# Patient Experience And Practice Trends In Multiple Sclerosis - Clinical Utility Of Fingolimod
+
+| Table 1 S1PR in the immune system Subtypes Tissue expression                                  | Function of S1PR                                                |                                                                                                                                                                                                                                                      |
+|-----------------------------------------------------------------------------------------------|-----------------------------------------------------------------|------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+| S1P1                                                                                          | CNS (neurons, astrocytes,  oligodendrocytes,  microglial cells) | CNS: migration of neuronal cells toward areas of damage; regulation  of oligodendrocyte survival, function, and modulation of myelination  following injury; regulation of microglial number and activation; and  maintenance of blood–brain barrier |
+| S1P3                                                                                          | Cardiovascular                                                  | Cardiovascular: heart rate control                                                                                                                                                                                                                   |
+| Immune                                                                                        |                                                                 |                                                                                                                                                                                                                                                      |
+| S1P4                                                                                          | Lymphoid tissue                                                 |                                                                                                                                                                                                                                                      |
+| S1P5                                                                                          | Natural killer cells CNS (oligodendrocytes)                     |                                                                                                                                                                                                                                                      |
+| Abbreviations: S1P, sphingosine-1-phosphate; S1PR, S1P receptor; CNS, central nervous system. |                                                                 |                                                                                                                                                                                                                                                      |
+
+therapy.26–29 This review article presents a comprehensive review of screening, monitoring, side effects, and efficacy in the clinical practice utilizing fingolimod for the treatment of relapsing–remitting MS (RRMS).
+
+## Screening Before Initiating Therapy
+
+Baseline screening and ongoing monitoring are required for fingolimod treatment to avoid potential serious side effects (Figure 1).29,30 The recommended baseline screening includes electrocardiogram (ECG) for cardiac rhythm abnormalities, ophthalmologic examination to evaluate for macular edema, serological test for immunity to varicella zoster virus (VZV) infection, complete blood count, liver function tests, blood pressure, and urine pregnancy test for females during reproductive age.30 Additional recommendations include pulmonary function test, dermatological examination, and serological test for viral hepatitis and tuberculosis, when clinically indicated. A detailed evaluation such as referral to cardiology (for abnormal ECG) and dermatology proceeds if baseline screening is abnormal. Active immunization against VZV is recommended for nonimmune cases.30,31 Review of past medical history and medication list for potential drug interactions is also recommended as part of prescreening. Special attention is paid to patients with diabetes and uveitis due to the increased risk of developing macular edema with fingolimod therapy.32,33 Cardiac rhythm abnormalities such as torsades de pointes, bradycardia, or conduction block could occur, especially in patients who are concurrently 
+
+1HXURORJLFDOH[DPFRQVLGHU05, ,QIHFWLRQUHFHQW&%&SRVLWLYHWLWHUIRU9=9 0DFXODUHGHPDRSKWKDOPRORJLFHYDOXDWLRQYLVXDODFXLW\ ![1_image_0.png](1_image_0.png)
+
+Figure 1 Proposed algorithm for patient management upon screening, FDO, and long-term follow-up for fingolimod therapy. Abbreviations: MRI, magnetic resonance imaging; CBC, complete blood count; VZV, varicella zoster virus; LFT, liver function test; ECG, electrocardiogram; FDO, first-dose observation; PFT, pulmonary function test; diff, diffusion; HR, heart rate.
+
+on medications that can cause prolonged QT interval (eg, citalopram, chlorpromazine, haloperidol, methadone, erythromycin), or interfere with cardiac conduction (eg, beta blockers, diltiazem, verapamil, digoxin).34,35 Interval monitoring of follow-up ophthalmologic examination (at 3–4 months following treatment initiation), complete blood counts, and hepatic function tests are recommended.1,2 Continuous monitoring of infection is recommended until 2 months after discontinuation of fingolimod. Women of childbearing potential should use effective contraception during and for 2 months after stopping therapy, since fingolimod therapy may cause fetal abnormalities.1,2 Regular monitoring for hypertension is also recommended throughout the duration of therapy.1,2,30 Patients undergoing fingolimod therapy receive more rigorous screening compared to those undergoing other disease-modifying therapies (DMTs). This may delay the initiation of therapy; however, patients in our practice have expressed satisfaction with thorough screening prior to starting therapy.
+
+## First-Dose Observation
+
+The first-dose observation (FDO) is a 6-hour monitoring session assessing for cardiac rhythm abnormalities, especially bradycardia, after initiation of fingolimod therapy. FDO includes monitoring for heart rate, cardiac rhythm, and blood pressure every hour, and ECG at 0 hour and 6 hours after taking first dose of fingolimod.36 The cardiovascular side effects during FDO from FREEDOMS and TRANSFORMS studies are bradycardia as being the most common cardiovascular event followed by first-degree atrioventricular (AV) block, second-degree AV block Mobitz type 1, sinus arrhythmia, and ventricular premature beats.36 The new FDA-revised FDO monitoring includes a repeat ECG prior to discharge based on potential cardiac rhythm abnormalities following first dose of fingolimod.37,38 FDO is carried out as an outpatient procedure in most facilities where patients are observed on a cardiac monitor for 6 hours with access to a rapid response team. Extended monitoring is recommended for those patients who demonstrate the following: 1) heart rate 45 beats per minute, 2) a continued downward trend, 3) new-onset seconddegree or more severe conduction block, 4) symptomatic bradycardia, and 5) prolonged QTc interval (QTc 470 ms in females and 450 ms in males) following 6-hour FDO 
+monitoring.37 Overnight continuous cardiac monitoring in a medical facility for FDO is recommended for patients with a preexisting cardiac condition or on concurrent medication that can interfere with cardiac conduction; patients with a prior cardiac history have not shown increased incidence of adverse events with FDO.39–41 Common complaints during FDO in our practice include headache, mild nausea, and symptomatic bradycardia in order of frequency. The guidelines for patients requiring repeat FDO are discontinuation within first 2 weeks of therapy, interruption of 1 or more days during weeks 3–4 of therapy, interruption of 7 or more days after 4 weeks of therapy, and interruption of 14 or more days anytime during treatment.1,37
+
+## Untoward Effects Associated With Fingolimod Use
+
+Side effects associated with fingolimod reported in FREEDOMS and TRANSFORMS are abnormal laboratory finding, infections, cardiovascular side effects, macular edema, malignancies, pulmonary side effects, and rare cases of posterior reversible encephalopathy syndrome. Less serious side effects include headache and hypertension.1,2
+
+## Laboratory Test Abnormalities
+
+Lymphopenia was the most common abnormal laboratory test leading to drug discontinuation in the FREEDOMS studies.42,43 Peripheral blood lymphocyte counts decreased up to 20%–30% from baseline within the first month of initiation of fingolimod therapy.20 Lymphopenia is often reversible and normalized approximately 45–135 days following discontinuation of fingolimod.44 Elevated alanine aminotransferase (ALT) (up to three or more times the upper limit of normal) was observed as the second most common abnormal laboratory finding.1,2 ALT levels also normalized spontaneously after discontinuation of fingolimod without permanent hepatic dysfunction.1,2
+
+## Risk Of Infection
+
+The overall incidence of infections in FREEDOMS and TRANSFORMS studies was similar in the treatment and placebo groups; however, a slightly higher incidence of bronchitis, influenza, and herpes viral infections (including herpes zoster infection) was observed in the fingolimod treatment groups.30 Other common infections included upper respiratory tract infections, nasopharyngitis, urinary tract infections, and sinusitis.30 Two fatal cases of reactivation of latent herpes virus (in the fingolimod 1.25 mg treatment group), a case of fatal disseminated VZV infection, and a case of fatal herpes simplex virus type 1 encephalitis in TRANSFORMS study were also observed.1–3,30 Other infections such as reactivation of human papilloma virus, John Cunningham virus 
+(in a post-natalizumab case), tuberculosis, and cytomegalovirus were also reported; however, post-marketing data did not reveal an increased rate of occult infections.45 About 20% 
+of our patient cohort on fingolimod (n=50) have reported symptoms of vaginitis, recurrent upper respiratory, and sinus infections; however, the etiology is unclear.
+
+## Cardiovascular Side Effects
+
+Fingolimod binds to S1PR1 in the heart, which can result in heart rhythm abnormalities such as bradycardia, therefore necessitating FDO.36–41 Maximal decrease in heart rate occurs at 4–6 hours, which is the basis of rationale for the 6-hour monitoring period.20 Symptomatic (eg, dizziness, chest discomfort, palpitations, and/or fatigue) bradycardia was observed in less than 1% of subjects.43,46 In FREEDOMS and TRANSFORMS studies, symptomatic bradycardia during FDO resolved within 24 hours without pharmacological interventions.1,2 Fingolimod is also known to induce cardiac conduction abnormalities, including first- and second-degree AV block, on the 6-hour post-dose ECG; patients who continued on treatment did not have persistent cardiac conduction abnormalities.34,35 We have had infrequent cases of symptomatic bradycardia leading to discontinuation of fingolimod as seen with patients in our practice.
+
+## Macular Edema
+
+Another potential side effect associated with the upregulation of S1PR in the vascular endothelial cells of the macula is fingolimod-associated macular edema (FAME).28–32 Most of the cases with FAME in FREEDOMS and TRANSFORMS studies were asymptomatic; the overall incidence of FAME was 0.5% in the 0.5 mg group, with complete resolution following discontinuation of therapy.1,2 FAME 
+generally occurred within 3–4 months of fingolimod initiation, although there has been a case report of early bilateral macular edema following fingolimod therapy within the first 3 months.32,33 Therefore, a follow-up ophthalmologic examination at 3–4 months post-fingolimod initiation is recommended. Few cases of unresolved macular edema were identified in the higher dose (1.25 mg) fingolimod group.20 In our patient cohort, we have seen two cases of symptomatic FAME which appeared 3–4 months after fingolimod initiation. Both cases had complete resolution of visual disturbance within 2–3 months after discontinuing fingolimod.
+
+## Risk Of Malignancy
+
+An increased risk of malignancies was found in association with fingolimod therapy in the TRANSFORMS and FREEDOMS studies. Most common malignancies found in association with fingolimod use are dermatological malignancies (Bowen's disease, n=1; basal cell carcinoma, n=10; and malignant melanoma, n=4).20,21 Other malignancies reported in the studies are breast cancer (n=5) with a fatal case of metastatic breast cancer in a patient who died 10 months after discontinuing fingolimod.47 Although there were at least three case reports of lymphoma in the fingolimod treatment group during drug development, a general consensus has not been reached on the risk of lymphoma with fingolimod.48
+
+## Pulmonary Side Effects
+
+Respiratory effects including mild reductions in 1-second forced expiratory volume and diffusion capacity for carbon monoxide were observed in FREEDOMS and TRANSFORMS.1,2 Spirometry and diffusion lung capacity tests are recommended if clinically indicated.1 We have a standard protocol assessing for pulmonary function status through spirometry testing prior to FDO.
+
+## Pregnancy
+
+Although fingolimod is classified as pregnancy category C, there have been cases of teratogenicity in live births during fingolimod clinical development.49 Exposure to fingolimod in the first trimester resulted in five cases of abnormal fetal development in 66 pregnancies.49,50 The available pregnancy registry data continue to provide important information regarding use of fingolimod in women of childbearing potential with the known risk of possible fetal malformation and teratogenic effects.51,52 The current recommendation for women of childbearing potential is to use effective contraception during fingolimod therapy and for at least 2 months after discontinuation of fingolimod.1
+
+## Tumefactive Ms And Rebound Relapses
+
+To date, 16 case reports in the literature describe worsening MS disease activity or even development of tumefactive demyelinating lesions (TDL) following fingolimod therapy.53–55 TDL are extremely rare and were observed in patients with established diagnosis of MS leading to the suspicion of a causal relationship between the use of fingolimod and development of TDL.55,56 The diagnosis of progressive multifocal leukoencephalopathy (PML) was entertained in this particular patient with TDL, since the patient was on natalizumab therapy before starting fingolimod; however, the patient was found to have "rebound" disease activity along with the development of TDL.57–60 It would seem prudent to monitor clinical progression and magnetic resonance imaging (MRI) activity for worsening disease activity in fingolimod-treated patients regardless of disease duration and prior DMT history.
+
+## Post-Market Experience
+
+Sudden death in a hypertensive patient on calcium-channel blockers and beta blockers within 24 hours following first-dose fingolimod prompted the FDA and the European Medicines Agency (EMA) to recommend a modification in the FDO to include hourly heart rate and blood pressure monitor and an ECG (either continuous, according to the EMA, or predose and 6 hours post-dose, according to the FDA) as well as excluding patients on medications that can cause cardiac rhythm abnormalities.37,38 Despite the recommendations, two open-label studies on fingolimod treatment initiation resulted in overall satisfactory safety and tolerability in patients with concomitant diseases, and no cardiac adverse events were observed in association with fingolimod use.34,39 On the contrary, a case report in 2013 identified that three (out of 59) 
+patients without known cardiovascular disease were found to have cardiac rhythm abnormalities (eg, sinus bradycardia with idioventricular escape rhythm that lasted 45 seconds and second-degree AV block Mobitz type 1).34 Additional postmarketing reports have raised concern over the risk for PML 
+in patients who were originally treated with natalizumab.60 A confirmed case of PML was reported in 2012 in a patient who was treated with natalizumab for 42 months prior to fingolimod therapy.61 The second case of PML was observed in a patient treated with fingolimod, who did not have prior exposure to natalizumab.62 The third reported case of PML was observed in a patient 3.5 months after fingolimod initiation and 4.5 months after natalizumab discontinuation.61,62
+
+## Efficacy
+
+Fingolimod met the primary end point of annualized relapse rate reduction across both Phase III trials. With the exception of time to disability progression in TRANSFORMS, secondary end point measures including MRI data were statistically significant in FREEDOMS and TRANSFORMS.63,64 More importantly, TRANSFORMS showed greater efficacy in relapse rate reduction over IFNβ in a 12-month study 
+(Table 2).1,2 Brain volume loss has been specifically studied in FREEDOMS, which found that fingolimod 0.5 mg dose significantly reduced brain volume loss up to 24 months vs placebo irrespective of the presence or absence of gadoliniumenhancing lesions, T2 lesion load, previous treatment status, or level of disability.65 Long-term data to support ongoing reduction in disability progression and brain volume loss are not available at this time, but studies to assess fingolimod safety and tolerability continue (Table 3).66,67
+
+## Suggested Treatment Algorithm Clinicians And Patients Across Ms Centers Continue To Struggle
+
+with selecting the most effective MS therapy for a particular patient with RRMS, and to assess whether drug benefits outweigh risks of treatment (Figure 2).68–70 As the first of three first-line oral therapies for the treatment of RRMS, fingolimod presents a suitable option for patients with recent diagnosis of MS or those with suboptimal response and/or compliance to injectable first-line immune therapies.71 Clinicians tend to switch patients to fingolimod (from natalizumab) based on the patients' risk for development of PML 
+based on serological status for John Cunningham virus, and those with neutralizing antibodies against natalizumab.72 A washout period of approximately 3 months has been recommended when switching from natalizumab to fingolimod, 
+
+| Table 2 Summary of pivotal trials Study Study design                                                                                     | Treatment arms                                                                                                    | Primary end point                  | Main result              |                          |
+|------------------------------------------------------------------------------------------------------------------------------------------|-------------------------------------------------------------------------------------------------------------------|------------------------------------|--------------------------|--------------------------|
+| TRANSFORMS4                                                                                                                              | n=1,292, 12-month, doubleblind, parallel-group, active  comparator, multicenter                                                                                                                   | Fingolimod 0.5 mg orally,          | ARR reduction over       | ARR: 0.16–0.20 (vs 0.33; |
+| daily                                                                                                                                    | 12 months                                                                                                         | P0.001 for each dose vs  IFNβ-1a) |                          |                          |
+| Fingolimod 1.25 mg  orally, daily IFNβ-1a 30 µg  intramuscularly, weekly                                                                 | Relapse free: 80%–83% of  patients (vs 69%; P0.0001  for each dose vs IFNβ-1a)                                   |                                    |                          |                          |
+| FREEDOMS3                                                                                                                                | n=1,272, 24-month,  double-blind, parallelgroup, placebo-controlled,  multicenter                                                                                                                   | ARR reduction over                 | ARR: 0.16–0.18 (vs 0.40; |                          |
+| 24 months                                                                                                                                | P0.001 for each dose vs  placebo) Relapse free: 70%–75% of  patients (vs 46%; P0.001  for each dose vs placebo) |                                    |                          |                          |
+| Abbreviations: ARR, annualized relapse rate for confirmed relapses; IFNβ-1a, interferon beta-1a.Fingolimod 0.5 mg orally,  daily Placebo |                                                                                                                   |                                    |                          |                          |
+
+| Table 3 Summary of other clinical trials Study Study design Treatment arms                                                                                                                                                                                                                                                                            | Primary end point                                                                    | Results                                                                                                                                                                                                                                                                                                                            |                                |                            |
+|-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|--------------------------------------------------------------------------------------|------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|--------------------------------|----------------------------|
+| FREEDOMS II43                                                                                                                                                                                                                                                                                                                                         | Phase II, 6-month,  double-blind,  parallel-group,  placebo-controlled,  multicenter | Fingolimod 0.5 mg                                                                                                                                                                                                                                                                                                                  | Total number of Gd+ lesions on | Free from Gd+ lesions: 82% |
+| orally, daily                                                                                                                                                                                                                                                                                                                                         | T1-w MRI at month 6                                                                  |                                                                                                                                                                                                                                                                                                                                    |                                |                            |
+| Fingolimod 1.25 mg  orally, daily Placebo                                                                                                                                                                                                                                                                                                             |                                                                                      |                                                                                                                                                                                                                                                                                                                                    |                                |                            |
+| FIRST34                                                                                                                                                                                                                                                                                                                                               | Phase IIIb, 4-month,                                                                 | Fingolimod 0.5 mg                                                                                                                                                                                                                                                                                                                  |                                |                            |
+| open-label, singlearm, multicenter                                                                                                                                                                                                                                                                                                                                                       | orally, daily  ×16 weeks                                                             | Cardiac effects following FDO are transient,  mostly asymptomatic, and observed in the  first 6 hours post-dose Suggest no increased risk of symptomatic  or serious cardiac events during treatment  initiation in patients with preexisting cardiac  conditions or in those receiving beta  blockers or calcium-channel blockers |                                |                            |
+| CFTY72045                                                                                                                                                                                                                                                                                                                                             | Non-comparative,                                                                     |                                                                                                                                                                                                                                                                                                                                    |                                |                            |
+| DIT0340                                                                                                                                                                                                                                                                                                                                               | open-label,  multicenter (Italy)                                                     | Evaluate the short-term safety  and tolerability profile of  fingolimod 0.5 mg with focus on  cardiac safety                                                                                                                                                                                                                       |                                |                            |
+| Fingolimod 0.5 mg                                                                                                                                                                                                                                                                                                                                     | Evaluate the safety and                                                              |                                                                                                                                                                                                                                                                                                                                    |                                |                            |
+| orally on FDO                                                                                                                                                                                                                                                                                                                                         | tolerability data associated with  initial dose of Fingolimod                        | Safety and tolerability in "real-world" setting  was similar to what was seen in pivotal trials                                                                                                                                                                                                                                    |                                |                            |
+| EPOC46,71                                                                                                                                                                                                                                                                                                                                             | 6-month,  randomized, active  comparator, openlabel, multicenter                                                                                      | Safety and tolerability similar to what was  seen in pivotal trials                                                                                                                                                                                                                                                                |                                |                            |
+| IFNβ-1a 44 µg  subcutaneous,  3 times a week GA 20 mg,  subcutaneous, daily                                                                                                                                                                                                                                                                           |                                                                                      |                                                                                                                                                                                                                                                                                                                                    |                                |                            |
+| Abbreviations: Gd+, gadolinium-enhanced; T1-w, T1-weighted; MRI, magnetic resonance imaging; FDO, first-dose observation; IFNβ-1a, interferon beta-1a; GA, glatiramer  acetate. Fingolimod 0.5 mg  Evaluate the safety and  orally, daily tolerability and patient  outcomes who are changing  from previous disease-modifying  therapy to fingolimod |                                                                                      |                                                                                                                                                                                                                                                                                                                                    |                                |                            |
+
+but duration of washout period depends on the disease activity and other comorbidities such as the immune status of the patient.73
+
+## Patient Adherence
+
+It is well recognized that medication adherence is not always 100% with either oral or injectable DMTs for multiple reasons.74,75 Fingolimod provides an attractive alternative to injectable DMTs due to the ease of administration. However, a retrospective study on medication compliance showed that approximately 27% of fingolimod users discontinued within 1 year of treatment initiation.75 Socioeconomic factors play a role in patient adherence to drug treatment with increasing out-of-pocket and copayments and lack of insurance 
+
+![5_image_0.png](5_image_0.png)
+
+Figure 2 Proposed algorithm to start fingolimod for treatment-naïve patients and prior disease-modifying therapy use. Abbreviations: MS, multiple sclerosis; IFN, interferon; GA, glatiramer acetate; DMF, dimethyl fumarate; PML, progressive multifocal leukoencephalopathy; JCV, John Cunningham virus; MRI, magnetic resonance imaging.
+
+coverage.76,77 The Consortium of MS Centers recently outlined that the main reasons for patients switching DMTs in MS included efficacy, safety, prescriber- or payer-related reasons, and patient-related reasons which included difficulty with adherence, desire to try different administration methods, and perceived lack of efficacy.78 Most of the patients in our practice have discontinued fingolimod primarily due to side effects of the medication and perceived lack of efficacy. Typically, patients who have switched from injection therapy are pleased with the ease of oral administration of fingolimod, despite the lack of comprehensive long-term safety data.
+
+## Conclusion
+
+Fingolimod is the first FDA-approved oral therapy for the treatment of RRMS as shown by two large Phase III studies, FREEDOMS and TRANSFORMS.1 Clinical efficacy of fingolimod was observed to be superior to placebo and IFNβ-1a in reducing relapse rate and MRI activity. However, thorough screening, FDO, and long-term follow-up are recommended in order to avoid potential side effects associated with fingolimod therapy. Fingolimod presents as a treatment option as a first-line therapy for patients with new-onset RRMS or those switching therapies due to intolerability and/or lack of efficacy of prior DMTs. However, studies on long-term efficacy, safety, and mechanism of action of fingolimod remain to be further pursued for therapeutic optimization and to avoid undesirable side effects.
+
+## Disclosure
+
+Jong-Mi Lee has received consulting agreements or service as speaker (Biogen Idec, Teva Pharmaceuticals, and Genzyme). The other author reports no conflicts of interest in this work.
+
+## References
+
+1. Novartis Pharmaceuticals. Fingolimod Prescribing Information; 2014. 
+
+Available from: http://www.pharma.us.novartis.com/product/pi/pdf/ gilenya.pdf. Accessed December 8, 2014.
+
+2. European Medicines Agency. European Public Assessment Report 
+(EPAR) for Gilenya; 2014. Available from: http://www.ema.europa.
+
+eu/ema/index.jsp?curl=pages/medicines/human/medicines/002202/ human_med_001433.jsp&mid=WC0b01ac058001d125. Accessed December 8, 2014. [Gilenya: EPAR: Summary report for the public].
+
+3. Kappos L, Radue EW, O'Connor P, et al. A placebo-controlled trial of oral fingolimod in relapsing multiple sclerosis. *N Engl J Med*. 2010; 362:387–401. [Pivotal Trial FREEDOMS].
+
+4. Cohen JA, Barkhof F, Comi G, TRANSFORMS Study Group, et al. Oral fingolimod or intramuscular interferon for relapsing multiple sclerosis. N Engl J Med. 2010;362:402–415. [Pivotal Trial FREEDOMS].
+
+5. Hla T, Brinkmann V. Sphingosine 1-phosphate (S1P): physiology and the effects of S1P receptor modulation. *Neurology*. 2011;76:S3–S8.
+
+6. Brinkmann V. FTY720 (fingolimod) in multiple sclerosis: therapeutic effects in the immune and the central nervous system. *Br J Pharmacol*. 2009; 158:1173–1182.
+
+7. Brinkmann V, Davis MD, Heise CE, et al. The immune modulator FTY720 targets sphingosine 1-phosphate receptors. *J Biol Chem*. 2002; 277(24):21453–21457.
+
+8. Cohen JA, Chun J. Mechanisms of fingolimod's efficacy and adverse effects in multiple sclerosis. *Ann Neurol*. 2011;69(5):759–777.
+
+9. Mehling M, Johnson TA, Antel J, Kappos L, Bar-Or A. Clinical immunology of the sphingosine 1-phosphate receptor modulator fingolimod 
+(FTY720) in multiple sclerosis. *Neurology*. 2011;76(8 suppl 3):
+S20–S27.
+
+10. Choi JW, Gardell SE, Herr DR, et al. FTY720 (fingolimod) efficacy in an animal model of multiple sclerosis requires astrocyte sphingosine 1-phosphate receptor (S1P1) modulation. *Proc Natl Acad Sci U S A*. 2011; 108(2):751–756.
+
+11. Groves A, Kihara Y, Chun J. Fingolimod: direct CNS effects on sphingosine 1-phosphate (S1) receptor modulation and implications in multiple sclerosis therapy. *J Neurol Sci*. 2013;328(1–2):9–18.
+
+12. Mullershausen F, Zecri F, Cetin C, Billich A, Guerini D, 
+Seuwen K. Persistent signaling induced by FTY720-phosphate is mediated by internalized S1P1 receptors. *Nat Chem Biol*. 2009;5(6): 428–434.
+
+13. Van Doorn R, Van Horssen J, Verzijl D, et al. Sphingosine 1-phosphate receptors 1 and 3 are upregulated in multiple sclerosis lesions. *Glia*. 2010;58(12):1465–1476.
+
+14. Scott LJ. Fingolimod: a review of its use in the management of relapsingremitting multiple sclerosis. *CNS Drugs*. 2011;8:673–698.
+
+15. Devonshire V, Havrdova E, Radue EW, et al; FREEDOMS study group. Relapse and disability outcomes in patients with multiple sclerosis treated with fingolimod: subgroup analyses of the double-blind, randomized, placebo-controlled FREEDOMS study. *Lancet Neurol*. 2012;11:420–428.
+
+16. Gasperini C, Ruggieri S. Development of oral agent in the treatment of multiple sclerosis: how the first available oral therapy, fingolimod will change therapeutic paradigm approach. *Drug Des Devel Ther*. 2012;6: 175–186.
+
+17. Gasperini C, Ruggieri S, Mancinelli CR, Pozzilli C. Advances in the treatment of relapsing-remitting multiple sclerosis - critical appraisal of fingolimod. *Ther Clin Risk Manag*. 2013;9:73–85.
+
+18. Mehling M, Kappos L, Derfuss T. Fingolimod for multiple sclerosis: 
+mechanism of action, clinical outcomes, and future directions. *Curr* Neurol Neurosci Rep. 2011;11:492–497.
+
+19. Rommer PS, Zettl UK, Kieseier B, et al. Requirement for safety monitoring for approved multiple sclerosis therapies: an overview. Clin Exp Immunol. 2013;175(3):397–407.
+
+20. Ward M, Jones DE, Goldman MD. Overview and safety of fingolimod hydrochloride use in patients with multiple sclerosis. *Expert Opin Drug* Saf. 2014;13(7):989–998.
+
+21. Kappos L, Cohen J, Collins W, et al. Fingolimod in relapsing multiple sclerosis: an integrated analysis of safety findings. Multiple Sclerosis and Related Disorders. 2014;3(4):494–504.
+
+22. Beran RG, Hegazi Y, Schwartz RS, Cordato DJ. Rebound exacerbation multiple sclerosis following cessation of oral treatment. Mult Scler Relat Disord. 2013;2(3):252–255.
+
+23. Alroughani R, Alroughani R, Almulla A, Lamdhade S, Thussu A. 
+
+Severe reactivation of multiple sclerosis after discontinuation of fingolimod: an IRIS-associated phenomenon. *Mult Scler Relat Disord*. 2014;3(6):748.
+
+24. Havla JB, Pellkofer HL, Meinl I, Gerdes LA, Hohfeld R, Kumpfel T. 
+
+Rebound of disease activity after withdrawal of fingolimod (FTY720) treatment. *Arch Neurol*. 2012;69(2):262–264.
+
+25. Ghezzi A, Rocca MA, Baroncini D, et al. Disease reactivation after fingolimod discontinuation in two multiple sclerosis patients. *J Neurol*. 2013;260(1):327–329.
+
+26. Rommer PS, Zettl UK, Kieseier B, et al. Requirement for safety monitoring for approved multiple sclerosis therapies: an overview. Clin Exp Immunol. 2014;175(3):397–407.
+
+27. Singer BA. Initiating oral fingolimod treatment in patients with multiple sclerosis. *Ther Adv Neurol Disord*. 2013;6(4):269–275.
+
+28. Ontaneda D, Hara-Cleaver C, Rudick RA, Cohen JA, Bermel RA. Early tolerability and safety of fingolimod in clinical practice. *J Neurol Sci*. 2012;323(1–2):167–172.
+
+29. Thomas K, Ziemssen T. Management of fingolimod in clinical practice. 
+
+Clin Neurol Neurosurg. 2013;115(suppl 1):S60–S64.
+
+30. Thöne J, Ellrichmann G. Oral available agents in the treatment of relapsing remitting multiple sclerosis: an overview of merits and culprits. 
+
+Drug Healthc Patient Saf. 2013;5:37–47.
+
+31. Berger JR. Varicella vaccination after fingolimod: a case report. *Mult* Scler Relat Disord. 2013;2(4):391–394.
+
+32. Jain N, Bhatti MT. Fingolimod-associated macular edema: 
+incidence, detection, and management. *Neurology*. 2012;78(9): 672–680.
+
+33. Coppes O, Gutierrez I, Reder AT, Ksiazek S, Bernard J. Severe early bilateral macular edema following fingolimod therapy. Mult Scler Relat Disord. 2013;2(3):256–258.
+
+34. Gold R, Comi G, Palace J, FIRST Study Investigators, et al. Assessment of cardiac safety during fingolimod treatment initiation in a real-world relapsing multiple sclerosis population: a phase 3b, open-label study. J Neurol. 2014;261(2):267–276.
+
+35. Camm J, Hla T, Bakshi R, Brinkmann V. Cardiac and vascular effects of fingolimod: mechanistic basis and clinical implications. *Am Heart J*. 2014;168(5):632–644.
+
+36. Horga A, Castrillo J, Montalban X. Fingolimod for relapsing multiple sclerosis; an update. *Expert Opin Pharmacother*. 2010;11:
+1183–1196.
+
+37. FDA. *Revised Drug Monitoring*: US Food and Drug Administration; 2014. Available from: http://www.fda.gov/Drugs/DrugSafety/
+ucm303192.htm. Accessed December 8, 2014.
+
+38. FDA. *First Reported Death on Gilenya: 24hrs Post FDO*: US Food and Drug Administration; 2014. Available from: http://www.fda.gov/ Drugs/DrugSafety/ucm284240.htm. Accessed December 8, 2014.
+
+39. Thomas K, Schrötter H, Halank M, Ziemssen T. Fingolimod in a patient with heart failure on the background of pulmonary arterial hypertension and coronary artery disease. *BMC Neurol*. 2014;14:126.
+
+40. Laroni A, Brogi D, Morra VB, et al; EAP Investigators. Safety of the first dose of fingolimod for multiple sclerosis: results of an open-label clinical trial. *BMC Neurol*. 2014;14:65.
+
+41. Faber H, Fischer H-J, Weber F. Prolonged and symptomatic bradycardia following a single dose of fingolimod. *Mult Scler*. 2013;19(1):
+126–128.
+
+42. Singer B, Ross AP, Tobias K. Oral fingolimod for the treatment of patients with relapsing forms of multiple sclerosis. *Int J Clin Pract*. 2011;65(8):887–895.
+
+43. Calabresi PA, Radue EW, Goodin D, et al. Safety and efficacy of fingolimod in patients with relapsing-remitting multiple sclerosis (FREEDOMS II): a double-blind, randomized, placebo-controlled, phase 3 trial. *Lancet Neurol*. 2014;13(6):545–556.
+
+44. Johnson TA, Shames I, Keezer M, et al. Reconstitution of circulating lymphocyte counts in FTY720-treated MS patients. *Clin Immunol*. 2010;137(1):15–20.
+
+45. Rosenstiel PV, Gottschalk R, Cappiello L, Zhang Y, Said M, Kappos L. 
+
+Long-term safety of fingolimod: interim evaluation of data from the longterms trial. *Mult Scler Relat Disord*. 2014;3(6):752.
+
+46. Hughes B, Cascione M, Freedman MS, et al. First-dose effects of fingolimod after switching from injectable therapies in the randomized, openlabel, multicenter, evaluate patient outcomes (EPOC) study in relapsing multiple sclerosis. *Mult Scler Relat Disord*. 2014;3(5):620–628.
+
+47. Conzett KB, Kolm I, Jelcic I, et al. Melanoma occurring during treatment with fingolimod for multiple sclerosis: a case report. *Arch Dermatol*. 2011;147(8):991–992.
+
+48. Lorvik KB, Bogen B, Corthay A. Fingolimod blocks immunosurveillance of myeloma and B-cell lymphoma resulting in cancer development in mice. *Blood*. 2012;119(9):2176–2177.
+
+49. Karlsson G, Francis G, Koren G, et al. Pregnancy outcomes in the clinical development program of fingolimod in multiple sclerosis. Neurology. 2014;82(8):674–680.
+
+50. Jones B. Multiple sclerosis: study reinforces need for contraception in women taking fingolimod. *Nat Rev Neurol*. 2014;10(3):125.
+
+51. Alwan S, Chambers CD, Armenti VT, Dessa-Sadovnick A. The need for disease-specific prospective pregnancy registry for multiple sclerosis (MS). *Mult Scler Relat Disord*. 2015;4(1):6–17.
+
+52. Houtchens MK, Kolb CM. Multiple sclerosis and pregnancy: therapeutic considerations. *J Neurol*. 2013;260(5):1202–1214.
+
+53. Hellmann MA, Lev N, Lotan I, et al. Tumefactive demyelination and a malignant course in an MS patient during and following fingolimod therapy. *J Neurol Sci*. 2014;344(1–2):193–197.
+
+54. Pilz G, Harrer A, Wipfler P, et al. Tumefactive MS lesions under fingolimod: a case report and literature review. *Neurology*. 2013;81(19): 
+1654–1658.
+
+55. Castrop F, Kowarik MC, Albrecht H, et al. Severe multiple sclerosis relapse under fingolimod therapy: incident or coincidence? *Neurology*. 2012;78(12):928–930.
+
+56. Jander S, Turowski B, Kieseier BC, Hartung H-P. Emerging tumefactive multiple sclerosis after switching therapy from natalizumab to fingolimod. *Mult Scler*. 2012;18:1650–1652.
+
+57. Daelman L, Maitrot A, Maarouf A, Chaunu MP, Papeix C, Tourbah A. 
+
+Severe multiple sclerosis reactivation under fingolimod 3 months after natalizumab withdrawal. *Mult Scler*. 2012;11:1647–1649.
+
+58. Hakiki B, Portaccio E, Giannini M, Razzolini L, Pasto L, Amato MP. 
+
+Withdrawal of fingolimod treatment for relapsing-remitting multiple sclerosis: report of six cases. *Mult Scler*. 2012;18(11):1636–1639.
+
+59. Centonze D, Rossi S, Rinaldi F, Gallo P. Severe relapses under fingolimod treatment prescribed after natalizumab. *Neurology*. 2012; 79(19):2004–2005.
+
+60. Alroughani R, Ahmed S, Al-Hashel J. The risk of short-term relapse in patients switching from natalizumab to fingolimod. Mult Scler Relat Disord. 2014;3(6):748–749.
+
+61. FDA. *Brain Infection Case. US Food and Drug Administration*; 2014. 
+
+Available from: http://www.fda.gov/Drugs/DrugSafety/ucm366529. htm. Accessed December 8, 2014.
+
+62. Calic Z, Cappelen-Smith C, Hodgkinson SJ, McDougall A, Cuganesan R, 
+Brew BJ. Treatment of progressive multifocal leukoencephalopathyimmune reconstitution inflammatory syndrome with intravenous immunoglobulin in a patient with multiple sclerosis treated with fingolimod after discontinuation of natalizumab. *J Clin Neurosci*. 2014; 22(3):598–600.
+
+63. Khatri BO, Pelletier J, Kappos L, et al. Effect of prior treatment status and reasons for discontinuation on the efficacy and safety of fingolimod vs interferon B-1a intramuscular: subgroup analyses of the trial assessing injectable interferon vs. fingolimod oral in relapsingremitting multiple sclerosis (TRANSFORMS). *Mult Scler Relat Disord*. 
+
+2013;3(3):355–363.
+
+64. Khatri B, Barkhof F, Comi G, et al; TRANSFORMS Study Group. 
+
+Comparison of fingolimod with interferon beta-1a in relapsing-remitting multiple sclerosis: a randomized extension of the TRANSFORMS study. *Lancet Neurol*. 2011;10(6):520–529.
+
+65. Radue EW, O'Connor P, Polman CH, et al; FTY720 Research Evaluating Effects of Daily Oral Therapy in Multiple Sclerosis (FREEDOMS) 
+Study Group. Impact of fingolimod therapy on magnetic resonance imaging outcomes in patients with multiple sclerosis. *Arch Neurol*. 2012; 69(10):1259–1269.
+
+66. Yamout B, Khoury S, Zeineddine M, Hourany R. Efficacy and safety of fingolimod treatment in multiple sclerosis: the clinical experience of the AUBMC Multiple Sclerosis Center in Lebanon. Mult Scler Relat Disord. 2014;3(6):749.
+
+67. Ziemmsen T, Diaz-Lorente M, Abdelkader M, Cornelissen C. PANGAEA: post-authorization Noninterventional German safety Study of Gilenya in relapsing-remitting multiple sclerosis (RRMS) patients: a 24-month interim analysis of a German five-year fingolimod registry study. *Mult Scler Relat Disord*. 2014;3(6):751.
+
+68. Fazekas F, Bajenaru O, Berger T, et al. How does fingolimod (gilenya(®)) fit in the treatment algorithm for highly active relapsingremitting multiple sclerosis? *Front Neurol*. 2013;4:10.
+
+69. Hanson KA, Agashivala N, Wyrwich KW, Raimundo K, Kim E, 
+Brandes DW. Treatment selection and experience in multiple sclerosis: survey of neurologists. *Patient Prefer Adherence*. 2014;8:415–422.
+
+70. Ontaneda D, Cohn S, Fox RJ. Risk stratification and mitigation in multiple sclerosis. *Mult Scler Relat Disord*. 2014;3(5):639–649.
+
+71. Fox E, Edwards K, Burch G, et al. Outcomes of switching directly to oral fingolimod from injectable therapies: results of the randomized, open-label, multicenter, evaluate patient outcomes (EPOC) study in relapsing multiple sclerosis. *Mult Scler Relat Disord*. 2014;3(5): 607–619.
+
+72. Havla J, Tackenberg B, Hellwig K, et al. Fingolimod reduces recurrence of disease activity after natalizumab withdrawal in multiple sclerosis. J Neurol. 2013;260(5):1382–1387.
+
+73. de Seze J, Ongagna JC, Collongues N, et al. Reduction of the washout time between natalizumab and fingolimod. *Mult Scler*. 2013; 19(9):1248.
+
+74. Halpern R, Agarwal S, Borton L, Oneacre K, Lopez-Bresnahan MV. 
+
+Adherence and persistence among multiple sclerosis patients after one immunomodulatory therapy failure: retrospective claims analysis. *Adv* Ther. 2011;28(9):761–775.
+
+75. Agashivala N, Wu N, Abouzaid S, et al. Compliance to fingolimod and other disease modifying treatments in multiple sclerosis patients, a retrospective cohort study. *BMC Neurol*. 2013;13:138.
+
+76. Tan H, Cai Q, Agarwal S, Stephenson JJ, Kamat S. Impact of adherence to disease-modifying therapies on clinical and economic outcomes among patients with multiple sclerosis. *Adv Ther*. 2011; 28(1):51–61.
+
+77. Menzin J, Caon C, Nichols C, White LA, Friedman M, Pill MW. 
+
+Narrative review of the literature on adherence to disease-modifying therapies among patients with multiple sclerosis. *J Manag Care Pharm*. 2013;19(1 suppl A):S24–S40.
+
+78. Therapeutic decision making in multiple sclerosis: best practice algorithms for the MS care clinician. *Int J MS Care*. 2014;16 (suppl 6):1–36.
+
+Patient Preference and Adherence Publish your work in this journal Patient Preference and Adherence is an international, peer-reviewed, open access journal that focuses on the growing importance of patient preference and adherence throughout the therapeutic continuum. Patient satisfaction, acceptability, quality of life, compliance, persistence and their role in developing new therapeutic modalities and compounds to optimize Submit your manuscript here: http://www.dovepress.com/patient-preference-and-adherence-journal clinical outcomes for existing disease states are major areas of interest for the journal. This journal has been accepted for indexing on PubMed Central. The manuscript management system is completely online and includes a very quick and fair peer-review system, which is all easy to use. Visit http://www. dovepress.com/testimonials.php to read real quotes from published authors.
+
+## Dovepress

medical/md/PMC4616385.md

@@ -0,0 +1,364 @@
+# Evaluation Of A Novel Functional Single-Nucleotide Polymorphism (Rs35010275 G>C) In Mir196A2 Promoter Region As A Risk Factor Of Gastric Cancer In A Chinese Population
+
+Ming Xu, PhD, Fulin Qiang, MD, Yan Gao, MD, Meiyun Kang, MD, Meilin Wang, PhD,
+Guoquan Tao, PhD, Weida Gong, PhD, Haixia Zhu, MD, Dongmei Wu, PhD,
+Zhengdong Zhang, PhD, and Qinghong Zhao, PhD
+Abstract: Single-nucleotide polymorphisms (SNPs) in microRNAs
+(miRNAs) have been suggested to influence the occurrence and progression of cancer through altering the expression and biological function of miRNAs. The aim of this study was to investigate whether the potential functional SNPs in MIR196A2 promoter had effect on the susceptibility to gastric cancer (GC) in a Chinese population.
+
+We conducted a 2-stage case–control study (753 cases and 854 controls in testing set; 940 cases and 1061 controls in validation set) to evaluate the association between 2 potential functional SNPs in MIR196A2 promoter (rs12304647 A>C and rs35010275 G>C) and GC risk. The luciferase reporter assay and electrophoretic mobility shift assay were used to examine the functionality of the important polymorphism.
+
+We found that the rs35010275 C allele was significantly associated with the decreased risk of GC (adjusted odds ratio ¼ 0.85, 95% confidence interval¼ 0.77–0.94) in the combined case–control studies.
+
+The miR-196a expression levels in GC tissues were significantly higher than that in corresponding adjacent normal tissues (P < 0.001). Besides, Editor: Bulent Kantarceken. Received: June 15, 2014; revised: September 9, 2014; accepted: September 13, 2014. From the Department of Environmental Genomics (MX, YG, MK, MW,
+HZ, DW, ZZ), Jiangsu Key Laboratory of Cancer Biomarkers, Prevention and Treatment, Cancer Center, Nanjing; Department of Genetic Toxicology (MX, YG, MK, MW, DW, ZZ), The Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing; Core Laboratory of Nantong Tumor Hospital (FQ, HZ), Nantong; Department of General Surgery (GT), Huai-An First People's Hospital Affiliated to Nanjing Medical University, Huai-an; Department of General Surgery (WG), Yixing Cancer Hospital, Yixing; and Department of General Surgery (QZ), The Second Affiliated Hospital of Nanjing Medical University, Nanjing, China.
+
+Correspondence: Zhengdong Zhang, Department of Environmental Genomics, School of Public Health, Nanjing Medical University, 818 East Tianyuan Road, Jiangning District, Nanjing 211166, China (e-mail: drzdzhang@gmail.com).
+
+MX, FQ, and YG contributed equally to this work. This study was partly supported by the National Natural Science Foundation of China (81230068, 81302490, 81373091, and 81473049), the Natural Science Foundation of Jiangsu Province (BK2011194 and BK2012842), the Key Program for Basic Research of Jiangsu Provincial Department of Education (12KJA330002), Jiangsu Provincial Science and Technology Innovation Team, and the Priority Academic Program Development of Jiangsu Higher Education Institutions (Public Health and Preventive Medicine).
+
+The authors have no funding and conflicts of interest to disclose.
+
+Copyright \# 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins.
+
+This is an open access article distributed under the Creative Commons Attribution-NonCommercial License, where it is permissible to download, share and reproduce the work in any medium, provided it is properly cited. The work cannot be used commercially. ISSN: 0025-7974 DOI: 10.1097/MD.0000000000000173 each allele of rs35010275 displayed completely opposite effects to influence the transcription activity of MIR196A2 promoter via recruiting different transcription factors or complexes.
+
+The functional rs35010275 G>C polymorphism in MIR196A2 promoter was significantly associated with miR-196a expression and influenced the genetic susceptibility to GC. (Medicine 93(26):e173)
+Abbreviations: 30-UTR = 30-untranslated region, EMSA =
+electrophoretic mobility shift assay, GC = gastric cancer, HWE = Hardy–Weinberg equilibrium, MAF = minor allele frequency, SNPs = single-nucleotide polymorphisms.
+
+## Introduction
+
+Gastric cancer (GC) remains the fourth most common cancer worldwide with a huge number of new diagnosed cases every year, especially in Asian countries.1,2 In recent decades, GC mortality has been reported to decline; however, it is still the second fatal cause in China, following lung cancer.2 Clinical data have shown that most GC patients were diagnosed with an advanced stage, which means these patients have missed their best treatment period and will confront a poor survival. A better understanding of the molecular mechanisms underlying gastric carcinogenesis may help to identify more accurate diagnostic markers and even more effective treatment strategies for this lethal disease.3–5 Classic genetic studies have implicated that aberrant expressions of tumor-suppressor genes or oncogenes are crucial factors for GC occurrence. With the development of epigenomics, alterations of CpG islands and whole genomic methylation were proved to be involved in gastric carcinogenesis.6–8 Besides, accumulating evidences have indicated that microRNAs (miRNAs), as important factors, also participate in the etiology of GC.9–11 MiRNAs are a sort of endogenous small noncoding RNAs, which cleaved from 70 to 100 nucleotides hairpin miRNA precursors, and are about 19 to 25 nucleotides long in mature form. In eukaryotes, mature miRNAs mainly affect the expressions of diverse protein-coding genes by targeting their mRNA in 30-untranslated regions
+(30-UTRs), and then leading to a post-transcriptional retardation by either inhibiting mRNAs' translation or accelerating their degradation.12 It has been reported that miRNAs, including miR-196a, were noticed for their aberrant behaviors on various target mRNAs covering almost all of the important signal pathways.13–16 Recently, single-nucleotide polymorphisms (SNPs) in several miRNAs genes have aroused researchers' concern. The potential role of these SNPs have been identified in the cancer development, such as nasopharyngeal carcinoma,17 breast cancer,18,19 hepatocellular carcinoma,20,21 lung cancer,22,23 head and neck cancer,24 and GC.25,26 The MIR196A2 rs11614913, as a prestigious biomarker in cancers, including GC, was reported in our previous study.27 The variant of rs11614913 could strongly influence the binding ability of mature miR-196a to its target mRNAs.28,29 Overexpression of miR-196a was common in colon cancer and GC.16,30–32 Considering functional polymorphisms in promoter region could influence gene expression,33–35 it is rational to hypothesize that there exist some SNPs in MIR196A2 promoter region that might directly trigger the transcription of MIR196A2 and finally affect GC susceptibility. In our previous report, rs11614913 SNP was associated with the risk of GC.36 However, as a variant existing in mature miRNA, it was still difficulty to affect the transcription of miR-196a-2. As an intergenic miRNA gene, MIR196A2 has recently been reported to possess its own promoter that might alter miR-196a expression level and closely associate with the incidence of GC.36To test this hypothesis, we initiated to screen MIR196A2 promoter region and then focused on 2 potentially functional SNPs (rs12304647 A>C and rs35010275 G>C).
+
+Through further functional study, we testified their probable mechanisms and evaluated the possibility of these SNPs as biomarkers for GC susceptibility and clinical outcomes.
+
+## Materials And Methods Study Population
+
+This study was approved by the Institutional Review Board of Nanjing Medical University, Nanjing, China, and all subjects participated in this 2-stage study signed a written informed consent form. Seven hundred fifty-three GC cases and 854 cancer-free controls in testing set and additional subjects consisted of 1022 cases and 1061 cancer-free participants in validation set were periodical recruited from the Cancer Clinical Research Base of Nanjing Medical University during March 2006 to January 2010 and January 1999 and December 2006, respectively, which had been described previously in details.37 In the set for validation, 78 patients (7.6%) with incomplete follow-up information and 4 patients with nonadenocarcinoma were excluded, and finally 940 patients with gastric adenocarcinoma were enrolled. All patients involved in our study were newly diagnosed and histopathologically identified, without previous history of cancer or previous chemotherapy or radiotherapy. Collecting data on patients mainly included age, sex, and tumor site histological type, depth of invasion, lymph node metastasis, distant metastasis, as well as clinical tumor node metastasis (TNM) stage. Histopathology of tumor was classified to diffuse type and intestinal type according to Lauren criteria.38 The tumor invasion, lymph nodes metastasis, distant metastasis, and clinical TNM stage were recorded according to TNM classification (American Joint Commission on Cancer Staging, 6th).39 All controls were enrolled in the same period with no genetic relationship to the cases. Besides, the controls were frequency matched to cases by sex and age (-5 years) (Table 1). Each subject donated 5 mL peripheral blood after interviews.
+
+## Snp Selection
+
+SNPs in MIR196A2 promoter region were selected based on HapMap data (http://hapmap.ncbi.nlm.nih.gov/) and dbSNP
+data (http://www.ncbi.nlm.nih.gov/projects/SNP/). The potentially functional polymorphisms were identified following the criteria: located in the MIR196A2 50-flanking region; and Minor allele frequency (MAF) >0.05 in Chinese population. According to the criteria, 2 SNPs (rs12304647 A>C and rs35010275 G>C) remained in our study.
+
+## Dna Isolation And Genotyping
+
+Genomic DNA was extracted from peripheral blood and paraffin sections of tissues for testing set and validation set, respectively. After proteinase K digestion and phenol–chloroform extraction, approximately 10% of DNA samples were randomly selected for agarose electrophoresis as quality control. Genotyping was carried out by fluorescent-based TaqMan SNP Genotyping Assay using ABI 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA). Quality control was performed with the quality criteria as our previous study.37
+
+## Rna Isolation And Qrt-Pcr
+
+Total RNA were extracted by TRIzol reagent (Invitrogen, Carlsbad, CA) according to the protocol, which were from 66 pairs of patients' tumor and adjacent normal tissues including 753 cases in our testing set. RNA was measured by Nanodrop ND-2000 spectrophotometer (Thermo, Waltham, MA) for its quality and quantity, and then stored at 808C.
+
+Quantitative reverse transcriptase PCR was carried out by ABI 7900HT Fast Real-Time PCR System (Applied Biosystems). The PCR of each sample was normalized against an U6 internal control. The primer sequences were mentioned in supplementary data (see supplementary Digital Content 1, http://links.lww.com/MD/A80). All PCR reactions were conducted in triplicate.
+
+## Construction Of Promoter–Reporter Plasmids The 50-Flanking Region Sequence Of Human Mir196A2
+
+gene was obtained from the Homo sapiens chromosome 12 (NC_000012.11) after a blast search, starting from the first base of pri-miRNA. Luciferase reporter plasmids and corresponding variants were constructed by PCR amplification of nucleotides 1000, 700, 500 to transcriptional start site of MIR196A2 promoter from human genomic DNA. All amplified fragments were cloned into pGL3-basic vectors (Promega, Madison, WI) and sequenced to confirm the orientation and integrity of each construct's inserts.
+
+## Cell Culture
+
+Gastric epithelium cell line (GES-1) and SGC-7901 are both cultured in Dulbecco's Modified Egale medium/high glucose (Invitrogen) culture medium, supplementing with 10% heat-inactivated fetal bovine serum obtained from GIBCO (Burlington, ON, Canada), 10 mmol/L 4-(2-hydroxyethyl)-1piperazineethanesulfonicaci, 2 mmol/L L-glutamine, 1 mmol/L
+pyruvate sodium, 100 U/mL penicillin, and 100mg/mL streptomycin at 378C in a humidified atmosphere containing 5%
+CO2.
+
+## Transfection And Luciferase Assay
+
+For transfection, 1  106 cells were seeded in individual well of a 24-well culture plate. Cells were transfected via lipofectamine-2000 transfection reagent with 0.5mg constructed luciferase reporter plasmids mentioned above. The pRL-SV40 (as internal control) was transiently cotransfected into cells. Twenty-four hours after transfection, all cells were
+
+| TABLE 1. Demographic Characteristics and Clinical Features Testing Set   | Validation Set     | P                 |                     |            |            |       |
+|--------------------------------------------------------------------------|--------------------|-----------------|---------------------|------------|------------|-------|
+| Cases (n ¼ 753)                                                          | Controls (n ¼ 854) | Cases (n ¼ 940) | Controls (n ¼ 1061) |            |            |       |
+| n (%)                                                                    | n (%)              | n (%)           | n (%)               |            |            |       |
+| P                                                                          |                    |                 |                     |            |            |       |
+| Variables Age, y 65                                                                          | 432 (57.4)         | 473 (55.4)      | 0.424               | 604 (64.3) | 660 (62.2) | 0.343 |
+| >65                                                                      | 321 (42.6)         | 381 (44.6)      | 336 (35.7)          | 401 (37.8) |            |       |
+| Sex Male                                                                 | 512 (68.0)         | 564 (66.0)      | 0.406               | 724 (77.0) | 805 (75.9) | 0.546 |
+| Female                                                                   | 241 (32.0)         | 290 (34.0)      | 216 (23.0)          | 256 (24.1) |            |       |
+| Tumor sites Cardia                                                       | 295 (39.2)         | 318 (33.8)      |                     |            |            |       |
+| Noncardia                                                                | 458 (60.8)         | 622 (66.2)      |                     |            |            |       |
+| Histological types Diffuse                                               | 437 (58.0)         | 541 (57.6)      |                     |            |            |       |
+| Intestinal                                                               | 316 (42.0)         | 399 (42.4)      |                     |            |            |       |
+| Depth of invasiony T1                                                    | 130 (17.3)         | 148 (15.7)      |                     |            |            |       |
+| T2                                                                       | 130 (17.3)         | 200 (21.3)      |                     |            |            |       |
+| T3                                                                       | 381 (50.6)         | 545 (58.0)      |                     |            |            |       |
+| T4                                                                       | 112 (14.8)         | 45 (4.8)        |                     |            |            |       |
+| Lymph node metastasis N0 297 (39.4)                                      | 374 (39.8)         |                 |                     |            |            |       |
+| N1/N2/N3                                                                 | 456 (60.6)         | 566 (60.2)      |                     |            |            |       |
+| Distant metastasis M0                                                    | 655 (87.0)         | 882 (93.8)      |                     |            |            |       |
+| M1                                                                       | 98 (13.0)          | 58 (6.2)        |                     |            |            |       |
+| TNM stages I                                                             | 202 (26.8)         | 261 (27.8)      |                     |            |            |       |
+| II                                                                       | 165 (21.9)         | 186 (19.8)      |                     |            |            |       |
+| III                                                                      | 266 (35.3)         | 396 (42.1)      |                     |            |            |       |
+| IV                                                                       | 120 (16.0)         | 97 (10.3)       |                     |            |            |       |
+| TNM ¼ tumor node metastasis.  Two-sided x2 test for the frequency distributions of selected variables. y Information of depth of invasion was not available for 2 patients in the validation set.                                                                          |                    |                 |                     |            |            |       |
+
+washed with Phosphate Buffered Saline and lysed with 1 passive lysis buffer. Luciferase activity was determined with a dual luciferase report assay system (Promega) following the manufacturer's protocol.
+
+detected by Student t test or x2 test. Unconditional univariate and multivariate logistic regression analyses were done to estimate adjusted odds ratios (ORs) and 95% confidence intervals (95% CIs), which were used to evaluate the importance of genetic variants in different clinical features of GC.
+
+## Electrophoretic Mobility Shift Assay (Emsa)
+
+SGC-7901 cells (2–4  106) were collected to prepare nuclear extracts by the NE-PER kit (Pierce; Rockford, IL). Biotin-labeled oligonucleotides probes were annealed at 50 fmol. Reactions were applied onto 5% polyacrylamide gels, and then transferred to nylon membranes. Biotin-labeled DNA was detected by the LightShift Chemiluminescent EMSA Kit (Pierce).
+
+## Statistical Analysis
+
+In this study, statistical analyses were performed by SAS
+software (version 9.13; SAS Institute Inc, Cary, NC). All P values were 2-sided with P < 0.05. Goodness-of-fit x2 test was used to test for each SNP in control subjects to meet the Hardy–Weinberg equilibrium (HWE). Differences in the distributions of demographic characteristics, selected variables, and frequencies of genotypes between cases and controls were
+
+## Results Expression Of Mir-196A In Gastric Tumor And Adjacent Normal Tissues
+
+MiR-196a expression levels were detected in 66 new diagnostic gastric tumor and adjacent normal tissue samples, which were chosen to keep the same genetic background. As shown in Figure 1, the average miR-196a level in tumor tissues was significantly higher than that in adjacent normal tissues (53.89 - 3.991 vs 22.68 - 2.568, P < 0.001).
+
+## Identification Of Snps In Mir196A2 Gene Promoter Region
+
+With regard to higher levels of miR-196a in GC tissues, we attempted to investigate the regulatory mechanism of miR-196a-2 expression. After screening the promoter region
+
+![3_image_0.png](3_image_0.png)
+
+of MIR196A2 gene with SNP database (http://www.ncbi.nlm. nih.gov/snp), 2 SNPs within MIR196A2 gene reveal their presence in Chinese population with MAF >5%, named rs12304647 A>C and rs35010275 G>C (Figure 2A).
+
+## Effects Of Snps In Mir196A2 Promoter Region On Gene Transcriptional Regulation
+
+To identify whether these 2 variations have influence on the transcription activity of MIR196A2, we constructed fulllength luciferase reporter plasmid and its variants by using pGL3-basic vector, named pGL3–1000 wt, 1000mt1, 1000mt2, and 1000mt3, which were transfected into SGC-7901 and normal GES-1. As shown in Figure 2B, comparing with pGL3-1000 wt and pGL3-1000mt1, the transcription activity of pGL3-1000mt2 and pGL3-1000mt3 were significantly lower in SGC-7901 and GES-1, which suggested these SNPs in MIR196A2 promoter region took effect on its transcription. To further confirm the individual functions of rs12304647 and rs35010275, 3 plasmids containing shorter MIR196A promoter regions (pGL3-700 wt, 700mt, and 500) were transfected in SGC-7901 cell line. All of these reporter plasmid assays displayed higher luciferase activities than pGL3-basic vector.
+
+pGL3-1000 wt and pGL3-1000mt1 showed significant increases in promoter activity than pGL3-700 wt and pGL3700mt1. However, opposite trends displayed in pGL3-1000mt2 and pGL3-1000mt3 (Figure 2C). These results suggested that different allele of rs35010275 might possess different function in miR-196a expression.
+
+Based on the above results, we further investigated potential regulatory role of rs35010275 G>C. EMSA was performed with probes carrying the SNP major (G) or minor (C) allele.
+
+![3_image_1.png](3_image_1.png)
+
+Proteins or protein complexes binding to G-probe have larger molecular weight than those bind to C-probe, suggesting that they might be different (Figure 2D). Through competition assays between G and C-probes, it was obvious that both of the protein complexes displayed less intense bands as the decreasing concentration of both probes. These results suggested that these different protein complexes might contain sequence-specific DNA-binding domain that could recognize different alleles of rs35010275.
+
+## Characteristics Of Gc Patients And Controls
+
+The frequency distributions of cases and controls in 2 stages are summarized in Table 1. The cases and controls appeared to be adequately matched on age (P ¼ 0.424 and 0.343) and sex (P ¼ 0.406 and 0.546). In testing set, 26.8%, 21.9%, 35.3%, and 16.0% of patients were in stage I, II, III, and IV disease, respectively, whereas, 27.8%, 19.8%, 42.1%, and 10.3% of the patients in validation set were diagnosed in stage I, II, III, and IV, respectively.
+
+## Association Of Rs35010275 G>C Polymorphism With Mir-196A-2 Levels In Gc Tissues
+
+Next, we performed genotyping analysis for rs35010275 in above 66 patients' tissues from which we successfully obtained both genomic DNA and RNA. Data were showed as following: GG, 36 cases (54.6%); GC, 24 cases (36.3%); and CC, 6 cases (9.1%). As presented in Figure 3, patients carrying GG genotype had higher miR-196a-2 expression levels than those with GC or CC genotype in both cancer tissues (P ¼ 0.032 for GG vs GC and P ¼ 0.001 for GG vs CC) and adjacent normal tissues (P ¼ 0.048 for GG vs GC and P ¼ 0.049 for GG vs CC).
+
+## Overall Effects Of Mir196A2 Promoter Rs35010275 G>C On Risk Of Gc In 2-Stage Case–Control Studies
+
+We further performed a 2-stage case–control study to evaluate the overall associations between rs35010275 G>C
+polymorphism and GC risk. Genotype frequencies in the combined controls was conformed to HWE (x2¼ 0.885, P ¼ 0.347).
+
+As presented in Table 2, we found that GC/CC genotypes were associated with a significantly decreased risk of GC compared with GG genotype in both stage of the study (adjusted OR ¼ 0.82, 95% CI ¼ 0.67–0.99 in testing set and adjusted OR ¼ 0.82, 95% CI ¼ 0.68–0.97 in validation set). Moreover, with the expansion of samples in combined analysis, more significant protective effects displayed in GC, CC, and GC/ CC genotypes (adjusted OR ¼ 0.82, 95% CI ¼ 0.72–0.95 for GC; adjusted OR ¼ 0.76, 95% CI ¼ 0.59–0.99 for CC; adjusted OR ¼ 0.81, 95% CI ¼ 0.71–0.93 for GC/CC) compared to GG genotype. Simultaneously, difference between the subjects carrying C allele and G allele was observed in allele comparison with adjusted OR ¼ 0.85, 95% CI ¼ 0.73–1.00 in testing set, adjusted OR ¼ 0.85, 95% CI ¼ 0.74–0.98 in validation set, and adjusted OR ¼ 0.85, 95% CI ¼ 0.77–0.94 in combined set.
+
+## Associations Between Rs35010275 G>C Polymorphism And Clinical Features Of Gc
+
+Next, we evaluated the effects of rs35010275 G>C on the progression of GC by comparing the rs35010275 G>C polymorphism with different clinical features. As shown in Table 3, with polymorphism in genetic dominant model of combined analysis, GC/CC genotypes have a statistical significantly decreased risk of GC compared with wild homozygous GG genotype in patients with cardiac cancer (adjusted OR ¼ 0.71, 95% CI ¼ 0.59–0.85), diffuse type (0.85, 0.73–1.00), intestinal type (0.77, 0.64–0.92), T3 depth invasion (0.74, 0.63–0.87),
+
+Noncancerous tissue Cancerous tissue
+
+![4_image_1.png](4_image_1.png)
+
+![4_image_0.png](4_image_0.png)
+
+| TABLE 2. Genotype frequencies and overall effects of MIR196A2 rs35010275 G>C polymorphism on gastric cancer risk Testing set Validation set Combined set Cases/Controls (753/854) P Adjusted OR Cases/Controls (940/1061) P Adjusted OR Cases/Controls (1693/1915) P Adjusted OR (95% CI)y (95% CI)y (95% CI)y Genotypes GG 436/452 1.00 (ref.) 532/548 1.00 (ref.) 968/1000 1.00 (ref.) GC 264/331 0.069 0.82 (0.67-1.02) 348/432 0.043 0.83 (0.69-0.99) 612/763 0.006 0.82 (0.72-0.95) CC 53/71 0.179 0.77 (0.53-1.13) 60/81 0.119 0.75 (0.53-1.08) 113/152 0.040 0.76 (0.59-0.99) GC/CC 317/402 0.042 0.82 (0.67-0.99) 408/513 0.023 0.82 (0.68-0.97) 725/915 0.002 0.81 (0.71-0.93) G allele 1136/1235 1.00 (ref.) 1412/1528 1.00 (ref.) 2548/2763 1.00 (ref.) C allele 370/473 0.046 0.85 (0.73-1.00) 468/594 0.023 0.85 (0.74-0.98) 838/1067 0.002 0.85 (0.77-0.94) Ptrend 0.049 0.027 0.003   |
+|---|
+
+CI ¼ confidence interval, OR ¼ odds ratio.  Two-sided x2 test for genotype frequency distributions between cases and controls. yAdjusted for age and sex in logistic regression model.
+
+positive lymph node metastasis (0.73, 0.62–0.85), negative distant metastasis (0.82, 0.72–0.94), and advanced stage (0.72, 0.62–0.85).
+
+## Discussion
+
+In the present study, miR-196a acted as an oncogenic miRNA, which expressed significantly higher in cancerous tissues than in noncancerous tissues. Moreover, a notable SNP (rs35010275 G>C) in our study displayed potential transcript regulating function on MIR196A2 and was associated with the susceptibility of GC in the Chinese population. These findings suggested that MIR196A2 rs35010275 G>C might be regarded as a potential biomarker for GC prediction.
+
+It has been reported that the miR-196a may display different effects as an oncogenic miRNA in the pathology of
+
+| dominant model Variables         | Testing set   | Validation set        | Combined set     |             |                       |                  |         |                       |                  |
+|----------------------------------|---------------|-----------------------|------------------|-------------|-----------------------|------------------|---------|-----------------------|------------------|
+| GG/(GC/CC)                       | P               | Adjusted OR (95% CI)y | GG/(GC/CC)       | P             | Adjusted OR (95% CI)y | GG/(GC/CC)       | P         | Adjusted OR (95% CI)y |                  |
+| Controls Total                   | 452/402       | 1.00 (ref.)           | 548/513          | 1.00 (ref.) | 1000/915              | 1.00 (ref.)      |         |                       |                  |
+| Cases Tumor sites Cardia         | 184/111       | 0.005                 | 0.68 (0.52-0.89) | 188/130     | 0.015                 | 0.73 (0.56-0.94) | 372/241 | <0.001                | 0.71 (0.59-0.85) |
+| Non-cardia                       | 252/206       | 0.400                 | 0.91 (0.72-1.14) | 344/278     | 0.136                 | 0.86 (0.70-1.05) | 596/484 | 0.096                 | 0.88 (0.76-1.02) |
+| Histological types Diffuse       | 250/187       | 0.148                 | 0.84 (0.67-1.06) | 299/242     | 0.157                 | 0.86 (0.70-1.06) | 549/429 | 0.043                 | 0.85 (0.73-1.00) |
+| Intestinal                       | 186/130       | 0.065                 | 0.78 (0.60-1.02) | 233/166     | 0.020                 | 0.76 (0.60-0.96) | 419/296 | 0.003                 | 0.77 (0.64-0.92) |
+| Depth of invasionz T1            | 72/58         | 0.560                 | 0.90 (0.62-1.30) | 80/68       | 0.685                 | 0.93 (0.66-1.31) | 152/126 | 0.482                 | 0.91 (0.71-1.18) |
+| T2                               | 69/61         | 0.992                 | 1.00 (0.69-1.44) | 107/93      | 0.696                 | 0.94 (0.70-1.27) | 176/154 | 0.782                 | 0.97 (0.77-1.22) |
+| T3                               | 231/150       | 0.010                 | 0.72 (0.56-0.92) | 319/226     | 0.009                 | 0.76 (0.62-0.93) | 550/376 | <0.001                | 0.74 (0.63-0.87) |
+| T4                               | 64/48         | 0.369                 | 0.83 (0.56-1.24) | 26/19       | 0.635                 | 0.87 (0.48-1.56) | 90/67   | 0.291                 | 0.84 (0.60-1.16) |
+| Lymph node metastasis N0 161/136 | 0.684         | 0.95 (0.73-1.23)      | 195/179          | 0.829       | 0.97 (0.77-1.23)      | 356/315          | 0.664   | 0.96 (0.81-1.15)      |                  |
+| N1/N2/N3                         | 275/181       | 0.009                 | 0.74 (0.58-0.93) | 337/229     | 0.002                 | 0.72 (0.59-0.89) | 612/410 | <0.001                | 0.73 (0.62-0.85) |
+| Distant metastasis M0            | 382/273       | 0.034                 | 0.80 (0.65-0.98) | 493/389     | 0.053                 | 0.84 (0.70-1.00) | 875/662 | 0.004                 | 0.82 (0.72-0.94) |
+| M1                               | 54/44         | 0.635                 | 0.90 (0.59-1.38) | 39/19       | 0.027                 | 0.53 (0.30-0.93) | 93/63   | 0.079                 | 0.74 (0.53-1.04) |
+| TNM stages IþII                  | 203/164       | 0.429                 | 0.90 (0.71-1.16) | 237/210     | 0.546                 | 0.93 (0.75-1.17) | 440/374 | 0.330                 | 0.92 (0.78-1.09) |
+| IIIþIV                           | 233/153       | 0.013                 | 0.73 (0.57-0.94) | 295/198     | 0.003                 | 0.72 (0.58-0.89) | 528/351 | <0.001                | 0.72 (0.62-0.85) |
+
+CI ¼ confidence interval, OR ¼ odds ratio, TNM ¼ tumor node metastasis.  Two-sided x2 test for the frequency distributions of selected variables between cases and controls. yAdjusted for age and sex in logistic regression model.
+
+zInformation was not available for 2 patients in validation set and combined set.
+
+GC, after quantitatively assessing the levels of miR-196a in patients.16,30 Our study also confirmed that miR-196a unduly existed in GC tissues, which were consistent with the results reported by Sun et al.40 Besides, the genotyping of the 66 patients also manifested that patients carrying rs35010275 C allele were correlated with lower expression level of miR-196a in both tumor and normal tissues. These evidences suggested that the increase of miR-196a expression in rs35010275 GG genotype was a crucial event in gastric carcinogenesis; while some other transcriptional or post-transcriptional mechanism might exist in normal tissues to protect the abnormal expression of miR-196a.
+
+It was proposed that various genomic and epigenomic mechanisms were involved in dysregulation of miRNA genes in cancers. The study by Croce41 had concretely demonstrated these different causes such as deletions, amplifications, mutations, epigenetic silencing, and even the aberrant expression of transcription factors targeting miRNAs. To date, compared with thorough disclosure of miR-196a functions, the culprits of abnormal expression of miR-196a have been involved seldom. Derived from 2 different loci, nominated MIR196A1 and MIR196A2 gene, detailed mechanism of miR-196a expression may be diverse and complicated. With regard to affecting the mature process of miR-196a-2 transcription,23,42,43 rs11614913 SNP was one exploration raising the concerns of researchers.20,42,44,45 Recent studies have identified this polymorphism as a risk factor for several diseases, including hepatocellular carcinoma,20 leukemia,46 lung cancer,22,23 breast cancer,44,47 colorectal cancer,32 and pancreatic adenocarcinoma.48,49 Apart from MIR196A1, MIR196A2 possesses its own promoter in structure, in which the variations might also alter miR-196a expression and then influence the susceptibility of GC. In this study, we identified 2 SNPs (rs12304647 A>C and rs35010275 G>C) in MIR196A2 promoter region of 1000 bp away from the transcription starting site. Taken functional analyses together, these observations supported the idea that MIR196A2 rs35010275 G>C resulted in different recruits of transcription factors or complexes to MIR196A2 gene promoter region, which modulated the miR-196a expression. To our knowledge, this is the first study providing direct evidence that MIR196A2 promoter polymorphism may influence individuals' susceptibility to GC through affecting miRNA
+biogenesis.
+
+MiRNAs potentially display their distinct effects in various biologic processes via influencing their target genes. As dysregulation of miR-196a may contribute to tumor detachment, migration, invasion, and proliferation13,16,32,40,50,51 through regulating its fundamental target genes, it is biologically plausible that rs35010275 G>C influence the development of GC. Our 2-stage epidemiological study indicated that rs35010275 C allele displayed protective effect on GC with T3 depth of invasion, positive lymph node metastasis, negative distant metastasis, and advanced TNM stage. Therefore, MIR196A2 may participate in the invasion and migration pathways of gastric carcinogenesis, and rs35010275 C allele may act as a repressor in hazardous biological processes. In previous studies, the members of homeobox Gene (HOX) family15,50,52 and annexin A113,53 have been reported as target genes of miR-196a in vivo. Schimanski et al32 identified that through regulating HOX family genes, miR-196a could activate the v-akt murine thymoma viral oncogene (AKT) signaling pathway by increasing phosphorylation of AKT. These results suggested that MIR196A2 rs35010275 could trigger the expression of miR-196a and finally induce the AKT pathway to influence susceptibility and processes of gastric carcinogenesis.
+
+Considering rs35010275 G>C as an molecular biomarker to predict individuals' susceptibility to GC, our study also showed that the protective effects of rs35010275 C allele were more predominant in cardia patients (adjust OR ¼ 0.71, 95% CI ¼ 0.59–0.85, P < 0.001) and stages III and VI patients
+(adjust OR ¼ 0.72, 95% CI ¼ 0.62–0.85, P < 0.001), suggesting that there exists associations of rs35010275 G>C with tumor site and advanced TNM stage. Further investigation to validate this association is necessary, and it would be interesting to clarify whether the carcinogenesis mechanism in cancer with low TNM stage might be distinct from that in cancer with advanced TNM stage. Besides, MIR196A2 rs35010275 G>C might majorly take its contribution on precluding the onset of cancer in cardia.
+
+Several limitations exist in our study. First, small sample size may limit the statistical power of our study, especially for subgroup analyses. Second, our study was retrospective hospital-based case–control studies; the inherent selection bias and information bias were unavoidable. Under this circumstance, we applied a rigorous epidemiological design in selecting study subjects and conducted statistical adjustment for known risk factors to minimize the potential biases. Finally, our study lacks some information on GC risk factors, such as Helicobacter pylori infection status, diet habit, tobacco smoking, and alcohol consumption status. Therefore, our results need to be validated in population-based studies with larger sample size and more detailed information.
+
+In conclusion, our study revealed that miR-196a was dysregulated in GC. Moreover, a functional SNP rs35010275 G>C in the promoter region of MIR196A2 gene was significantly associated with miR-196a-2 expression. Further insights into functional and clinical investigation of MIR196A2 gene may contribute to the diagnosis and prognosis of GC.
+
+ACKNOWLEDGMENT
+The authors would like to appreciate the technical help of Biolight Tech Company, Nanjing, China.
+
+## References
+
+1. Danaei G, Vander Hoorn S, Lopez AD, et al. Causes of cancer in the world: comparative risk assessment of nine behavioural and environmental risk factors. Lancet. 2005;366:1784–1793.
+
+2. Ferlay J, Shin HR, Bray F, et al. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010;127:2893–
+2917.
+
+3. Ajani JA. Optimizing docetaxel chemotherapy in patients with cancer of the gastric and gastroesophageal junction: evolution of the docetaxel, cisplatin, and 5-fluorouracil regimen. Cancer.
+
+2008;113:945–955.
+
+4. Yoong J, Michael M, Leong T. Targeted therapies for gastric cancer:
+current status. Drugs. 2011;71:1367–1384.
+
+5. Field K, Michael M, Leong T. Locally advanced and metastatic gastric cancer: current management and new treatment developments. Drugs. 2008;68:299–317.
+
+6. Matsusaka K, Kaneda A, Nagae G, et al. Classification of EpsteinBarr virus-positive gastric cancers by definition of DNA methylation epigenotypes. Cancer Res. 2011;71:7187–7197.
+
+7. Rusiecki JA, Al-Nabhani M, Tarantini L, et al. Global DNA
+methylation and tumor suppressor gene promoter methylation and gastric cancer risk in an Omani Arab population. Epigenomics.
+
+2011;3:417–429.
+8. Xu L, Li X, Chu ES, et al. Epigenetic inactivation of BCL6B, a novel functional tumour suppressor for gastric cancer, is associated with poor survival. Gut. 2012;61:977–985.
+
+9. Li X, Zhang Y, Ding J, et al. Survival prediction of gastric cancer by a seven-microRNA signature. Gut. 2010;59:579–585.
+
+10. Gao C, Zhang Z, Liu W, et al. Reduced microRNA-218 expression is associated with high nuclear factor kappa B activation in gastric cancer. Cancer. 2010;116:41–49.
+
+11. Craig VJ, Cogliatti SB, Rehrauer H, et al. Epigenetic silencing of microRNA-203 dysregulates ABL1 expression and drives Helicobacter-associated gastric lymphomagenesis. Cancer Res. 2011;71:3616–
+3624.
+
+12. Ambros V. The functions of animal microRNAs. Nature.
+
+2004;431:350–355.
+
+13. Luthra R, Singh RR, Luthra MG, et al. MicroRNA-196a targets annexin A1: a microRNA-mediated mechanism of annexin A1 downregulation in cancers. Oncogene. 2008;27:6667–6678.
+
+14. Mansfield JH, Harfe BD, Nissen R, et al. MicroRNA-responsive
+''sensor'' transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression. Nat Genet.
+
+2004;36:1079–1083.
+
+15. Niinuma T, Suzuki H, Nojima M, et al. Upregulation of miR-196a and HOTAIR drive malignant character in gastrointestinal stromal tumors. Cancer Res. 2012;72:1126–1136.
+
+16. Tsai KW, Liao YL, Wu CW, et al. Aberrant expression of miR-196a in gastric cancers and correlation with recurrence. Genes, Chromosomes Cancer. 2012;51:394–401.
+
+17. Lung RW, Wang X, Tong JH, et al. A single nucleotide polymorphism in microRNA-146a is associated with the risk for nasopharyngeal carcinoma. Mol Carcinog. 2013;52:E28–E38.
+
+18. Smith RA, Jedlinski DJ, Gabrovska PN, et al. A genetic variant located in miR-423 is associated with reduced breast cancer risk.
+
+Cancer Genomics Proteomics. 2012;9:115–118.
+
+19. Zhang M, Jin M, Yu Y, et al. Associations of miRNA polymorphisms and female physiological characteristics with breast cancer risk in Chinese population. Eur J Cancer Care. 2012;21:274–280.
+
+20. Li XD, Li ZG, Song XX, et al. A variant in microRNA-196a2 is associated with susceptibility to hepatocellular carcinoma in Chinese patients with cirrhosis. Pathology. 2010;42:669–673.
+
+21. Xu Y, Liu L, Liu J, et al. A potentially functional polymorphism in the promoter region of miR-34b/c is associated with an increased risk for primary hepatocellular carcinoma. Int J Cancer.
+
+2011;128:412–417.
+
+22. Hu Z, Chen J, Tian T, et al. Genetic variants of miRNA sequences and non-small cell lung cancer survival. J Clin Investig.
+
+2008;118:2600–2608.
+
+23. Tian T, Shu Y, Chen J, et al. A functional genetic variant in microRNA-196a2 is associated with increased susceptibility of lung cancer in Chinese. Cancer Epidemiol, Biomarkers Prevention.
+
+2009;18:1183–1187.
+
+24. Christensen BC, Avissar-Whiting M, Ouellet LG, et al. Mature microRNA sequence polymorphism in MIR196A2 is associated with risk and prognosis of head and neck cancer. Clin Cancer Res.
+
+2010;16:3713–3720.
+
+25. Mu YP, Su XL. Polymorphism in pre-miR-30c contributes to gastric cancer risk in a Chinese population. Med Oncol. 2012;29:1723–
+1732.
+
+26. Kogo R, Mimori K, Tanaka F, et al. Clinical significance of miR146a in gastric cancer cases. Clin Cancer Res. 2011;17:4277–4284.
+
+27. Wang S, Tao G, Wu D, et al. A functional polymorphism in MIR196A2 is associated with risk and prognosis of gastric cancer.
+
+Mol Carcinog. 2013;52(Suppl 1):E87–E95.
+
+28. Okubo M, Tahara T, Shibata T, et al. Association between common genetic variants in pre-microRNAs and gastric cancer risk in Japanese population. Helicobacter. 2010;15:524–531.
+
+29. Peng S, Kuang Z, Sheng C, et al. Association of microRNA-196a-2 gene polymorphism with gastric cancer risk in a Chinese population.
+
+Dig Dis Sci. 2010;55:2288–2293.
+
+30. Inoue T, Iinuma H, Ogawa E, et al. Clinicopathological and prognostic significance of microRNA-107 and its relationship to DICER1 mRNA expression in gastric cancer. Oncol Rep.
+
+2012;27:1759–1764.
+
+31. Ahmed FE, Ahmed NC, Vos PW, et al. Diagnostic microRNA
+markers to screen for sporadic human colon cancer in stool: I. Proof of principle. Cancer Genomics Proteomics. 2013;10:93–113.
+
+32. Schimanski CC, Frerichs K, Rahman F, et al. High miR-196a levels promote the oncogenic phenotype of colorectal cancer cells. World J
+Gastroenterol. 2009;15:2089–2096.
+
+33. Liu G, Gramling S, Munoz D, et al. Two novel BRM insertion promoter sequence variants are associated with loss of BRM
+expression and lung cancer risk. Oncogene. 2011;30:3295–3304.
+
+34. Hao B, Miao X, Li Y, et al. A novel T-77C polymorphism in DNA
+repair gene XRCC1 contributes to diminished promoter activity and increased risk of non-small cell lung cancer. Oncogene.
+
+2006;25:3613–3620.
+
+35. Wang M, Yuan L, Wu D, et al. A novel XPF 357A>C polymorphism predicts risk and recurrence of bladder cancer. Oncogene.
+
+2010;29:1920–1928.
+
+36. Ozsolak F, Poling LL, Wang Z, et al. Chromatin structure analyses identify miRNA promoters. Genes Dev. 2008;22:3172–3183.
+
+37. Wang M, Bai J, Tan Y, et al. Genetic variant in PSCA predicts survival of diffuse-type gastric cancer in a Chinese population. Int J
+Cancer. 2011;129:1207–1213.
+
+38. Lauren P. The two histological main types of gastric carcinoma:
+diffuse and so-called intestinal-type carcinoma. An attempt at a histo-clinical classification. Acta Pathologica Microbiologica Scandinavica. 1965;64:31–49.
+
+39. Green FL, Page DL, Fleming ID, et al. Stomach of the digestive system. AJCC Cancer Staging Handbook. 6th ed. New York:
+Springer Press; 2002:111–118.
+
+40. Sun M, Liu XH, Li JH, et al. MiR-196a is upregulated in gastric cancer and promotes cell proliferation by downregulating p27(kip1). Mol Cancer Therap. 2012;11:842–852.
+
+41. Croce CM. Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet. 2009;10:704–714.
+
+42. Xu J, Hu Z, Xu Z, et al. Functional variant in microRNA-196a2 contributes to the susceptibility of congenital heart disease in a Chinese population. Hum Mutat. 2009;30:1231–1236.
+
+43. Hu Z, Liang J, Wang Z, et al. Common genetic variants in premicroRNAs were associated with increased risk of breast cancer in Chinese women. Hum Mutat. 2009;30:79–84.
+
+44. Hoffman AE, Zheng T, Yi C, et al. MicroRNA miR-196a-2 and breast cancer: a genetic and epigenetic association study and functional analysis. Cancer Res. 2009;69:5970–5977.
+
+45. Catucci I, Yang R, Verderio P, et al. Evaluation of SNPs in miR146a, miR196a2 and miR-499 as low-penetrance alleles in German and Italian familial breast cancer cases. Hum Mutat. 2010;31:E1052–
+E1057.
+
+46. Coskun E, von der Heide EK, Schlee C, et al. The role of microRNA-196a and microRNA-196b as ERG regulators in acute myeloid leukemia and acute T-lymphoblastic leukemia. Leuk Res.
+
+2011;35:208–213.
+
+47. Hui AB, Shi W, Boutros PC, et al. Robust global micro-RNA
+profiling with formalin-fixed paraffin-embedded breast cancer tissues. Lab Investig. 2009;89:597–606.
+
+48. Kong X, Du Y, Wang G, et al. Detection of differentially expressed microRNAs in serum of pancreatic ductal adenocarcinoma patients:
+miR-196a could be a potential marker for poor prognosis. Dig Dis Sci. 2011;56:602–609.
+
+49. Szafranska-Schwarzbach AE, Adai AT, Lee LS, et al. Development of a miRNA-based diagnostic assay for pancreatic ductal adenocarcinoma. Expert Rev Mol Diagn. 2011;11:249–257.
+
+50. Braig S, Mueller DW, Rothhammer T, et al. MicroRNA miR-196a is a central regulator of HOX-B7 and BMP4 expression in malignant melanoma. Cell Mol Life Sci. 2010;67:3535–3548.
+
+51. Kim YJ, Bae SW, Yu SS, et al. MiR-196a regulates proliferation and osteogenic differentiation in mesenchymal stem cells derived from human adipose tissue. J Bone Miner Res. 2009;24:816–825.
+
+52. Mueller DW, Bosserhoff AK. MicroRNA miR-196a controls melanoma-associated genes by regulating HOX-C8 expression. Int J
+Cancer. 2011;129:1064–1074.
+
+53. Kan T, Meltzer SJ. MicroRNAs in Barrett's esophagus and esophageal adenocarcinoma. Curr Opin Pharmacol. 2009;9:727–732.

medical/md/PMC4959930.md

@@ -0,0 +1,178 @@
+
+## Esmo/Asco Recommendations For A Global Curriculum (Gc) In Medical Oncology—Edition 2016
+
+Oncology is driven by an exponentially increasing complexity.
+
+As an example, the use of molecular profiling or the determination of molecularly based biomarkers for the selection of the appropriate targeted therapy has now become routine in clinical practice. Such developments must be covered during education and integrated at all levels, from basic medical oncology at the initial postgraduate level to advanced levels requiring specialised approaches at the level of continuing medical education [1].
+
+Consequently, and in line with the internationalisation of healthcare in general and higher mobility of physicians and patients, the European Society for Medical Oncology (ESMO) and the American Society of Clinical Oncology (ASCO) have identified the need for a set of international recommendations for the clinical training of physicians that define the standard of qualifications, i.e. to specify the requirements to be fulfilled to qualify them as medical oncologists. Adherence to the Global Curriculum (GC) is to ensure that patients, wherever they live, have an equal chance of receiving treatment from well-trained physicians respecting multidisciplinarity, to which both ESMO and ASCO are strongly committed.
+
+The fundamental pillar is a common requirement of 5 years of training. This training period includes a minimum of 2 years in internal medicine followed by a minimum of 2 years of medical oncology. Also within these 5 years, half a year may be dedicated to clinical research that should create the basis for trainees' critical assessment and their continuous internalisation of new developments in the field.
+
+In 2011, the European Commission based its formal recognition of medical oncology on the recommendations made by the ESMO/ASCO GC Task Force. Thus, medical oncology has been included among the medical specialities covered by the Directive 2005/36/EC on the recognition of professional qualifications [2, 3]. The fact that the European Commission accepted the requirement of a minimum of 5 years of specialisation led many countries to adopt a 5-year period for training in medical oncology.
+
+The training requirements detailed in the GC apply to professionals across the globe and reinforce the position of ESMO and ASCO as leading organisations for oncology [4, 5]. The GC 2016 is a visible sign that these two societies, who cooperatively prepared this edition, are simultaneously advocating for and acting as reliable sources of education in medical oncology and encouraging a multidisciplinary approach to cancer care.
+
+## Background
+
+Medical oncology as a speciality was established in 1965, after ASCO was founded in the United States in 1964. A uniform system of training in medical oncology in the United States was formulated by the American Board of Internal Medicine in 1973 [6]. In 1998, ASCO published a training resource document for development of a curriculum in medical oncology [7].
+
+In 1989, ESMO started an examination programme in medical oncology for physicians actively working in the field. To guarantee the maintenance and updating of the knowledge, skills, and attitudes of these physicians, that is essential to the provision of quality care, a programme of continued education in medical oncology, the ESMO Medical Oncologist's Recertification Approval
+(MORA) programme, was introduced in 1994 [8].
+
+Both ESMO and ASCO support ongoing professional development in medical oncology as part of their missions. As the leading oncology professional societies worldwide, visible by the significant number of international members and attendees at their meetings, and due to the increasingly global nature of cancer care and the increased international interest in the field, a GC was perceived by both societies as an important joint project. Since 2002, ESMO and ASCO have been working together to develop common recommendations for training in medical oncology to overcome barriers in the quality of care.
+
+## Gc: Editions 2004 And 2010
+
+In 2004, a joint ESMO/ASCO GC Task Force established the first Global Core Curriculum outline for training in medical oncology.
+
+This outline was distributed to universities and medical oncology societies and was simultaneously published in the Annals of Oncology and the Journal of Clinical Oncology [9, 10].
+
+Interest in using the Global Core Curriculum outline has increased considerably since its inception, as shown by the availability of translations into a range of different languages available on the ESMO and ASCO websites [11, 12]. It was also used as a model for development of the speciality of medical oncology in several countries around the world. Additionally, a LogBook was launched as a support tool for medical oncologists in training with the purpose of keeping a record of oncology trainees' educational programmes and their progress and providing supervisors with a tool to assess performance [13, 14]. The GC was updated in 2010, and the Log-Book has been updated by the GC Working Group (WG), a group that evolved from the previous Task Force, to reflect continuous commitment to education of trainees in medical oncology [15–18].
+
+The 2010 edition presented a broad range of recommendations to be adopted by national educational and healthcare authorities and to be implemented according to the resources and conditions of each country. The GC WG recognised that the diversity of health and educational systems around the world may have rendered some curriculum recommendations aspirational at the stage of its implementation, even for those systems with well-developed training programmes in medical oncology, but that were, nevertheless, worth pursuing further.
+
+The intention of the propagation of a GC was and is to identify and reduce the degree of heterogeneity of the medical content and also, at the organisational level, the duration and structure of the internal medicine part of the training in medical oncology in Europe [19]. According to data assessed by the ESMO/ASCO GC European landscape survey on the evolution of medical oncology training in Europe, medical oncology is recognised as a separate speciality in 23 countries. The GC recommendations were adopted in nine countries, adapted in seven countries, and this process was ongoing in two other countries [19].
+
+## Logistic Development
+
+The 2004 edition of the GC was drafted by the chair and the respective members of the GC Task Force. The system of learning outcomes based on awareness, knowledge, and competence was developed only in the accompanying Log-Book [13, 14].
+
+The updated 2010 edition of the GC was drafted by several oncologists upon invitation from the GC Task Force. This edition was reviewed by a panel of experts from both societies.
+
+The use of a categorisation of awareness, knowledge, and competence was restricted to the Log-Book.
+
+Planning for the 2016 edition of the GC started in May 2015, first by the GC WG and later on, an ad hoc editorial board, which was composed of GC WG representatives from both ESMO and ASCO, was responsible for further selection of the topics and the authors of the respective contributions. All contributions underwent extensive anonymised expert review.
+
+## Gc 2016: Changes In Form And Content
+
+The major change in the 2016 edition consists of the adoption of acknowledged pedagogical principles. This resulted in a template-based format for the learning objectives, wherever appropriate. Thus, the qualities of the learning objectives have been divided into the subcategories of awareness, knowledge, and skills. This holds true primarily for the training in the different tumour entities, and, where possible, the more general teaching items are also subjected to this new format to a large extent.
+
+In recent years, important advances in medical oncology have been achieved. The unequivocal demands of personalised or precision medicine on the one side and of completely different developments, like the perpetually increasing survivorship community, on the other side—to mention just two examples of recent changes in oncology—have led to the development of the GC 2016 edition [20]. With regard to content, multiple changes and innovations were integrated, such as:
+
+- targeted therapies have been integrated into the (sub)chapters of the separate tumour entities, wherever suitable, to match the clinical reality;
+- immunotherapy is presented in a separate chapter to reflect its actual impact;
+- biological therapy and immunotherapy are now presented as separate chapters;
+- pathology, molecular pathology, laboratory medicine, translational research, and principles of personalised cancer medicine, which all previously belonged to the subsection 'Basic principles in the management and treatment of malignant diseases', have been transformed into separate chapters due to their importance, accepting some unavoidable overlap;
+- clinical research and statistics have been split into separate chapters under 'Basic scientific principles';
+- tumour immunology has been separated into 'Tumour immunology', which has been kept under 'Basic scientific principles', and into 'Immunotherapy', which has been moved as a separate chapter to 'Therapy';
+- imaging and molecular imaging have been separated into two chapters and are followed by an additional chapter on
+'RECIST';
+- rare cancers have been established as a novel subsection; - cancer treatment in patients with comorbidities is dealt with in a new subsection;
+- genetic counselling is given increased attention as a separate section due to its emerging role in routine clinical practice;
+- survivorship, with its tremendously increasing impact, is also now presented in a separate section.
+
+With regard to culturally sensitive contents, like supportive measures, palliative care, end-of-life-care, geriatric oncology, psychosocial aspects of cancer, patient education, survivorship, as well as bioethical, legal, and economic issues, positions were reserved to be filled by representatives from both societies. In particular, these authors were asked to take into account the global nature of the curriculum.
+
+Altogether, the GC 2016 consists of 12 sections comprising 17 subsections, 44 chapters, and 35 subchapters, provided by 96 different authors, among them 64 primarily ESMO-related and 32 primarily ASCO-related.
+
+## Next Steps Of Deployment For Esmo And Asco
+
+The GC 2016 will be released at the next annual ESMO Congress 2016 in Copenhagen, and a corresponding Log-Book will be released in 2017 [11, 12].
+
+The target population of the GC is primarily university teaching staff, mentors of medical oncology training programmes, and young medical oncologists in training. The GC WG intends to work closely with the respective national medical oncology societies via the ESMO national representatives and to seek their endorsement of the GC 2016. In addition, ESMO and ASCO
+also invite practising oncologists and clinicians, and even national health authorities and politicians, to become familiar with the 2016 edition. The so-called 'implementation symposia' will serve to efficiently implement the GC 2016 in the various oncologic communities.
+
+To assess the impact of the GC 2016 on the training landscape in medical oncology—this time not restricted to Europe [19]—
+the GC WG has envisaged performing a global GC landscape survey therewith monitoring its actual baseline status, i.e. the status before implementation of the GC 2016.
+
+## Future Outlook
+
+The development and registration of increasingly expensive drugs force all national economies to develop a cost-effective use of these cancer drugs. Both societies have presented their positions regarding a rational approach to deal with an economic attitude versus options for cancer treatment [21, 22]. This reflects in a very concrete way what is described as the shift of the old social contract of the Harrison-era that emphasised patient care to the new social contract in our actual managed-care era that emphasises cost containment and efficiency [23, 24]. Awareness and detailed, up-to-date knowledge of this additional dimension of cancer care also need to be included in future medical oncology education to guarantee sustainable cancer care, as already required in the corresponding subchapter on economic issues of new cancer drugs in the GC 2016 [1].
+
+This leads to an altered view of medical education, not only as far as the content is concerned but also regarding the teaching and assessment strategies. Both content and trustworthy professional activities are meticulously assigned to the specified learning outcome categories [25, 26].
+
+After having carried out the major step of harmonisation of the learning requirements to qualify as a medical oncologist, the GC WG is endorsing the next logical step of harmonising the teaching and assessment strategies.
+
+A plethora of learning mechanisms and instruments exists, including Internet-based tools such as YouTube videos or the iTune U educational app, comprised of a variety of products with partly complementary and partly overlapping content. The GC WG will have to select adequate teaching material covering all content required by the GC and to be aware of new areas which should be covered in a timely manner by its carrier societies. Although going beyond the main mission of the GC WG,
+both societies take care of leaders generation programmes to complement those skills not necessarily being covered by the GC, such as managerial skills. With the corresponding LogBook, a harmonised instrument for assessment will be provided soon. In order to also react appropriately in this area to the internationalisation on the one side and increasing specialisation on the other, a compilation of subdivided assessments carried out at dislocated teaching settings (e.g. accredited courses on specific topics) and via different accredited teaching providers may be considered as a strategy.
+
+Due to a broadened perspective of the GC WG, it will embark on initiatives in geographical areas of future interest for the societies to contribute to harmonisation of the training in medical oncology worldwide.
+
+C. Dittrich1,2*, M. Kosty3, S. Jezdic4, D. Pyle5, R. Berardi6, J. Bergh7, N. El Saghir8, J.-P. Lotz9, P. Österlund10, N. Pavlidis11 & G. Purkalne12, for the ESMO/ASCO Global Curriculum Working Group 1Centre for Oncology and Haematology, Kaiser Franz JosefSpital, Vienna; 2Applied Cancer Research-Institution for Translational Research, Vienna, Austria; 3Scripps Clinic, La Jolla, USA; 4European Society for Medical Oncology
+(ESMO), Lugano, Switzerland; 5American Society of Clinical Oncology (ASCO), Alexandria, USA; 6Clinica di Oncologia Medica, A.O.U Ospedali Riuniti Università Politecnica delle Marche, Ancona, Italy; 7Department of Oncology–
+Pathology, Radiumhemmet, Karolinska Institutet and University Hospital, Stockholm, Sweden; 8Department of Internal Medicine, NK Basile Cancer Institute, American University of Beirut Medical Center, Beirut, Lebanon; 9Department of Medical Oncology, APHP, Tenon Hospital, IUC-UPMC, Sorbonne University, Paris, France; 10Department of Oncology, HUCH Helsinki University Central Hospital, Helsinki, Finland; 11Department of Medical Oncology, University of Ioannina, Ioannina, Greece; 12Clinic of Oncology, Pauls Stradins Clinical University Hospital, Riga, Latvia
+(*E-mail: education@esmo.org)
+
+## Acknowledgements
+
+The authors wish to thank the following medical oncologists for their invaluable contribution: as member of the editorial board: JB, Hetty Carraway, Julia Lee Close, CD, Jill Gilbert, SJ, MK, GP, and DP; as member of the review board: Carsten Bokemeyer, Andrés Cervantes, Julia Lee Close, CD, NES, Jill Gilbert, MK, Yuichiro Ohe, and Miklos Pless. Keith McGregor deserves special credit for his constant encouragement to conceive the GC 2016 in its actual version. Special thanks to Jean-Yves Douillard for reviewing and commenting on the manuscript. The authors wish to thank Katharine Fumassoli, Roberta Candiani, Gracemarie Bricalli, Tanya Kenny, Nicola Latino, Marina Cogo, Vanessa Pavinato, and Vanessa Marchesi from the ESMO Head Office for their valuable contribution. Last but not least, the authors wish to thank the following responsible authors for their respective contributions: Ahmad Awada, Susana Banerjee, RB, JB, Smita Bhatia, Jan Bogaerts, Jan Buckner, Fatima Cardoso, Paolo Casali, Edward Chu, Julia Lee Close, Bertrand Coiffier, Roisin Connolly, Sarah Coupland, Luigi De Petris, Maria De Santis, Elisabeth G.E. de Vries, CD, Don S. Dizon, Jennifer Duff, Linda R. Duska, NES, Alexandru Eniu, Marc Ernstoff, Enriqueta Felip, Martin F. Fey, Jill Gilbert, Nicolas Girard, Andor W.J.M. Glaudemans, Priya K. Gopalan, Axel Grothey, Stephen M. Hahn, Diana Hanna, Christian Herold, Jørn Herrstedt, Krisztian Homicsko, Dennie V. Jones, Jr., Lorenz Jost, Ulrich Keilholz, Saad Khan, Alexander Kiss, Claus-Henning Köhne, MK, Rainer Kunstfeld, Heinz-Josef Lenz, Stuart Lichtman, Lisa Licitra, Thomas Lion, Saskia Litière, Lifang Liu, Patrick J. Loehrer, J-PL, Merry Jennifer Markham, Ben Markman, Marius Mayerhoefer, Johannes G. Meran, Olivier Michielin, Elizabeth Charlotte Moser, Giannis Mountzios, Timothy Moynihan, Torsten Nielsen, Kjell Öberg, Yuichiro Ohe, PÖ, Antonio Palumbo, NP, Fedro Alessandro Peccatori, Michael Pfeilstöcker, GP, Chandrajit Raut, Scot C. Remick, Mark Robson, Piotr Rutkowski, Roberto Salgado, Lidia Schapira, Eva Schernhammer, Martin Schlumberger, Hans-Joachim Schmoll, Lowell Schnipper, Cristiana Sessa, Charles L. Shapiro, Julie Steele, Cora N. Sternberg, Friedrich Stiefel, Florian Strasser, Roger Stupp, Richard Sullivan, Josep Tabernero, Luzia Travado, Marcel Verheij, Emile Voest, Everett Vokes, Jamie Von Roenn, Jeffrey S. Weber, Hans Wildiers, Yosef Yarden. Endorsements: the authors wish to thank the national societies in medical oncology endorsing the 2016 edition of the ESMO/ASCO Global Curriculum for Training in Medical Oncology.
+
+## Funding
+
+There was no any funding related to this work.
+
+ | Dittrich et al. Volume 27 | No. 8 | August 2016
+
+## Disclosure
+
+JB: research support to Karolinska Institutet and University Hospital from Amgen, AstraZeneca, Bayer, Merck, Roche, and Sanofi-Aventis. No personal payments. All remaining authors have declared no conflicts of interest.
+
+## References
+
+1. ESMO 2020 Vision 2015. http://www.esmo.org/content/download/68849/
+1233986/file/ESMO-2020-vision-brochure.pdf (May 2016, date last accessed).
+
+2. The European Parliament and the Council of the European Union. Directive 2005/
+36/EC of the European Parliament and of the Council of 7 September 2005 on the recognition of professional qualifications (text with EEA relevance). OJ 2005; L255: 22–142.
+
+3. Casali P. Medical oncology: the long-awaited price of recognition. Ann Oncol 2011; 22: 1695–1697.
+
+4. Popescu RA, Schäfer R, Califano R et al. The current and future role of the medical oncologist in the professional care for cancer patients: a position paper by the European Society for Medical Oncology (ESMO). Ann Oncol 2014; 25: 9–15.
+
+5. Hortobagyi GN, El-Saghir NS, Cufer T et al. The American Society of Clinical Oncology's efforts to support global cancer medicine. J Clin Oncol 2016; 34: 76–82.
+
+6. Kennedy BJ, Calabresi P, Carbone PP et al. Training programme in medical oncology. Ann Intern Med 1973; 78: 127–130.
+
+7. Training Resource Document for Curriculum Development in Medical Oncology.
+
+Adopted on February 20, 1997 by the American Society of Clinical Oncology. J
+Clin Oncol 1998; 16: 372–379.
+
+8. Wagener DJ, Vermorken JB, Hansen HH et al. The ESMO Programme of Certification and Training for Medical Oncology. Ann Oncol 1998; 9: 585–587.
+
+9. Hansen HH, Bajorin DF, Muss HB et al. ESMO/ASCO Task Force on Global Curriculum in Medical Oncology. Recommendations for a Global Core Curriculum in Medical Oncology. Ann Oncol 2004; 15: 1603–1612.
+
+10. Hansen HH, Bajorin DF, Muss HB et al. ESMO/ASCO Task Force on Global Curriculum in Medical Oncology. Recommendations for a Global Core Curriculum in Medical Oncology. J Clin Oncol 2004; 22: 4616–4625.
+
+11. ESMO/ASCO Recommendations for a Global Curriculum in Medical Oncology— Translation in different languages. http://www.esmo.org/Career-Development/ Global-Curriculum-in-Medical-Oncology (29 May 2016, date last accessed).
+
+12. ESMO/ASCO Recommendations for a Global Curriculum in Medical Oncology— Translation in different languages. http://www.asco.org/international-programs/ global-curriculum (29 May 2016, date last accessed).
+
+13. ESMO/ASCO Global Curriculum Log Book, 2008. https://www.esmo.org/content/
+download/8176/168808/file/The-ESMO-ASCO-Global-Core-Curriculum-for-Trainingin-Medical-Oncology-Log-Book.pdf (29 May 2016, date last accessed).
+
+14. ESMO/ASCO Global Curriculum Log Book, 2008. http://www.asco.org/sites/newwww.asco.org/files/content-files/international-programs/documents/2008-ESMOASCO-Log-Book-pdf.pdf (16 June 2016, date last accessed).
+
+15. ESMO/ASCO Recommendations for a Global Curriculum in Medical Oncology 2010 Update. https://www.esmo.org/content/download/8171/168764/file/ESMO-ASCORevised-Recommendations-for-a-Global-Curriculum-in-Medical-Oncology.pdf (29 May 2016, date last accessed).
+
+16. ESMO/ASCO Recommendations for a Global Curriculum in Medical Oncology 2010 Update. http://www.asco.org/sites/default/files/esmo-asco_revised_recommendations.
+
+pdf (29 May 2016, date last accessed).
+
+17. ESMO/ASCO Global Curriculum Log Book Update 2016. http://www.esmo.org/
+content/download/81967/1487517/file/The-ESMO-ASCO-Global-Curriculum-forTraining-in-Medical-Oncology-Log-Book-2016.pdf (30 May 2016, date last accessed).
+
+18. ESMO/ASCO Global Curriculum Log Book Update 2016. http://www.asco.org/
+sites/new-www.asco.org/files/content-files/international-programs/documents/
+2016-ESMO-ASCO-Log-Book-interactive.pdf (16 June 2016, date last accessed).
+
+19. Pavlidis N, Alba E, Berardi R et al. The ESMO/ASCO Global Curriculum and the evolution of medical oncology training in Europe. ESMO Open 2015;1(1), doi:10.1136/esmoopen-2015-000004.
+
+20. Ciardiello F, Arnold D, Casali PG et al. Delivering precision medicine in oncology today and in future—the promise and challenges of personalised cancer medicine: a position paper by the European Society for Medical Oncology (ESMO).
+
+Ann Oncol 2014; 25: 1673–1678.
+
+21. Cherny NI, Sullivan R, Dafni U et al. A standardised, generic, validated approach to stratify the magnitude of clinical benefit that can be anticipated from anti-cancer therapies: the European Society for Medical Oncology Magnitude of Clinical Benefit Scale (ESMO-MCBS). Ann Oncol 2015; 26: 1547–1573.
+
+22. Schnipper LE, Davidson NE, Wollins DS et al. American Society of Clinical Oncology Statement: a conceptual framework to assess the value of cancer treatment options. J Clin Oncol 2015; 33: 2563–2577.
+
+23. Gilbert J, Chew H, Dewey C, Horn L. Medical education: perils and progress in educating and assessing a new generation of learners. In Dizon DS (ed), Illumination & Innovation: Transforming Data Into Learning. 2015 ASCO Educational Book.
+
+Alexandria, VA: American Society of Clinical Oncology 2015; 33–39.
+
+24. Ludmerer KM. Time to Heal: American Medical Education from the Turn of the Century to the Era of Managed Care. Oxford: Oxford University Press, 2005.
+
+25. Ten Cate O. Nuts and bolts of entrustable professional activities. J Grad Med Educ 2013; 5: 157–158.
+
+26. Ten Cate O. Competency-based education, entrustable professional activities, and the power of language. J Grad Med Educ 2013; 5: 6–7.

medical/md/PMC5045474.md

@@ -0,0 +1,292 @@
+-
+
+![0_image_0.png](0_image_0.png)
+
+ORIGINAL RESEARCH ARTICLE
+Presence of Cx43 in extracellular vesicles reduces the cardiotoxicity of the anti-tumour therapeutic approach with doxorubicin Tania Martins-Marques1,2, Maria Joao Pinho1,2, Monica Zuzarte1,2, Carla Oliveira3,4,5, Paulo Pereira6, Joost P. G. Sluijter7,8, Celia Gomes2,9,10 and Henrique Girao1,2* 1Institute of Biomedical Imaging and Life Sciences (IBILI), Faculty of Medicine, University of Coimbra, Coimbra, Portugal; 2CNC.IBILI, University of Coimbra, Coimbra, Portugal; 3Expression Regulation in Cancer Group, Instituto de Investigac¸ a˜ o e Inovac¸ a˜ o em Sau´ de (i3S), Porto, Portugal; 4Institute of Molecular Pathology and Immunology of the University of Porto (IPATIMUP), Porto, Portugal; 5Department of Pathology and Oncology, Faculty of Medicine, University of Porto, Porto, Portugal; 6Chronic Diseases Research Center
+(CEDOC), NOVA Medical School, Faculdade de Cieˆ ncias Me´ dicas, Universidade NOVA de Lisboa, Lisboa, Portugal; 7Department of Cardiology, Division of Heart & Lungs, University Medical Center Utrecht, Utrecht, The Netherlands; 8Interuniversity Cardiology Institute Netherlands (ICIN), Utrecht, The Netherlands; 9Laboratory of Pharmacology and Experimental Therapeutics, IBILI, Faculty of Medicine, University of Coimbra, Coimbra, Portugal; 10Center of Investigation in Environment, Genetics and Oncobiology (CIMAGO),
+Faculty of Medicine, University of Coimbra, Coimbra, Portugal Extracellular vesicles (EVs) are major conveyors of biological information, mediating local and systemic cellto-cell communication under physiological and pathological conditions. These endogenous vesicles have been recognized as prominent drug delivery vehicles of several therapeutic cargoes, including doxorubicin (dox),
+presenting major advantages over the classical approaches. Although dox is one of the most effective antitumour agents in the clinical practice, its use is very often hindered by its consequent dramatic cardiotoxicity.
+
+Despite significant advances witnessed in the past few years, more comprehensive studies, supporting the therapeutic efficacy of EVs, with decreased side effects, are still scarce. The main objective of this study was to evaluate the role of the gap junction protein connexin43 (Cx43) in mediating the release of EV content into tumour cells. Moreover, we investigated whether Cx43 improves the efficiency of dox-based anti-tumour treatment, with a concomitant decrease of cardiotoxicity. In the present report, we demonstrate that the presence of Cx43 in EVs increases the release of luciferin from EVs into tumour cells in vitro and in vivo. In addition, using cell-based approaches and a subcutaneous mouse tumour model, we show that the anti-tumour effect of dox incorporated into EVs is similar to the administration of the free drug, regardless the presence of Cx43. Strikingly, we demonstrate that the presence of Cx43 in dox-loaded EVs reduces the cardiotoxicity of the drug. Altogether, these results bring new insights into the concrete potential of EVs as therapeutic vehicles and open new avenues toward the development of strategies that help to reduce unwanted side effects.
+
+Keywords: extracellular vesicles; drug delivery; cancer; cardioprotection; intercellular communication Responsible Editor: Suresh Mathivanan, La Trobe University, Australia.
+
+*Correspondence to: Henrique Girao, Institute of Biomedical Imaging and Life Sciences (IBILI), Faculty of Medicine, University of Coimbra, Azinhaga de Sta Comba, PT-3000 354 Coimbra, Portugal, Email:
+hmgirao@fmed.uc.pt To access the supplementary material to this article, please see Supplementary files under 'Article Tools'.
+
+Received: 8 June 2016; Revised: 25 August 2016; Accepted: 30 August 2016; Published: 29 September 2016 Extracellular vesicles (EVs), including exosomes and microvesicles, are nano-sized particles that can be released by virtually every cell type into the extracellular milieu (13). Hence, EVs are found in several body fluids including saliva, urine, malignant ascites, and blood, and they are considered important tools for diagnosis and therapy (3). Because EVs are able to cross stringent biological barriers and remain in circulation without eliciting immune responses, these vesicles have emerged as excellent candidates for drug delivery (4,5). Importantly, the therapeutic value of EVs largely depends upon an efficient uptake and intracellular processing of deliverable material. Although a few different models have been proposed to depict the mechanisms underlying EV-cell interaction, the most robust evidence pointed to endocytosis or membrane fusion of EVs within target cells (3,6). Recently, we proposed an additional mode of communication, involving connexin43 (Cx43)-containing channels. Results from our lab demonstrated that the gap junction (GJ) protein Cx43, embedded in EV membranes, forms a channel that facilitates the release of intravesicle content into recipient cells, likely playing important functions on selective EV targeting, increased cargo delivery, or both (7).
+
+Mounting lines of evidence established the therapeutic potential of endogenous membrane-enclosed vesicles, mostly focused on inflammation and cancer. For example, curcumin-loaded exosomes were found to confer protection in mice models of lipopolysaccharide-induced sepsis, whereas intratumoural delivery of microvesicles carrying the cytosine deaminase mRNA and protein, in combination with systemic delivery of a pro-drug, leads to reduced growth of schwannoma xenografts in vivo (8,9).
+
+Given that cancer cells express a myriad of membrane receptors that can confer targeting selectivity, EV homing has been attempted through the use of engineered vesicles with surface-targeting peptides (4,10,11). This enhanced tropism is particularly important to mitigate the side effects of cytotoxic compounds. For example, doxorubicin (dox) is among the most effective chemotherapeutic agents used in the clinical practice, with indications for a wide variety of cancers. Nevertheless, its use has been limited by the high incidence of acute cardiotoxicity that arises in about 11% of the patients (12). Consequently, EVs or liposomal formulations of dox have been considered as valuable therapeutic alternatives to decrease toxicity to non-target organs (13,14). Tian et al. demonstrated that exosomes with surface expression of the internalizingRGD peptide (Arg-Gly-Asp); amino acid sequence CRGDK/RGPD/EC peptide, exogenously loaded with dox, display enhanced tropism to breast cancer xenografts and increased therapeutic efficiency (10). Given its potential, additional studies are required to deeply demonstrate the efficacy of EVs as dox-carrying agents.
+
+Although it is known that initial stages of tumour growth involve a downregulation of Cx43, further dissemination and colonization of malignant cells require the presence of Cx43 (15,16). Therefore, we hypothesized that Cx43 can constitute a target to direct therapeutic vehicles within specific stages of tumour development. In the present work, we investigated whether the presence of Cx43 improves the therapeutic potential of EVs as carriers of dox, with a concomitant reduction of cardiotoxicity in a subcutaneous breast cancer mouse model.
+
+## Materials And Methods
+
+Cell culture and animal models Human embryonic kidney (HEK)-293 and 4T1luc2 (Perkin Elmer) cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM) (Life Technologies), supplemented with 10% foetal bovine serum (FBS, Gibco), penicillin/
+streptomycin (100 U/ml:100 mg/ml) and 1% GlutaMax (Life Technologies). Animals were handled according to European Union guidelines (86/609/EEC), with approval of the Ethics Committee, Faculty of Medicine, University of Coimbra. The tumour model was established by subcutaneous injection of 0.5106 murine breast 4T1luc2 cells in opposite flanks of 12-week-old female Swiss nude mice
+(Charles River) (17,18). EVs loaded with luciferin and dox were resuspended in phosphate-buffered saline (PBS) (10 mg of EVs/20 ml of PBS) and intratumourally (i.t.) injected. Tumour growth was monitored 5, 8 and 11 days post-inoculation by bioluminescence imaging (BLI) with an IVIS Lumina II XR (PerkinElmer), 8 min after intraperitoneal (i.p.) injection of D-luciferin (150 mg/kg), with animals under anaesthesia (100 mg/kg ketamine and 2.5% chlorpromazine). Images were analysedwith Living Imaging 4.10 (Caliper Life Sciences SA) (19). A region of interest
+(ROI) was drawn around the tumour for bioluminescence quantification. Tumour volumes were assessed with a manual caliper and calculated with the formula (length width2)/2. Experiments were ended before tumours reached a 2 cm3 volume endpoint. Animals were sacrificed, tumours and hearts were harvested, and then they were embedded in optimum cutting temperature (OCT) matrix (Tissue-Tek) for cryosectioning, or snap-frozen in liquid nitrogen for biochemical studies, before storage at 808C.
+
+## Ev Purification
+
+HEK-293 cells expressing Cx43 or not (HEK-293Cx43 and HEK-293Cx43 ) (7) were cultured in EV-depleted medium, prepared by ultracentrifugation of 50% FBS (120,000 g, 16 h). Supernatants were diluted to a final concentration of 10% FBS in DMEM. After 48 h, conditioned medium was collected for EV isolation by differential centrifugation at 48C, starting with 10 min at 300 g, and 20 min at 16,500 g. Supernatants were filtered
+(0.22 mm filter units, cellulose acetate) and ultracentrifuged (120,000 g, 70 min) (20). Pellets were resuspended in PBS and immediately used for EV loading. On average, 0.5 mg of purified EVs was obtained per 1 million cells.
+
+Transmission electron microscopy (TEM) characterization of EVs was performed as described previously (7).
+
+EV loading Five micrograms of EVs was incubated with 150 mM 1-(4,5dimethoxy-2-nitrophenyl)ethyl ester (DMNPE)-caged-D-luciferin for 1 h, at 378C, protected from light. Luciferin was released from the DMNPE group by UV-B (365 nm) photolysis (5 min, on ice) using an UV transilluminator (7,21).
+
+Non-incorporated luciferin was removed using Exosome Spin Columns (Life Technologies). Luciferin-loaded EVs were added to 4T1luc2 seeded in 96-well plates, or injected i.t.
+
+into mice, followed by BLI. Ten micrograms of EVs was mixed with 100 mg of dox (DOXO-cell†) in PBS supplemented with 5 mM EDTA, and then the mixture was electroporated at 35 V and 150 mF using 0.4 cm cuvettes in a Gene Pulser II electroporator (Bio-Rad) (10,21).
+
+Empty EVs were also electroporated. Non-incorporated dox was washed out with PBS by using ultracentrifugation
+(120,000 g, 70 min). Loaded dox was quantified by fluorescence detection in a Biotek Synergy HT microplate reader
+(emission, 594 nm; excitation, 480 nm) with Gen 5 software (BioTek). Fluorescence readings were compared with a standard curve of free dox. On average, yield of dox encapsulation was 10%.
+
+Determination of cell viability, proliferation, motility and colony formation in vitro 4T1luc2 cells were treated with 2 mM free dox or dox-loaded EVs for 24 h, when appropriate. Metabolic activity, through the 3-(4,5-dimethylthiazol-2-yl)-2.5-diphenyl tetrazolium bromide (MTT, Sigma) assay (17), and cell viability, by Trypan blue exclusion or flow cytometry, after propidium iodide (PI) staining, were performed as described previously (22,23). Cell proliferation was assessed by 5-bromo-2?-deoxyuridine (BrdU) incorporation according to the manufacturer's instructions (Roche Diagnostics). Where indicated, cells were treatedwith 0.25 mg/ml gap26 (Caslo) for 1 h. Staining of ki-67positive cells was performed by immunofluorescence (1:100, AB16667, Abcam) (24). Images were obtained using an Axio Observer.Z1 inverted microscope (Zeiss) and analysed with ImageJ (National Institutes of Health). Cell cycle analysis was performed by flow cytometry, after PI/RNase staining
+(Immunostep) (25). Cell motility was analysed by timelapse video microscopy (6 h, 3 min acquisition interval, using an Axio Observer.Z1 inverted microscope), with the cells under an atmosphere of 5% CO2 at 378C. Manual cell tracking analysis was performed with ImageJ (26). For colony formation assay, cells were treated for 48 h, as indicated, after which medium was replaced by a drug-free medium, and cells were allowed to grow for 7 days. At the end of the experiment, cells were fixed and stained with crystal violet (Sigma-Aldrich) (27). Microscopy images were obtained using an Axio Observer.Z1 inverted microscope.
+
+## Western Blot
+
+Cell and tissue lysates were prepared as described previously (28). EV pellets were lysed in a non-reducing loading buffer. Primary antibodies against CD63 (1:500, AB0047, Sicgen), CD81 (1:250, Sc9158, Santa Cruz Biotechnology), Cx43 (1:2,500, AB0016, Sicgen), Calnexin (1:5,000, AB0041, Sicgen), phosphorylated and total p44/42 (1:500, 4377S and 9102, Cell Signaling Technology),
+Bax (1:250, Sc6236, Santa Cruz Biotechnology) and Bcl2
+(1:250, Sc7382, Santa Cruz Biotechnology) were used, followed by incubation with horseradish peroxidaseconjugated secondary antibodies (1:10,000, Bio-Rad). Images were visualized in a VersaDoc system (Bio-Rad).
+
+Densitometric quantification was performed in unsaturated images using ImageJ.
+
+Immunofluorescence staining and histology Immunofluorescence staining of tissue samples (5 mm cryosections) was carried out as described previously (29).
+
+Fixation was performed with acetone and blocking with 2.5% bovine serum albumin. Primary antibodies against cyclooxygenase (COX)-2 (1:100, ab15191, Abcam), Hsp27 (1:50, SPA-803, Stressgen) and Cx43 (1:250, AB0016, Sicgen) were used. Images were collected with an Axio Observer.Z1 inverted microscope. For haematoxylin and eosin (HE) and Sirius red (0.1% in saturated aqueous picric acid) staining, slices were fixed in 4% paraformaldehyde (30). Images were collected with an AxioLab.A1 microscope (Zeiss). Quantitative analysis (at least 10 randomly chosen fields) was performed using ImageJ,
+including measure of transverse diameter of the myocytes cut at the level of the nucleus and area of fibrosis.
+
+## Statistical Analysis
+
+Data were analysed with Prism 7, version 7.0a (GraphPad Software, Inc.). Statistical significance was assessed by Student's t-test or KruskalWallis test, where appropriate. Experimental data were presented as scatterplots plus mean (31), or as mean9standard error of the mean, where applicable.
+
+## Results
+
+Cx43 mediates the communication between EVs and tumour cells In the present work, we hypothesized that Cx43 facilitates the direct transfer of EV cargo, including cytotoxic drugs, into tumour cells, thus contributing to improve the therapeutic potential of EVs. First, we demonstrated that our preparations of EVs, obtained from HEK-293 cells, containing or not Cx43, EVCx43 or EVCx43 
+(7,32), are positive for canonical EV markers, such as the tetraspanins CD63 and CD81 (Fig. 1a), and present typical size and morphology (Fig. 1b). In addition, the presence of higher molecular weight forms of Cx43, in non-reducing WB, suggests that EV-Cx43 is assembled into hexameric structures (Fig. 1a). This is in accordance with our previous report, wherein we characterized in great detail Cx43-containing EVs (7).
+
+To evaluate whether Cx43 enhances the EV uptake by tumour cells, EVCx43 or EVCx43  were exogenously loaded with luciferin, after which they were added to 4T1luc2 tumour cells, overexpressing the firefly luciferase and endogenously expressing Cx43. We observed that
+
+![3_image_0.png](3_image_0.png)
+
+the light emitted by 4T1luc2 cells incubated with intact EVCx43 is 1.7-fold higher, compared with that of cells exposed to EVCx43  (Supplementary Fig. 1a), an effect that is maintained in a dose-dependent manner (Supplementary Fig. 1b). The levels of light emission after EV lysis are similar in both populations of vesicles (Supplementary Fig. 1a), suggesting that the same amount of luciferin was loaded into EVs, regardless the presence of Cx43.
+
+EVs loaded with dox are cytotoxic for tumour cells in vitro Then, we tested the efficiency of Cx43-containing EVs in the delivery of dox to tumour cells. First, by fluorimetric analysis, we demonstrated that a similar amount of dox was incorporated into EVCx43 and EVCx43  (Fig. 1c).
+
+Also, we showed that the electroporation procedure did not compromise EV integrity (Fig. 1d), nor EV-Cx43 levels
+(Supplementary Fig. 2a). To compare the cytotoxicity of dox, equal amounts of dox (2 mM), either free or loaded into EVCx43 or EVCx43  (EVCx43dox or EVCx43 dox),
+were added to recipient 4T1luc2 cells for 24 h. As control, empty EVs were used. Results in Fig. 1e show a dramatic decrease in cell viability after 24 h treatment with free dox, an effect that was further enhanced in cells treated with EVCx43dox, compared with their respective vehicletreated cells. However, no significant differences were found between free dox and dox-loaded EVs, neither among EVCx43dox nor EVCx43 dox treatments. In addition, we demonstrated that treatment with dox equally reduced the metabolic activity of tumour cells (Fig. 1f), regardless the delivery vehicle, in a dose-dependent manner (Supplementary Fig. 2b). The addition of empty EVs had no significant alterations upon cell viability or metabolic activity.
+
+EVs loaded with dox impair tumour cell proliferation and motility in vitro Next, we evaluated the effect of EV-dox in counteracting the abnormal proliferation of tumour cells, by using different complementary approaches (33). Results on Fig. 2a show that the percentage of ki-67positive cells is lower in the presence of EV-dox than the free drug. Regarding the BrdU incorporation, a more pronounced decrease was observed in cells treated with EVCx43dox
+(Fig. 2b). This was further corroborated by the cell cycle analysis, where treatment with EVCx43dox induced a cell cycle arrest in G2/M phase, accompanied by a decrease
+
+![4_image_0.png](4_image_0.png)
+
+in the percentage of cells undergoing S-phase (Fig. 2c).
+
+In colony formation assays, dox-loaded EVs presented a similar effect as free dox, abolishing the clonogenic potential of 4T1luc2 cells (Supplementary Fig. 2c). In any circumstance, empty EVs did not present an effect. Overall, despite that no statistical significance could be achieved, dox loaded into EVs containing Cx43 presented a trend toward an enhanced anti-proliferative capacity, compared with either free dox or EVCx43 dox.
+
+Some of these data were confirmed in another tumour cell line, MNNG/HOS, derived from an osteosarcoma. The results obtained show that metabolic activity and cell proliferation were impaired in the presence of either free or EV-dox (Supplementary Fig. 2df). In parallel, to attest whether this effect can be tumour specific, we evaluated the same parameters in 2 non-tumour cell lines - kidney epithelial HEK-293Cx43 cells and retinal pigment epithelial Arpe-19 cells (Supplementary Fig. 3ac). Our data show that, in this case, free dox leads to a significant decrease in the metabolic activity, BrdU incorporation and percentage of ki-67positive cells in both non-tumour cell lines, whereas EV-dox presents minor toxicity to those cells. Altogether, the data obtained with tumoural and non-tumoural cell lines demonstrate that dox carried in EVs, compared to free dox, is more toxic to tumour cells and less toxic to non-tumour cells.
+
+To prove that a functional channel is required to the aforementioned effects, we used a Cx43 mimetic peptide, gap26, that specifically blocks Cx43 channels (7,34). Results in Fig. 2d show that, in the presence of gap26, EVCx43dox were no longer able to impair proliferation of recipient 4T1luc2 cells, whereas the use of gap26 showed no effect upon treatment with EVCx43 dox or free dox.
+
+These data provide strong evidence that the increased cytotoxicity of EVCx43dox can be, at least partially, mediated by the function of Cx43 channels.
+
+Furthermore, we evaluated cell motility, using timelapse microscopy. Our results show that 4T1luc2 cells incubated with EVCx43dox present a significantly reduced cell motility, compared to free dox treatment (Fig. 3a). Given that mitogen-activated protein kinases are master regulators of cell motility, survival and proliferation (35,36),
+
+![5_image_0.png](5_image_0.png)
+
+we explored the effect of dox administration upon modulation of the p44/42 pathway. Results in Fig. 3b show a decreased activation of the p44/42 pathway in tumour cells treated with either free or EV-dox for 24 h; this decrease is only statistically significant when EVCx43dox are used.
+
+Altogether, these data suggest that the anti-proliferative effects and disruption of cell motility in response to EVCx43dox treatment involve a downregulation of the p44/42 pathway.
+
+DOX loaded in EVs present therapeutic potential identical to free dox in vivo Once we established the anti-tumoural effect of dox loaded in EVs in vitro, we proceeded to the in vivo studies. We started by quantitatively assessing the communication between EVs and tumour cells by using a subcutaneous mouse xenograft model with bilateral flank tumours. For that, we injected the mice i.t. with luciferin-loaded EVCx43 or EVCx43  in opposed tumours of the same animal. Results depicted in Supplementary Fig. 4 show that EVCx43 were more efficient in the delivery of luciferin to the tumours, as indicated by the 2.7-fold increase in the signal, relative to EVCx43 . Because BLI of animals receiving luciferin i.p. showed tumours with a similar signal intensity, our data support the hypothesis that the presence of Cx43 in EVs facilitates the release of intraluminal content into target tumour cells.
+
+To investigate the therapeutic potential of Cx43containing EVs in vivo, tumour-bearing mice received treatment with equal amounts of dox (0.2 mg/kg i.t.; Supplementary Fig. 5a), administered either free or encapsulated in EVs (EVCx43 dox or EVCx43dox), 5 and 8 days post-implantation of 4T1luc2 cells. As controls, we used vehicle-treated animals - injected i.t. with either PBS, EVCx43  or EVCx43 at the same concentrations.
+
+Tumour response to different forms of treatment was monitored by BLI, 11 days after cell inoculation. Treatment of mice with EVCx43 dox or EVCx43dox resulted in anti-tumoural effects similar to the free drug (Fig. 4a). In addition, we assessed tumour volumes using a manual caliper (Fig. 4b) and determined the weight of excised tumours (Fig. 4cd). Altogether, and considering the comparison between dox-treated animals and their respective vehicles, we show that similar anti-tumoural effects were obtained for free dox and dox encapsulated in EVCx43 , whereas a better therapeutic efficiency was observed for EVCx43dox, compared with EVs devoid of Cx43. The effect of dox-induced apoptosis was also evaluated through the analysis of Bax and Bcl2 levels in tumours after the treatments (37). Results on Fig. 4e show that only EVCx43dox induced a statistically significant increase in the ratio Bax/Bcl2. In all the evaluated parameters, injection of empty EVs produced no effect and was therefore omitted from subsequent experiments.
+
+Fig. 4. EVs loaded with dox have anti-tumoural activity in 4T1luc2 tumour-bearing mice. Tumour-bearing mice were treated (i.t.) with 0.2 mg/kg of free dox, EVCx43dox or EVCx43 dox or vehicles, on days 5 and 8 after subcutaneous inoculation of 4T1luc2 cells into opposed flanks. Equal amounts of EVs were used in each condition. (a) Representative BLI of mice 11 days after 4T1luc2 cells inoculation, corresponding to 3 days after the last treatment. (b) Tumour diameters were measured with a caliper, followed by determination of tumour volume (n 5-8). (c) Representative images of excised tumours. (d) Average mass of excised tumours (n 5-8). (e) WB analysis of Bax and Bcl2 in tumour lysates, for each treatment group. Ratio of Bax/Bcl2 is depicted on graph. Calnexin was used as loading control (n 5, #p B0.05 vs. EVCx43).
+
+Cx43 in extracellular vesicles is cardioprotective
+
+![6_image_0.png](6_image_0.png)
+
+Herein, the term vehicle is used to designate animals that received treatment with PBS.
+
+Subsequently, we evaluated the therapeutic value of EVs concerning the tumour growth rate, by BLI. Similar to the data presented above, dox-loaded EVs showed the same therapeutic activity as free dox, inducing a progressive decrease in tumour growth rate relative to the vehicle (Fig. 5ab). Despite no statistical differences, a trend toward an increased efficiency for EVs containing Cx43 (comparing with EVCx43 dox) was maintained.
+
+Representative images illustrating treatment with empty EVs are presented in Supplementary Fig. 5b.
+
+Cx43-containing EVs loaded with dox ameliorate dox cardiotoxicity in vivo Given the cardiotoxicity associated with dox-based therapies, we sought to assess whether EVs are able to mitigate such side effects in our model. To address this question, we evaluated different parameters usually implicated in dox cardiotoxicity, including oxidative stress and altered expression of cardiac-specific genes (12,27,35,36,45). Although HE staining showed no major histopathological changes, transverse diameter of the cardiomyocytes was reduced in the hearts of mice that received treatment with free dox, an effect that was prevented upon EVCx43dox treatment (Fig. 6a, upper panel). Moreover, free dox treatment lead to increased myocardial fibrosis that was not observed in animals that received dox encapsulated in EVCx43 (Fig. 6a, bottom panel).
+
+Dox-induced oxidative stress in the heart is mediated by the activity of COX-2, that is, the generation of reactive oxygen species responsible for the induction of small heat shock proteins (3840). Our results show that mice treated with free dox presented increased levels of COX-2 and Hsp25 in the heart (Fig. 6bc), whereas in those mice that received dox encapsulated in Cx43containing EVs, the cardiac levels of these proteins remained unaltered.
+
+![7_image_0.png](7_image_0.png)
+
+Several cardiomyopathies have been associated with GJ remodelling, which is accompanied by alterations of the levels and/or subcellular distribution of Cx43, the more abundant GJ protein in the myocardium (28,41). Results depicted in Fig. 6d show that free dox lead to a marked increase in the levels of Cx43 in the heart, which was prevented by EVCx43dox treatment. Concerning the animals treated with EVCx43 dox, they presented an intermediate phenotype, with an upregulation of COX-2 and Cx43, but not of Hsp25, and induction of fibrosis.
+
+Altogether, these results demonstrate that i.t. administration of dox causes morphological and molecular alterations in the heart that can partially be attenuated using EVCx43 as a delivery vehicle of dox.
+
+Discussion It has become increasingly evident that EVs are major conveyors of biological information between cells, making them appealing candidates for directed drug delivery.
+
+Although various studies have shown that these endogenous vesicles can be used to deliver therapeutic cargo to specific tissues (46), we are still far from reaching the standardization needed to translate those evidences into the clinical arena. Indeed, many drawbacks, including some lack of specificity of EV to desirable target cells, causing adverse effects, have hampered the enthusiasm around of EV-based therapeutics. Therefore, the development of strategies that aim to improve the efficacy of using EVs as drug delivery systems with decreased side effects are vital to boost this highly promising field of research. In the present report, we show that EVs can be successfully used to deliver dox to tumour cells in vitro and in vivo, rendering a similar chemotherapeutic effect to that of the free drug. More importantly, we demonstrate that the presence of Cx43 in EVs potentially increases the therapeutic value of these vesicles by reducing the cardiotoxicity of dox.
+
+Despite the theoretical high potential of EVs as dox vehicles for anti-tumour therapy, only 1 study from Tian
+
+Fig. 6. Cx43-containing EVs ameliorate dox cardiotoxicity in vivo. Tumour-bearing mice were treated (i.t.) with 0.2 mg/kg of free dox, EVCx43dox or EVCx43 dox 5 and 8 days after bilateral subcutaneous 4T1luc2 cells inoculation. At day 11, mice were sacrificed and hearts were collected. (a) Histological analysis of hearts was performed by HE and Sirius red staining. Scale bars, 5 mm. Insets represent low-magnification images. Quantitative measurements obtained in each field analysed by microscopy are depicted in the graph (n 34,
+*p B0.05 dox vs. vehicle; §p B0.05 EVCx43 dox vs. vehicle; #p B0.05). Expression of COX-2 (green) (b) Hsp25 (red) (c) and Cx43
+(green) (d) was assessed by immunofluorescence. Nuclei were stained with Dapi. Scale bars, 20 mm. Graphs depict quantification of each individual field analysed by fluorescence microscopy (n 34, *p B0.05, **p B0.01 dox vs. vehicle; §p B0.05 EVCx43 dox vs. vehicle; #p B0.05).
+
+Cx43 in extracellular vesicles is cardioprotective
+
+![8_image_0.png](8_image_0.png) 
+et al. has shown that exogenous loading of dox into exosomes can be used to inhibit tumour growth, using a breast cancer mice model (10,40). Therefore, the results gathered in our report constitute an important step forward in favour of EVs as suitable delivery vehicles.
+
+In addition, we provided important insights regarding the mechanisms whereby dox-loaded EVs exert therapeutic effects, showing that EV-dox impair metabolic activity and proliferation of tumour cells in vitro, cause cell cycle arrest and impair clonogenic ability of 4T1luc2 cells.
+
+Concerning the donor cell type for vesicle production, we used EVs from HEK-293 cells. HEK-293 cells have been shown to be suitable for the delivery of other therapeutic compounds in different animal models of disease, including models of cancer and hepatic disorders
+(10,11).
+
+The more challenging step of targeted drug delivery is still the design of vesicles with enhanced tropism to tumour cells. For example, Ohno et al. demonstrated that the miRNA let-7A can be successfully delivered by exosomes displaying an epidermal growth factor receptor ligand, leading to growth inhibition of breast cancer xenografts (4). It was also demonstrated that the presence of iRGD peptides at the exosomal surface increase the efficiency of dox delivery to tumour cells by targeting upregulated integrin receptors, with a concomitant decrease of toxicity to non-target organs (10). Because the expression of Cx43 in tumour and stromal cells can correlate with the malignancy and metastatic potential of tumours (42), it is conceivable that Cx43 constitutes a suitable target to direct therapeutic vesicles, within specific types and/or stages of tumour development. In the present study, we show that the presence of Cx43 in EVs increases the delivery efficiency of small compounds, such as luciferin, into luciferase-expressing tumour cells, in vitro and in vivo.
+
+Although the presence of Cx43 in EVs did not show a statistically significant difference in terms of therapeutic effect of dox, in the majority of the evaluated parameters there is a clear trend for EVCx43 to present a better antitumoural performance, compared to EVCx43 .
+
+Moreover, the fact that the specific hemichannel inhibitor gap26 was able to prevent the effect of EVCx43dox on cell proliferation impairment, underpins our model in which functional Cx43 channels are required for the cytotoxicity of EVCx43dox. This lead us to propose that, in addition to endocytosis and membrane fusion of EVs with recipient cells, an alternative and/or complementary mechanism, involving the docking of Cx43 channels present in both EVs and cells, can contribute for a more efficient and/or rapid communication between recipient cells and EVs (43). This can be relevant, for example, to bypass inflammasome activation or rapid lysosomal degradation of intraluminal cargo, thus improving the value of EVs as therapeutic carriers (3).
+
+In line with a previous study (13), our data show that cardiac damage, induced by treatment of tumour-bearing mice with free dox (i.t.), including morphological alterations, increased fibrosis and upregulation of oxidative stress response, can be attenuated when dox is carried by Cx43containing EVs, whereas delivery through EVCx43  did not ameliorate dox cardiotoxicity. Given that in physiological conditions, in the heart, Cx43 is mainly present at the intercalated discs, forming GJ, these fully assembled channels would not be available to dock with Cx43 channels present at the EV membranes, which could, at least partially, explain our results. In contrast, EVs devoid of Cx43 would be preferentially taken up by endocytosis and/or fusion, still causing some degree of toxicity to the heart. Alternatively, it is plausible that Cx43-containing EVs can be retained in other organs and do not reach the heart.
+
+In agreement with a recent report (44), we found that free dox lead to an upregulation of Cx43, an effect that is absent from hearts of animals treated with EVCx43dox.
+
+Although in our study, we did not explore in detail the subcellular distribution of cardiac Cx43, it is conceivable that after dox exposure Cx43 accumulates at the intercalated discs, thus accounting for an increased intercellular communication that could have a detrimental effect not only through alterations to the electrical conduction system required for synchronous heart contraction, but also by contributions to the spread of damage signals, which, in this case, would exacerbate dox-induced cardiotoxicity.
+
+Overall, our results constitute an important contribution to reinforce the emerging and very promising idea that EVs constitute an efficient drug delivery vehicle for anti-tumoural therapeutic approaches. Moreover, we provide strong evidence that the presence of Cx43 in dox-containing EVs can reduce cardiotoxicity, without compromising its therapeutic efficiency.
+
+## Authors' Contributions
+
+HG coordinated the study, designed experiments, analysed data and wrote the manuscript. TMM designed and performed the experiments, discussed the data and wrote the manuscript. CG designed and performed the experiments and discussed the data. MJP performed the experiments. MZ performed the TEM experiments. CO, JPGS
+and PP contributed to the writing and revision of the manuscript.
+
+Conflict of interest and funding The authors declare no conflicts of interest. This work was supported by the Portuguese Foundation for Science and Technology (FCT) grant FCT-UID/NEU/04539/2013. TMM was supported by a Ph.D. grant from FCT, PD/BD/ 106043/2015. IPATIMUP, part of the i3S Research Unit, was supported by FEDER (Fundo Europeu de Desenvolvimento Regional)/COMPETE 2020 [Operacional Programme for Competitiveness and Internationalisation (POCI)], Portugal 2020, FCT grant POCI-01-0145-FEDER-007274, Programa Operacional Regional do Norte (ON.2 - O Novo Norte),
+through FEDER/QREN (Quadro de Refereˆncia Estrate´gico Nacional) grants NORTE-07-0162-FEDER-000118 and NORTE-07-0162-FEDER-000067. CO is a Management Committee Member of the COST Action BM1202 ''European Network On Microvesicles And Exosomes In Health And Disease (Me-Had).'' The 4T1luc2 cells were kindly provided by L. G. Arnaut.
+
+## References
+
+6. Mulcahy LA, Pink RC, Carter DRF. Routes and mechanisms of extracellular vesicle uptake. J Extracell Vesicles. 2014;3: 24641, doi: http://dx.doi.org/10.3402/jev.v3.24641 7. Soares AR, Martins-Marques T, Ribeiro-Rodrigues T, Ferreira JV, Catarino S, Pinho MJ, et al. Gap junctional protein Cx43 is involved in the communication between extracellular vesicles and mammalian cells. Sci Rep. 2015;5:13243.
+
+8. Zhuang X, Xiang X, Grizzle W, Sun D, Zhang S, Axtell RC,
+et al. Treatment of brain inflammatory diseases by delivering exosome encapsulated anti-inflammatory drugs from the nasal region to the brain. Mol Ther. 2011;19:176979.
+
+9. Mizrak A, Bolukbasi MF, Ozdener GB, Brenner GJ, Madlener S, Erkan EP, et al. Genetically engineered microvesicles carrying suicide mRNA/Protein inhibit schwannoma tumor growth. Mol Ther. 2013;21:1018.
+
+10. Tian Y, Li S, Song J, Ji T, Zhu M, Anderson GJ, et al. A
+doxorubicin delivery platform using engineered natural membrane vesicle exosomes for targeted tumor therapy. Biomaterials.
+
+2014;35:238390.
+
+11. Johnsen KB, Gudbergsson JM, Skov MN, Pilgaard L, Moos T,
+Duroux M. A comprehensive overview of exosomes as drug delivery vehicles - endogenous nanocarriers for targeted cancer therapy. Biochim Biophys Acta. 2014;1846:7587.
+
+12. Ewer MS, Ewer SM. Cardiotoxicity of anticancer treatments.
+
+Nat Rev Cardiol. 2015;12:54758.
+
+13. Toffoli G, Hadla M, Corona G, Caligiuri I, Palazzolo S,
+Semeraro S, et al. Exosomal doxorubicin reduces the cardiac toxicity of doxorubicin. Nanomedicine (Lond). 2015 [cited 2016 May 5]. Available from: http://www.ncbi.nlm.nih.gov/ pubmed/26420143 14. Lener T, Gioma M, Aigner L, Bo¨rger V, Buzas E, Camussi G,
+et al. Applying extracellular vesicles based therapeutics in clinical trials - an ISEV position paper. J Extracell Vesicles.
+
+2015;4:30087, doi: http://dx.doi.org/10.3402/jev.v4.30087 15. Elzarrad MK, Haroon A, Willecke K, Dobrowolski R,
+Gillespie MN, Al-Mehdi A-B, et al. Connexin-43 upregulation in micrometastases and tumor vasculature and its role in tumor cell attachment to pulmonary endothelium. BMC Med. 2008;6:20.
+
+16. McLachlan E, Shao Q, Laird DW. Connexins and gap junctions in mammary gland development and breast cancer progression. J Membr Biol. 2007;218:10721.
+
+17. Ferreira-Teixeira M, Parada B, Rodrigues-Santos P, Alves V,
+Ramalho JS, Caramelo F, et al. Functional and molecular characterization of cancer stem-like cells in bladder cancer:
+a potential signature for muscle-invasive tumors. Oncotarget.
+
+2015;6:36185201.
+
+18. Martins-Neves SR, Paiva-Oliveira DI, Wijers-Koster PM,
+Abrunhosa AJ, Fontes-Ribeiro C, Bove´e JVMG, et al. Chemotherapy induces stemness in osteosarcoma cells through activation of Wnt/b-catenin signaling. Cancer Lett. 2016; 370:286-95.
+
+19. Lim E, Modi KD, Kim J. In vivo bioluminescent imaging of mammary tumors using IVIS spectrum. J Vis Exp. 2009. pii:
+1210. [cited 2016 May 4]. Available from: http://www.ncbi.nlm. nih.gov/pubmed/19404236 20. The´ry C, Amigorena S, Raposo G, Clayton A, The´ry C,
+Amigorena S, et al. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. In: Current protocols in cell biology. Hoboken, NJ: Wiley; 2006. p. 3.22.13.22.29. [cited 4 May 2016]. Available from: http://doi.wiley.
+
+com/10.1002/0471143030.cb0322s30 21. Montecalvo A, Larregina AT, Shufesky WJ, Stolz DB,
+Sullivan MLG, Karlsson JM, et al. Mechanism of transfer of functional microRNAs between mouse dendritic cells via exosomes. Blood. 2012;119:75666.
+
+22. Johnson S, Nguyen V, Coder D, Johnson S, Nguyen V,
+Coder D. Assessment of cell viability. In: Current protocols in cytometry. Hoboken, NJ: Wiley; 2013. p. 9.2.19.2.26.
+
+[cited 2016 Jun 6]. Available from: http://doi.wiley.com/10. 1002/0471142956.cy0902s64 23. Strober W. Trypan blue exclusion test of cell viability. In:
+Current protocols in immunology. Hoboken, NJ: Wiley; 2015.
+
+p. A3.B.1-A3.B.3. [cited 2016 Jun 6]. Available from: http://
+doi.wiley.com/10.1002/0471142735.ima03bs111 24. Butler M, Spearman M, Braasch K. Monitoring cell growth, viability, and apoptosis. Methods Mol Biol. 2014;1104:16992.
+
+25. Pozarowski P, Darzynkiewicz Z. Analysis of cell cycle by flow cytometry. In: Checkpoint controls and cancer. Totowa, NJ: Humana Press. p. 30112. [cited 2016 May 5]. Available from: http://link.springer.com/10.1385/1-59259-811-0:301 26. Jain P, Worthylake RA, Alahari SK. Quantitative analysis of random migration of cells using time-lapse video microscopy.
+
+J Vis Exp. 2012;63:e3585.
+
+27. Franken NAP, Rodermond HM, Stap J, Haveman J, van Bree C. Clonogenic assay of cells in vitro. Nat Protoc. 2006;1:
+23159.
+
+28. Martins-Marques T, Catarino S, Zuzarte M, Marques C,
+Matafome P, Pereira P, et al. Ischemia-induced autophagy leads to degradation of gap junction protein connexin43 in cardiomyocytes. Biochem J. 2015;467:23145.
+
+29. Martins-Marques T, Catarino S, Marques C, Matafome P,
+Ribeiro-Rodrigues T, Baptista R, et al. Heart ischemia results in connexin43 ubiquitination localized at the intercalated discs.
+
+Biochimie. 2015;112:196201.
+
+30. Kawaguchi T, Takemura G, Kanamori H, Takeyama T,
+Watanabe T, Morishita K, et al. Prior starvation mitigates acute doxorubicin cardiotoxicity through restoration of autophagy in affected cardiomyocytes. Cardiovasc Res. 2012; 96:45665.
+
+31. Weissgerber TL, Milic NM, Winham SJ, Garovic VD, Cooper R, Schriger D, et al. Beyond bar and line graphs: time for a new data presentation paradigm. PLoS Biol. 2015;13:
+e1002128.
+
+32. Lo¨tvall J, Hill AF, Hochberg F, Buza´s EI, Vizio D Di, Gardiner C, et al. Minimal experimental requirements for definition of extracellular vesicles and their functions: a position statement from the International Society for Extracellular Vesicles. J Extracell Vesicles. 2014;3:26913, doi: http://
+dx.doi.org/10.3402/jev.v3.26913 33. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144:64674.
+
+34. Hawat G, Benderdour M, Rousseau G, Baroudi G. Connexin 43 mimetic peptide Gap26 confers protection to intact heart against myocardial ischemia injury. Pflugers Arch. 2010;460:
+58392.
+
+35. Vial E, Sahai E, Marshall CJ. ERK-MAPK signaling coordinately regulates activity of Rac1 and RhoA for tumor cell motility. Cancer Cell. 2003;4:67-79.
+
+36. Zhang W, Liu HT. MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell Res. 2002;12:9-18.
+
+37. Chen GG, Lai PBS, Hu X, Lam IKY, Chak ECW, Chun YS,
+et al. Negative correlation between the ratio of Bax to Bcl-2 and the size of tumor treated by culture supernatants from Kupffer cells. Clin Exp Metastasis. 2002;19:45764.
+
+38. Octavia Y, Tocchetti CG, Gabrielson KL, Janssens S, Crijns HJ, Moens AL. Doxorubicin-induced cardiomyopathy: from molecular mechanisms to therapeutic strategies. J Mol Cell Cardiol. 2012;52:1213-25.
+
+39. Vedam K, Nishijima Y, Druhan LJ, Khan M, Moldovan NI,
+Zweier JL, et al. Role of heat shock factor-1 activation in the doxorubicin-induced heart failure in mice. Am J Physiol Heart Circ Physiol. 2010;298:H183241.
+
+40. Dowd NP, Scully M, Adderley SR, Cunningham AJ,
+Fitzgerald DJ. Inhibition of cyclooxygenase-2 aggravates doxorubicin-mediated cardiac injury in vivo. J Clin Invest.
+
+2001;108:585-90.
+
+41. Martins-Marques T, Catarino S, Marques C, Pereira P, Gira˜o H. To beat or not to beat: degradation of Cx43 imposes the heart rhythm. Biochem Soc Trans. 2015;43:47681.
+
+42. Radic´ J, Krusˇlin B, Sˇamija M, Ulamec M, Milosˇevic´ M,
+Jazvic´ M, et al. Connexin 43 expression in primary colorectal carcinomas in patients with Stage III and IV disease. Anticancer Res. 2016;36:218996.
+
+43. Colombo M, Raposo G, The´ry C. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles. Annu Rev Cell Dev Biol. 2014;30:25589.
+
+44. Pecoraro M, Sorrentino R, Franceschelli S, Del Pizzo M,
+Pinto A, Popolo A. Doxorubicin-mediated cardiotoxicity: role of mitochondrial connexin 43. Cardiovasc Toxicol. 15:
+366-76.
+
+45. Zhang X, Teodoro JG, Nadeau JL. Intratumoral golddoxorubicin is effective in treating melanoma in mice. Nanomedicine. 2015;11:136575.
+
+46. Tang K, Zhang Y, Zhang H, Xu P, Liu J, Ma J, et al. Delivery of chemotherapeutic drugs in tumour cell-derived microparticles. Nat Commun. 2012;3:1282.

medical/md/PMC5329560.md

@@ -0,0 +1,119 @@
+Article II.- -On the Treatment of Secondary Syphilis. By J. L. 
+
+Milton. 
+
+Under the head of secondary syphilis, I propose comprising merely, however, for the purpose of treatment all forms of infection Allowing upon chancre; from the wasting, lassitude, and glandular swellings which usher in the coming mischief, up to the latest stage of tertiary ulceration, or syphilitic disease of the internal organs or nervous centres. The reason for thus agglomerating symptoms so widely differing from each other in character and date, the treatment of the last phase of which is supposed by so many excellent authorities to be fundamentally distinct from t le first, will be seen further on. 
+
+I . 
+
+am not going here to re-open the old question about the supe- riority of simple over mercurial treatment, or of the latter over the former. After all that has been written, the dispute seems in much the same state as ever. The latest combatants who have appeared on the stage come forward, each in support of his own cause, as confident, as well supported by facts and cases, as any of 
+"is predecessors. This ever-recurring, endless conflict of opinion seems so entirely independent of the merits or demerits of t le vol. xx.?no. ix. 5 G 
+point at issue, and so entirely dependent on a cause quite beyond our control?the in-born constitution of the human mind?that I 
+should consider it waste of time to examine arguments controverted only to start into life with renovated vigour. In a systematic work, it would doubtless be the author's duty to do so, however fruitless and unprofitable he might consider the task; but in a paper intended to be strictly practical, any endeavour to reconcile such conflicting opinions as, that the worst symptoms of syphilis are never seen except when mercury lias been given, and that equally bad cases are met with in persons who have never taken a grain of mercury or used it in any form?that mercury is a poison here, as maintained by Mr Syme and many others, and the sole antidote, as taught by numbers of excellent surgeons,?would be quite out of place. 
+
+Neither will I attempt to state all the reasons which gradually led me to abandon the known methods of treatment, and to substitute that which I propose to describe here. The observations on which this system is based extend over many years of trial; during the last four or five years it has been incessantly in force, except during the periods when I was absent from work; great part of it would consist but of a long history of failures and disas-ters, of slight successes and frequent disappointments, which, though important enough perhaps at the time of trial, would be equally wearisome to recount and to read. I think, therefore, that it will be better to restrict myself to stating the conclusions arrived at. 
+
+The first is, that beyond all question, a great many persons get well without taking any mercury at all. So far, I think, the opponents of this drug are right. Very possibly these persons would have been cured more quickly and effectually if mercury had been given, but the fact that they get well without it?so far, at any rate, as visible symptoms are concerned?cannot be doubted. 
+
+Besides, I entirely question the utility of mercury here. The patients of whom I speak are usually careless and refractory, often dissipated. They have so far done nothing for their complaint, and, most probably, would do nothing for it in the only way likely to be of service. For a short time, perhaps, impelled by the fear or suffering which some new and threatening symptom has brought on, they may conform with tolerable regularity to the rules laid down by the surgeon; but with the first feeling of relief these good resolutions vanish, and they return to their old courses as surely as the comet returns towards the sun : sometimes, indeed, recovering by the aid of a good constitution, fresh air, and high feeding; oftener, perhaps, breaking down in the long-run from the combined effects of syphilis and debauchery; or, perhaps, disappearing from our view, so that we cannot trace their course for good or for evil. 
+
+To give mercury for such a case means simply to add to the mischief, to damage the reputation of the drug and of the practi-tioner who prescribes it. There is scarcely any fact better establislied in medicine than that mercury, to be of any service, must he aken systematically; and that is one of the last things that a patient of this class is likely to do. The surgeon may as well sutler him to go his own road ; for go it he will, whether he be preached to or not. We may put down in the same category with iese persons all those who have a great horror of mercury, who eve they cannot take it, who make a point of controverting every rule of treatment, or who cannot be depended on as respects heir habits. They may, one and all, be eliminated from the class o cases to be treated by means of mercury. The surgeon who tries 0 use it here will find that it is a two-edged sword, with one edge a 8reat deal sharper than the other; the patient will blame the mercury for everything that goes amiss, and he will reap nothing bul-vexation for his pains. 
+
+Again, there are many cases which do extremely well on iodide 
+?t potassium. On this head there is ample evidence, and I have observed cases which might satisfy the most incredulous. Not Merely do the symptoms disappear under the gentle operation of s. medicine?not merely does secondary syphilis, thus treated, vanish without bringing in its wake the dreaded tertiary symp-f?.rlls?but years afterwards I have examined such patients, and jailed to find any trace of a relapse, or any prospect that one would If at the outset we could unfailingly diagnose these cases, I do n?t know that it would be necessary to treat them with mercury; probably it would be quite as well not to give it at all. I see no evidence^ that mercurial treatment is here in any way superior to iodide of potassium; it may be equal to it, but that is a merent matter. The mercury can only cure after all, and that le iodide seems to do. But it is only too certain that we cannot at the beginning isolate these cases from those not amenable to the potassium, and that a very large proportion of the cases treated 
+^T1.1. the latter salt run anything but a favourable course. When bis is the case, too, no increase of the dose, no degree of persever-ance in the use of the remedy, however valuable such steps may be 
+*n the tertiary stage, will avail to remove secondary disease refrac-0l7 to moderate quantities. I do not understand how any one can Maintain that it always yields here to the iodide. My experience runs directly counter to such a statement. It might, indeed, be Said that cases which do not disappear under the action of the potassium, resist mercury quite as obstinately. With a certain reservation, there is a good deal of truth in this view, and it is the Worst of these cases that so often try the surgeon's resources when reating them with mercury. I will now suppose that the process of elimination has been pursued far enough, and that we have simply to deal with the cases which remain?that is to say, with all those which we are not warranted in considering as likely to yield to time, to simple treatment, or to iodide of potassium. I suppose I am only endors-ing the common-sense view of the profession, when I say that there remains for these no remedy but mercury. The reader is to remember that I am speaking here strictly of cases which hold out no promise of getting well under any other system, where the expectant method has been tried and found utterly wanting. 
+
+Whether the surgeon will err on what he thinks the side of safety, and decide to look upon all cases of syphilis as, ab initio, fraught with mischief, is a question I reserve for consideration further on. 
+
+Paracelsus said, No man knew the amount of vice there might be in an ass; and there can be no doubt that many excellent surgeons have, in the course of their practice, learned to look upon syphilis from much the same point of view, and to distrust it as much in the mildest form as in the most severe. 
+
+What the surgeon can do with these cases unless he gives mercury, I am quite at a loss to know. I therefore refrain from entering upon any fruitless discussion, and proceed upon the assumption that he has decided to try the great antidote, about which I 
+am desirous of making some preliminary remarks, for which I 
+ask the reader's particular attention, as they run quite counter to the views held by some eminent observers. 
+
+The first remark is, that if mercury is really to be used for the cure of these cases, it must be carried to the extent of producing a thorough effect upon the system. I do not believe a worse principle than that of simply giving mercury till the present symp-toms have disappeared?of stopping short on the first appearance of any slight sign of soreness of the gums?was ever laid down. 
+
+It is no wonder that some of those who treat syphilis by this u extinction " plan, should find it often recur, and, indeed, come to look upon syphilis as nearly, if not quite, a hopeless affair. No system that 1 have seen put in force seems better calculated to make the disease incurable, and M. Simon had M. Ricord fairly on the hip when he taxed him with the shortcomings of his treatment. In my opinion, the disease must be thoroughly subdued before any attempt is made even to reduce the amount of mercury, much less to leave it off altogether. Any half measures here are only likely to be as mischievous as semi-extirpation in scirrhus. 
+
+" The back " of the disease " must be " thoroughly 11 broken," or it will be better for both patient and surgeon that mercury should not be meddled with. 
+
+Supposing, then, that the surgeon has decided to try mercury, the next great question is, What mode of using it should be resorted to ? 
+
+For my own part, I have no hesitation in saying at once that it should be employed externally?at any rate, so far as the chief effect to be expected from it is concerned. As an adjuvant to the external use of mercury, I not only never hesitate to give this drug by the mouth, but, on the contrary, invariably recommend it; but nothing would induce me to trust to it as the sheet-anchor. The most careful and judicious administration of it in tliis way is only too apt to be followed by most serious results, by irreparable mischief. Just enough blue pill to make the gums slightly sore, will, in some constitutions, cause the uvula to slough right off, or a piece of the jaw to exfoliate?will bring on alarming and per- sistent bleeding from the bowels, or an amount of prostration which compels the practitioner to give up the remedy at the very time when it is most necessary to go on with it. Granted that such accidents occur but rarely when there is a reasonable amount of prudence on both sides, it must still be admitted that they do happen at times. There are men who deny that anything of the kind ever occurs in their practice 5 the answer is, either that they cannot have had much practice in syphilis, or that they have not followed the cases up. The opponents of mercury say that the worst results of syphilis are only seen when mercury has been given ; and there can be little doubt that the effects of mercury given by the mouth are calculated to lend effect to the statement. Unquestionably the statement itself is exaggerated. There is ample evidence that symptoms of the worst class, especially in the form of phagedena and sloughing, are seen when no mercury has been taken 5 but they are ex-ceptions, and, as a rule, I believe the charge here holds good, and most so of all when the drug has been taken by the mouth. In my own practice, all the worst eases that I have seen were in-stances of this. Many of them would, no doubt, have been very had under any treatment j they would, perhaps, have run much the same course had mercury been used externally, or possibly had it not been given at all; the use of the drug may have been only one of many causes contributing to the exacerbation of the disease; but the conclusion that its use lent a fearful impetus to the mischief seems irresistible. 
+
+Of the two remaining modes, that by friction and that by vapour-bath, I have only to say, with respect to the former, that however well suited it may be thought to a Lock Hospital, 01 a 
+? T" ?' j a- -L- ?- desperate case in private life, the recommendation to use it gener-tive, for the simple reason Now and then, a man who 
+^ b'm practice must ever prove inoperative, for the simple reason lat patients will, as a rule, reject it. Now and then, a man who as nothing to do may be found willing to go through a course of IriofiAv, /vi? ? ,1 i i .i_? 
+
+. fc) VV Vt\J XI AC* J WO 1 V/Uiiu v* friction ? or a person afflicted with syphilophobia may hail the Proposal to do so with delight; but nineteen times out of twenty the patient will have nothing to say to it. He knows, when the matter is explained to him, that such a proceeding brings with 
+*t dirt, confinement, exposure, and discomfort, and he will rather 
+^isk the chances of a milder system. The surgeon knows that behind this lurk still more serious evils?eczema, erethism, in-tractable salivation?and consequently does not often exhibit any yiolent enthusiasm for a plan which may bring all these symptoms m its train, and may not bring relief. 
+
+Yet if it is to do good, these evils must be faced. Using inunction so gently as to steer wide of all chance of acting on the mouth, is, in my judgment, worse than useless. The present symptoms may be removed, but the disposition to still more serious outbreaks is rather exasperated than alleviated, and I fancy there are few men of experience who, when they get the chance of taking the patient in hand for a radical cure, would not much rather have a case where no mercury had been used, than one where it had been tampered with in this way. 
+
+We have now to deal with the vapour-bath, so far the cleanliest and least objectionable of all the modes of administering mercury. 
+
+Its curative power is perhaps as great as that of inunction. There may be instances where a sharp salivation set up by the latter will do good where the bath has failed. Such cases have been related, but I am disposed to consider them as very rare, and to think that the chances of cure by the bath and by friction are pretty nearly balanced. 
+
+I do not wish to say one word in depreciation of Mr Lee's labours; on the contrary, I hold them in too high estimation for that; but I think their value would be greatly enhanced if they were made to comprise an accurate estimate of the relative proportion of failures to successes; and if we could gather, from reading the accounts, a clue to the cases in which vapour is likely to effect a radical cure, as distinguished from those in which it will only relieve the present symptoms, I think it is quite time that this question was stirred up. Mr Lee has done so much that is likely to survive all cavil, that he can well afford to have the subject cross-examined; and when this is done, I think it will result in the conclusion that, though the lamp-bath is the greatest improvement of modern days, yet that it still leaves much to be done. It does not get over the objections made to all systems of administering mercury. It sometimes fails; formidable symptoms, showing that it is not mastering the hold which syphilis has got upon the constitution?such as single, and even double, iritis?will appear when the patient is thoroughly under the influence of the bath; and when both these contingencies are averted, and all present symptoms disappear without any untoward occurrence, it still leaves the disposition to relapse untouched. The tendency to return on the first occasion will often resist the most persevering use of calomel vapour. I have pushed the baths to as great a pitch as the constitution seemed capable of bearing. I have continued them up to within a week of marriage, and yet have seen the first child born decidedly syphilitic. 
+
+When Mr Lee first announced the very decided success which had followed his trials with the vapour of calomel and water, I not only tried his plan extensively, but had a bath fitted up at the hospital, where I could study the effects of these remedies under my own eyes and on a large scale. But, however gently I used the vapour, or however far I pushed it, one result invariably cropped up. There was a certain percentage of failures. I then tried the addition of a small quantity of mercury, and afterwards of small doses of iodide of potassium, but with 110 better success. 
+
+Chance led me to make trial at last of the Zittmann decoction, and with such surprising results, that I have since gradually extended the employment of it to every case and form of syphilis; combin-ing it, however, with the iodide of potassium and mercury, and the employment of the vapour-bath, in the following manner_ The patient is first of all put through a course of iodide of potassium and perchloride of mercury. By combining these in the same mixture, red iodide of mercury is given in a form of extreme diffusion and freshly made, conditions which enable the to stomaph bear it so well that I have never yet known the mixture disagree. I would most strongly advise that, at the outset, the dose should be very small, not more than two or three grains of the potassium, and from the thirtieth up to the twentieth of a grain of the perchloride. Nothing can militate more effectually against the success of the treatment than to risk setting up irritation by giving the remedies too freely at first, or even by raising the strength of them too rapidly at any time. The object in view is effectually defeated so soon as ever symptoms of iodic poisoning begin. There is no choice but to entirely abandon the medicine for some days, perhaps weeks, but certainly until the symptoms have quite abated. At the same time, every precaution should be taken to Prevent such a result arising from the doses really necessary to produce an effect upon the disease, and in practice I believe nothing answers better than to combine them with bitters and aromatics. The choice of these may be safely left to the practi-tioner; it is not, perhaps, of much moment, so long as the medicine js made to sit well on the stomach, and rendered palatable, but it is of great importance that those two objects should be effected, as otherwise great difficulty may be experienced in continuing a medicine which nauseates the patient at the time of taking it, and disagrees with him afterwards. I generally use the tincture of ehirata with syrup of orange-peel or ginger, and cardamoms, as a Vehicle; but my readers will be as well versed in such matters as I am. 
+
+At one time I conjoined those medicines with sarsaparilla; it is n?t likely now that I shall ever commit such a mistake again. I have used pretty well every preparation of sarsaparilla I could near of, and long ago came to the conclusion that it was waste of time and money to employ it, except in doses too bulky and nauseous for general use; that is to say, in large quantities of the Yarm decoction. I have frequently prescribed the concentrated decoction in doses equivalent to twelve or eighteen ounces of the ordinary decoction, daily, for a long time together, without the Patient deriving the least benefit from it. 
+
+But all precautions that I have seen put in force, for the purpose of enabling the stomach to bear the potassium and mercury, fail more or less frequently unless aperients are combined with them, and the patient is restricted to a proper diet. As to the aperient, I believe it is essential that it should consist of two chief in-gredients?a pill to be taken overnight, and a draught for morning use. I have repeatedly tried both separately, and have failed quite often enough with both to deter me from any repetition of the experiment. The pill may consist of colocynth, blue pill, and hyoscyamus; or a mixture of rhubarb, soap, and jalap; a sedative or aromatic, sufficiently potent to obviate griping, is an essential feature in its cDmposition. Naturally enough, I do not mean to say that the choice of the practitioner is to be restricted to these ingredients; he will have to select according to the constitution of the patient, and the present state of that patient's health. 
+
+For the morning draught, I would recommend salts and senna ; 
+but under that name I understand something very different from the compound usually taken, or the black draught of the Phar-macopoeia; both of which, however well adapted to the ordinary emergencies of practice, are unsuitable here, the quautity of sulphate of magnesia being far too large. A small black draught usually contains quite two drachms, and when the medicine is made at home, much more is generally taken, causing an unnecessary amount of griping, without any equivalent good. About a drachm is generally quite sufficient, and many persons, especially women, do not require so much. On the other hand, the quantity of senna must be increased. It is not easy to speak with exactitude, some people being so much more easily affected by this drug than others, but generally quite a drachm is required, often more. The taste, when objected to, is easily covered by the admixture of liquorice, which also serves to facilitate the operation of the medicine. To the addition of the tincture of cardamoms I see no objection, but it is not required here as a carminative, because there is little, if any, griping set up by the medicine. 
+
+The draught should always be freshly made, and be taken in as dilute a form as possible. I advise the patient, when it is practicable, to make the medicine at home each time that it is required. The proper amount of salts, senna, and liquorice, made up in a packet, is kept ready. When the draught is wanted this is placed in a jug, a breakfast-cupful of boiling water is poured upon it, the mixture is briskly stirred to dissolve the sulphate, and as far as possible the liquorice; it is then closely covered up, and next morning strained off and drunk. The more dilute the form in which it is taken, the more certainly and gently does it act. If the patient object to diluting it before swallowing, he can do so after, by drinking half a tumbler of cold water; or, what is better, a large cup of hot weak tea so soon as he has sufficiently recovered from the fatigue of getting the draught down. As for any substitutes in the shape of tincture of senna, syrup of senna, etc., I have simply to remark that I never yet saw one of them do the least good, and that the greater the divergence in the direction of concentration and making things agreeable to the palate, the more useless does the medicine b come. 
+
+I have often been asked by patients if they might substitute some mineral water, patent preparation of magnesia, etc., for the draught. There can be no harm in granting the request, as the patient is generally the first to find out that there has been a mis-take. The moral effect of the victory gained by conquering man's natural repugnance to the unpalatable flavour of mineral waters, combined with that of superstitious faith in anything that issues from a mineral spring, may have some sort ot influence 5 and some preparations of magnesia may take the place of the senna mixture for a brief time without any perceptible mischief 5 but I think that he who carefully weighs the facts of the case will incline to my belief in the superiority of the latter. 
+
+1 he pill and draught should be taken once or twice a week, as a somewhat free action of the bowels serves not only to favour toler-ation of the iodide, but to improve the health, feome peisons aie afraid that the continued use of such medicines must piove lnjurious. I believe the impression to be quite unfounded. There may be at the outset some depression after a brisk aperient, but the reaction which follows is generally attended by a feeling ot 1?lief, of greater fitness for work, mental or bodily, and better spirits 5 signs not at all likely to attend a prejudicial action of the medicine. 
+
+. So soon as ever these symptoms are observed, the dose of the iodide and perchloride may be raised at the discretion of the practitioner. I seldom, in my own practice, go beyond five grains of the former, and an eighth of a grain of the latter, two or tliiee times a day, and always stop short of setting up much irritation. 
+
+?*- he combined treatment is continued for four or five weeks pnoi to beginning with the mercurial bath, to be presently desciibed, and, if possible, during the whole time it is employed. 
+
+Directly the dose of the iodide is increased the patient may begin to take a simple vapour-bath once or twice a week, and undei any circumstances a course of these should precede the^ use of the dedicated bath. Some of my readers may consider this precaution superfluous, but they have only to watch the progress of a few pases to satisfy themselves that the disappearance of any eiuption often directly accelerated by the vapour-bath. One author, in-deed, who has tried both plans, goes so far as to affirm that the Eatery vapour is really the active agent in the calomel bath, and tnat it is the mercury which is superfluous. At any 1 ate, the sample vapour-bath possesses one valuable property which, I think, 
+. w observing persons will refuse to accord to it that of materially improving the condition of the skin itself, and thus very probably acilitating to some slight extent the removal of the syphilis. At vol. xx.?no. ix. 5 11 one time the obstacles in the way of getting vapour-baths were so great, that, except in the case of a few persons who happened to be living near an establishment of this kind, the recommendation to employ them was inoperative; but now that a perfectly safe and portable vapour-bath can be procured for a small outlay, the diffi-culty no longer exists. 
+
+Having taken the simple vapour-bath for three or four weeks, the addition of mercurial vapour may be safely begun with. The quantity used at first should be very small?not more than five or ten grains of calomel for a bath?and should, I think, rarely exceed twenty grains. Some practitioners employ as much as sixty grains, but the action of this quantity is far too violent, and I have seen very painful and disagreeable lichen?threatening to run into eczema?result from it. Where the patient can conveniently resort to a bath properly fitted up for using mercury, this is, per-haps, the least onerous way of taking it. Mr Lee's bath is highly useful, and very reasonable in price. A decided improvement is, however, to substitute the flannelled mackintosh, made by Messrs Walters and Co., for the blanket. It confines the vapour better, and averts the dirty marks caused, when mackintosh alone is used, by a deposit of black sulphuret of mercury, due, I suppose, to decomposition of the calomel by the sulphur in the waterproof; or the calomel can be volatilized by strewing it on a small round plate of tin placed on the bearing ring of the portable vapour-bath lamp. In that case I advise the patient first to take a thoroughly hot vapour-bath for ten minutes or so, then to rise, dry himself, place the calomel over the re-lighted lamp, and cover himself well with the flannelled mackintosh. He thus preserves himself thoroughly warm, with a moist skin, without excessive perspiration, and gets a bath without serious fatigue or waste of time. 
+
+The bath is taken at first twice a week for a fortnight, then three times a week for another fortnight, and after that every night till, in the judgment of the practitioner, the disease seems to be effec-tually stamped out,?that is to say, till all manifest signs of persist-ence or recurrence have disappeared, and clear indications of the action of the mercury have been present for some little time. I do not find it often necessary to order in general more than about eighteen or twenty baths for this purpose. Doubt has been, as I 
+said, cast upon the action of the mercury here, on the ground that pounds of calomel ointment may be rubbed in without producing any salivation, that the calomel is deposited on the skin in a crystal-line form quite unsuited for absorption, and that the eruptions of syphilis will die out under the influence of mere watery vapour. 
+
+Upon hearing this I determined to make some special investigations, and have been led to conclude that the objection is unfounded, and that the mercury, thus given, has an unmistakable action on the system, even when only applied to the skin and not inhaled at all. 
+
+I also questioned the bath attendant, a very intelligent and observ- 
+!ng woman, who has been giving baths to my patients for years, and who has had excellent opportunities of watching the action 
+?f both kinds of vapour on the skin. Her testimony was unequivo- cally to the effect that the mercury was more powerful than the water, and that she had repeatedly seen a 
+" rash," refractory to simple vapour, begin to disperse as soon as ever calomel was resorted to. 
+
+J- his statement refers exclusively to the action of these remedies on the skin alone; for though always I direct the patient to inhale, I 
+seldom do so till he has taken half-a-dozen baths. 
+
+The baths being taken, the patient is, after an interval of one clear day, put through a course of Zittmann's decoction, lasting for eight days. The reader may think this the most extraordinary part of the whole proceeding, and I admit that it looks so ; in fact, it seems rather outrageous to subject a patient to eight days' purging for secondary disease; yet I always do so where I can obtain his consent. If he will not consent, I wash my hands of all responsibility, as pretty ample observation has convinced me, that while the plan in its entirety is not infallible, there is no safety for the patient if it be left incomplete. As I always have syphilitic patients under my care, I have been able to watch the influence of this part of the treatment quite fully enough to form an opinion by this time; and after more than four years of almost unbroken observation, I feel that the observations justify me in speaking of the purging as essential. 
+
+Some time ago, after I had satisfied myself on this point, I began a series of experiments with the view of ascertaining to what features in its composition the value of the decoction is due, and have every reason to believe that the senna is the sole essential in-gredient, and that it owes its value to being given highly diluted and in large bulk, and accompanied by great mixture ot liquorice and aromatics. Consequently, I have one after another weeded out many ot the ingredients. First, the sarsaparilla may be with-drawn, unless the great faith in its virtues outweigh the objections that it is useless and costly. The antimony and mei'cury are, I 
+think, entirely useless. There is no necessity for nausea, and any power of setting up perspiration possessed by the former is left quite in the background by the action of the vapour-bath; the mercury is, I submit, better given separately, if required at all, which is rather doubtful. The carminatives may be reduced to one or two, such as cinnamon or cardamoms, or both, and the alum and sugar can be discarded; at least, I observed no diminution in the efficacy of the decoction from omitting these. Dividing the process into the two stages, expressed by the cold and warm decoction, looks lathei like some astrological ceremony, or the preparation foi going through a magical performance, and may be abolished at once; neither is it in the least degree necessary for the patient to drink three quarts a day; reducing the whole bulk to a pint daily is much more rational, and even this proves far too irksome to most persons, so that for some time past I have been steadily reducing the bulk of the decoction. At the same time, whatever is deducted in this way should be made up in another, and I find this easily-effected by directing the patient to drink a cup of tea after the first half of the dose taken before breakfast, and a like quantity of beef-tea, chicken broth, or veal broth after the second half, which should follow the breakfast. 
+
+In this way the essential features of the Zittmann treatment are preserved, while it is more adapted to the exigencies of modern life. So many appliances are now to be found for warming fluids and procuring such things as beef-tea, hot, at any time requisite, that a bachelor in his chambers can carry out all that is really re-quisite quite as well as a patient in a hospital. Free purging there must be. I have seen very unsatisfactory results too often, when modifying the treatment to suit the emergencies of the patient's occupation, to trust again to anything short of this. An action which produces less than three, four, or five stools daily, I have learned by experience to regard as thoroughly insufficient; and when the decoction does not effect quite this, I never hesitate to prescribe an aperient pill every two or three nights. The decoction should always be taken warm ; and when the patient can remain in bed during the early part of the day, and confine himself to the house in the evening, especially during cold and wet weather, I think he undoubtedly recovers more quickly and thoroughly. 
+
+After the course of the decoction has been gone through, dilute nitro- or nitro-hydrochloric acid, or dilute phosphoric acid, in some bitter tincture or infusion, should be given if the patient suffers from loss of appetite and debility. I suppose all belief in the antivenereal properties of such medicines has long faded away, even if it were ever entertained by sober-minded persons since the days of Helenus Scott; but I think there can be no doubt that they materially improve the health ; and unless the patient is too tired of medicine to take anything more,?which is one of the most probable things in the world,?they may be prescribed with the most confident prospect of doing good. 
+
+What I have now to add will perhaps awaken more censure and opposition to the treatment than anything else, and that is, that the patient must go through another course of the same kind, but a very short one, at the end of three months, and again at the end of six months after that. This may appear intolerable to some per-sens ; if so, I am sorry for it, but the truth must be stated. The nature of the disease is to return, and the only safe plan is to anticipate the relapse. I do not, however, generally find it requisite to order more than a very short course; three or four weeks of the medicine, raising the dose much more rapidly than at first, half-adozen to a dozen baths taken every night, and a four or five days' use of the purgatives, suffice, in most cases, to do all that is re-quisite. 
+
+But all directions as to remedies, external and internal, the modes and times of using them, are liable to be defeated, unless tlie patient will observe a strictly regulated diet, and conform to the dictates ot prudence. The diet should be good, without being heating or over high. I do not know whether it is necessary to define what this really means; but as it may be thought rather vague, it will perhaps be better to say, that the food should include but a very moderate amount of meat, and that such things as pork, goose, strong heating soups like mulligatawney, curry, shell-fish to any great extent, too much salmon, etc., should be excluded. Plenty of good milk, good bread, and pudding of tapioca, rice, and Chap-man's flour, and mutton broth, are most desirable.ingredients. Beer of all kinds, spirits, unless it be occasionally a small quantity of pure Hollands, and all strong brandied wines, should be banished at once. Sound, thin, red wine, such as good claret, burgundy, Carlowitz, and Australian red hermitage, is, 1 think, by far the most suitable. By conforming to the dictates of prudence, I mean that the patient should sedulously abstain from all unnecessary exposure to cold and rain, from late hours, and excesses of every kind. 
+
+This comprises all that is necessary to form the basis of treatment. Of course there are, especially in the tertiary stage, many complications which require additional means, particularly when ye only see the patient after mercury has been used, such as blisterin nodes, cauterizing in sore throat, evulsion of the nails for onychia, the removal of dead bone, etc. These are matters of prac- tice which, if discussed in detail, would carry me far beyond all reasonable limits, and I therefore forbear to enter upon them. I 
+must equally refrain from going into the statistics of cure and failure, and content myself with saying that I have seen no system succeed nearly so well, that I have not had so far a single instance of failure or relapse after the full course where I have treated the case from the beginning, and but a small percentage of bad results in cases previously uncured by mercury; and that is equally appli-cable to any stage of the disease, and, so far as I can judge, any severity of symptoms. 
+
+The reader will perhaps ask if I propose to recommend this method in every case of constitutional syphilis; to which I reply, that I most certainly do, unless the patient_ consents quite uncon-ditionally to take upon himself the responsibility of failure from doing otherwise. The surgeon's task is to exorcise the demon of syphilis; and, as concerns the majority of cases, I think that is best done by early and energetic treatment. Of the two errors, it is better to err 
+?n the side of safety, and safety is only to be found by looking on all cases as dangerous. Granted that a few persons throw off the disease by the inherent strength of their constitutions; they are, after all, exceptions; and any system of treatment, founded on ex-ceptions, is as unsteady as a pyramid standing on its apex. 
+
+He may also ask if I can explain how the treatment acts; a question which may be met at once by saying that I know nothing about it. Possibly the wonderfully elastic properties of the humoral doctrine will admit of its being adapted to the case, and there is always the elimination of the virus and the emunctory property of the mercury to fall back upon. True, the humoral doctrine wants a foundation to stand upon, but that shrewd observer, Sir Benjamin Brodie, tells us that this does not interfere with the vitality of a hypothesis, which will continue to exist long after the slender foundation on which it originally rested has melted away. This may be thought improper levity, but really I do not see how the doctrine is to be met in any other manner. Reasoning and experiment are alike lost here. A. chancre has been cut out, the blood from the spot unsuccessfully inoculated, and yet the chancrous action has reappeared. There is no evidence that the contamination of tbe blood is lessened by copiousness of eruption, but plenty of evidence that there is no visible connexion be-tween the severity of secondary disease and the state of the circulat-ing fluid. The supposed elimination of the virus from the blood goes on long after there is any virus to be eliminated ; for we see it in its most formidable and destructive shape in tertiary syphilis, when neither the blood can be inoculated or auto-inoculated, nor can the disease be conveyed by contact, connexion, or descent. Yet with these facts before them, with the full knowledge that they cannot demonstrate the first stage in the hypothesis which they use so freely, and that to verify what they so unhesitatingly advance would require powers of sight and comprehension not possessed by the human race, there are men who constantly speak of elimination and blood-poisoning as though they were speaking of something established beyond doubt. 

medical/md/PMC5453919.md

@@ -0,0 +1,282 @@
+# Polydactylous Transverse Erythronychia: Report Of A Patient With Multiple Horizontal Red Bands Affecting The Fingernails
+
+Carina Chang . Bryce D. Beutler . Philip R. Cohen Received: February 10, 2017 / Published online: March 4, 2017
+- The Author(s) 2017. This article is published with open access at Springerlink.com
+
+## Abstract
+
+Introduction: Redness of the nail plate—erythronychia—is a common condition involving one or multiple digits. It may affect the entire nail or present as longitudinal red bands that extend from the proximal nail fold to the distal tip of the nail plate. Rarely, red bands may traverse the nail bed horizontally. Although erythronychia is often idiopathic, it has also been associated with amyloidosis, Darier's disease, lichen planus, and various other cutaneous conditions. We describe the clinical features of a 64-year-old Caucasian man who presented with transverse and longitudinal erythronychia affecting his fingernails. In addition, we review the classification of erythronychia and summarize the acute and chronic conditions that have been associated with this clinical finding.
+
+Methods: The features of a man with polydactylous transverse and longitudinal erythronychia are presented. In addition, PubMed Enhanced content To view enhanced content for this article go to http://www.medengine.com/Redeem/9297 F0601567D31E.
+
+C. Chang - B. D. Beutler Reno School of Medicine, University of Nevada, Reno, NV, USA
+P. R. Cohen (&)
+Department of Dermatology, University of California San Diego, San Diego, CA, USA
+e-mail: mitehead@gmail.com was used to search the following terms: erythronychia, longitudinal erythronychia, red
+
+![0_image_0.png](0_image_0.png)
+
+lunulae, and subungual. All papers were reviewed, and relevant articles, along with their references, were evaluated. Informed consent was obtained from the patient for being included in the study.
+
+Results: A 64-year-old Caucasian man with a past medical history significant for testicular cancer and pulmonary embolism presented with multiple horizontal pink-red bands affecting his fingernails. The discoloration was most prominent in the region distal to the lunula. In addition, the nails of the fifth digit of his left hand and third digit of his right hand featured longitudinal red bands extending from the distal curvature of the lunula to the free edge of the nail plate. A diagnosis of polydactylous longitudinal and transverse erythronychia, based on the clinical presentation, was established. Our patient's red bands were asymptomatic and he was not concerned about the cosmetic appearance of his nails; therefore, no additional investigation or treatment was required.
+
+Conclusion: Polydactylous transverse erythronychia is a rare condition characterized by the development of horizontal red bands affecting the fingernails or toe nails. It has only been previously described in a man with multiple system atrophy. In our patient, both transverse and longitudinal red bands were present simultaneously. Therefore, it is possible that horizontal erythronychia is an early clinical manifestation of longitudinal erythronychia.
+
+Keywords: Erythronychia; Longitudinal erythronychia; Red lunulae; Subungual; Transverse erythronychia
+
+## Introduction
+
+Erythronychia—red discoloration of the nail plate—is a benign, typically asymptomatic clinical entity that may affect one or multiple digits. The nail finding is frequently idiopathic, but has also been associated with various benign and malignant conditions, including glomus tumors [1], Darier's disease [1], malignant melanoma [2], and hemiplegia [3]. The discoloration most commonly presents as longitudinal red or pink-red bands that extend from the proximal nail fold to the distal tip of the nail plate. However, albeit rarely, red bands may also extend across the nail bed horizontally.
+
+The clinical features of a 64-year-old man who developed not only polydactylous transverse erythronychia but also polydactylous longitudinal erythronychia are described. In addition, the classification of erythronychia is reviewed, and the acute and chronic conditions that have been associated with this clinical finding are summarized. Informed consent was obtained from the patient for being included in the study.
+
+## Case Report
+
+A 64-year-old Caucasian man presented for evaluation of several lesions on his scalp. His past medical history was significant for testicular cancer with lung metastasis; he had been in remission for over 20 years following treatment with chemotherapy (cisplatin) and resection of his left testicle and the right lower lobe of his lung. In addition, he had developed multiple pulmonary emboli 4 years earlier and was receiving 7.5 mg of warfarin (Coumadin) orally each day.
+
+Examination of his scalp revealed multiple actinic keratoses; these lesions were treated with liquid nitrogen cryotherapy. A complete head--
+to-toe cutaneous examination was performed and demonstrated horizontal red-colored bands affecting six of his distal fingernails (Figs. 1, 2, 3). Prominent longitudinal red bands were also observed on the fifth digit of his left hand
+(Figs. 1, 2) and the third digit of his right hand
+(Figs. 1, 3) extending from the distal curvature of the lunula to the free edge of the nail plate.
+
+The clinical presentation established the diagnoses of polydactylous transverse and longitudinal erythronychia. The red bands were asymptomatic and he was not concerned about the cosmetic appearance of his nails. Therefore, no additional investigation or treatment was required.
+
+## Discussion
+
+Erythronychia is a benign, yet common, clinical
+
+![1_image_0.png](1_image_0.png)
+
+entity characterized by red discoloration of the nails of one or multiple digits. The condition is typically asymptomatic; it may reflect discoloration of the nail plate itself or appear as a manifestation of a subungual lesion or neoplasm. Various presentations of erythronychia have been described, each of which can be classified based on location and pattern of discoloration (Table 1) [1, 4–10].
+
+![2_image_0.png](2_image_0.png)
+
+![2_image_1.png](2_image_1.png)
+
+Erythronychia has been described in both men and women. There is no distinct gender predilection. It occurs most frequently among middle-aged individuals [11], but has also been reported in patients ranging in age from 18 to 87 years [11–13].
+
+Erythronychia most commonly presents as linear red bands that extend from the proximal nail fold to the distal tip of the nail plate. This variant of erythronychia—known as ''longitudinal erythronychia''—was first described by Baran and Perrin in 2000; the investigators had identified 16 individuals with ''a red longitudinal streak found in the nail plate'' [12].
+
+Longitudinal erythronychia is classified based on the number of affected nails and the number of red bands present on each affected nail [14]. Four basic variants have been described: Type IA, Type IB, Type IIA, and Type IIB.
+
+Type IA describes a single red band affecting a single nail. Type IB refers to bifid red bands affecting a single nail. Type IIA describes a single red band affecting multiple nails, and Type IIB denotes multiple red bands affecting multiple nails.
+
+Typically, the single red bands are less than 3 mm in diameter [15]. However, single bands ranging from 4 to 6 mm wide have also been described [14]. When multiple bands are present on a single nail, the width of each band is usually less than 1 mm in diameter [14].
+
+Interestingly, longitudinal erythronychia is frequently identified in the fingernails but is rarely observed in the toenails. It has been hypothesized that discoloration affecting the subungual tissues of the toes is less likely to be visualized due to the thickness of the toenails. Alternatively, it is possible that individuals are seldom aware of changes in toenail color and thus erythronychia of the toenails is simply underdiagnosed [11, 15].
+
+Longitudinal erythronychia is typically asymptomatic. However, albeit rarely, affected individuals may seek medical attention due to pain in the affected digit, nail fragility, or concern about the cosmetic appearance of the lesions [16].
+
+Although longitudinal erythronychia is often idiopathic, it has also been associated with benign subungual tumors, malignant subungual tumors, and various cutaneous conditions and systemic diseases (Table 2)
+[1–4, 6–8, 11–13, 16–43].
+
+Monodactylous longitudinal erythronychia, when characterized by a single linear red band on a single nail, is most often reported in
+
+| Table 1 Erythronychia: classification and associated conditions [1, 4–10] Location of red color Description   | Associated conditions                                                                                                                                                    |                                                                                                                                           |
+|---------------------------------------------------------------------------------------------------------------|--------------------------------------------------------------------------------------------------------------------------------------------------------------------------|-------------------------------------------------------------------------------------------------------------------------------------------|
+| Longitudinal band located in the lunula and nail bed                                                          | Red discoloration forms a longitudinal band that traverses the proximal nail fold, extending to the distal region of the nail plate                                      | Idiopathic Benign tumors Malignant neoplasms Cutaneous conditions Systemic diseases Segmental neurofibromatosis Graft-versus-host disease |
+| Lunula                                                                                                        | Red discoloration may be observed throughout the entire lunula or it may appear only within the proximal lunula with a narrow white band separating it from the nail bed | Idiopathic Cutaneous conditions Systemic diseases                                                                                         |
+| Nail bed                                                                                                      | Red discoloration lies beneath the nail plate and extends                                                                                                                | Most commonly occurs secondary to                                                                                                         |
+| from the lunula to the proximal free edge of the nail                                                         | chemotherapeutic agents and vascular tumors                                                                                                                              |                                                                                                                                           |
+| Nail plate                                                                                                    | Red discoloration may affect a portion of the nail plate                                                                                                                 | Exogenous agents                                                                                                                          |
+| or the entire nail plate                                                                                      |                                                                                                                                                                          |                                                                                                                                           |
+| Transverse band located                                                                                       | Red discoloration forms a horizontal band that extends                                                                                                                   | Idiopathic                                                                                                                                |
+| in the nail bed                                                                                               | across the nail bed in between the lateral nail folds                                                                                                                    | Multiple system atrophy                                                                                                                   |
+
+individuals with benign subungual tumors such as glomus tumor [1, 2, 11, 12, 18, 19], onychopapilloma [2, 11, 12, 19, 20], and warty dyskeratoma [1, 12, 19, 21, 22]. Rarely, it has been associated with malignant subungual tumors, including squamous cell carcinoma and malignant melanoma [2, 6, 8, 11–13, 17–25]. Monodactylous longitudinal erythronychia has also been observed in patients with hemiplegia [3, 17] and those with postsurgical scars from distal digit surgery [11, 18].
+
+Polydactylous longitudinal erythronychia, in which there are single or multiple linear red bands affecting multiple nails, may occur among individuals with cutaneous conditions such as acantholytic dyskeratotic epidermal nevus [1, 26, 27], acantholytic epidermolysis bullosa [1, 28], acrokeratosis verruciformis of Hopf [1, 6, 29–32], Darier's disease
+[1, 2, 4, 7, 11, 12], and lichen planus [1, 2, 4, 11, 12, 33]. In addition, polydactylous longitudinal erythronychia has been associated with various systemic diseases including amyloidosis [1, 2, 12, 34–39], graft-versus-host disease [2, 34, 40–42], and pseudobulbar syndrome
+[43].
+
+The evaluation of monodactylous longitudinal erythronychia (Type IA or Type IB) typically involves assessment for local neoplastic processes [2]. A biopsy of the affected nail or subungual tissue or both may be required to establish a diagnosis [16]. Magnetic resonance imaging can also be utilized to define a local tumor [44]. Longitudinal erythronychia associated with a dermal tumor located solely within the matrix, such as a glomus tumor, can be treated via simple excision [2, 16]. However, excision of the entire nail apparatus or amputation of the affected digit may be indicated if a malignant neoplasm is discovered [16].
+
+Individuals who present with polydactylous longitudinal erythronychia (Type IIA or Type
+
+| Table 2 Conditions associated with longitudinal erythronychia [1–4, 6–8, 11–13, 17–43] Monodactylous longitudinal erythronychia Polydactylous longitudinal erythronychia Benign subungual tumors Cutaneous conditions Glomus tumor Acantholytic dyskeratotic epidermal nevus Onchyopapilloma Acantholytic epidermolysis bullosa Warty dyskeratoma Acrokeratosis verruciformis of Hopf Cutaneous conditions Darier's disease Darier's disease Lichen planus Postsurgical scar Systemic diseases Malignant subungual tumors Amyloidosis Malignant melanoma Graft-versus-host disease Subungual amelanotic melanoma Pseudobulbar syndrome Squamous cell carcinoma Systemic diseases Amyloidosis Hemiplegia   |
+|-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+
+IIB) should be evaluated for associated cutaneous conditions and systemic diseases [2]. If an underlying condition is not detected, then a biopsy may be required in order to establish a diagnosis [2]. However, the occurrence of multiple longitudinal red bands on multiple digits is usually idiopathic and requires no additional investigation [14].
+
+It is important to distinguish longitudinal erythronychia from longitudinal pseudoerythronychia. Longitudinal erythronychia is characterized by a non-blanchable red discoloration of the fingernails or toenails. In contrast, individuals who present with longitudinal pseudoerythronychia exhibit red bands that vary in intensity depending on the position of the digit relative to the heart. It has therefore been hypothesized that longitudinal pseudoerythronychia represents a manifestation of a local microcirculatory phenomena [14].
+
+Histopathologic features of longitudinal erythronychia include acanthosis of the nail bed epithelium and hyperplasia of the vascular tissue of the dermal papilla in the distal matrix. In addition, there is often a distal longitudinal papillomatosis characterized by stratified layers of fusiform eosinophilic cells arranged in a V-shape. Fibrosis and inflammatory infiltrate within the distal nail bed is common. Lastly, there is frequently a distal subungual keratosis that shows parakeratosis with acanthosis and papillomatosis, multinucleated giant cells, and no dysplasia [1, 2, 11, 12].
+
+Although erythronychia most commonly presents as longitudinal bands, our patient presented with linear pink-red bands which extended horizontally across his distal fingernails. To the best of our knowledge, this presentation of erythronychia—which may be referred to as ''transverse erythronychia''—has been described in only one other individual: a 41-year-old man with a 4-year history of multiple system atrophy who presented with horizontal red bands that traversed the lateral nail folds on all of his fingernails [8]. Investigators postulated that disturbances to microcirculatory homeostatic mechanisms secondary to multiple system atrophy may have contributed to the development of the transverse erythronychia in this individual.
+
+Longitudinal erythronychia is thought to arise due to matrix function loss and longitudinal thinning of the ventral plate [2, 11]. The thinning of the nail plate creates a longitudinal groove into which the neighboring nail bed swells, resulting in a vascular congestion that manifests as erythema. As the nail grows distally, it also becomes more susceptible to trauma from activities of daily living. The thinned nail plate may disintegrate distally, exposing the nail bed and promoting the formation of multinucleate giant cells and a protruding keratosis [2, 11].
+
+The mechanism of pathogenesis for transverse erythronychia remains to be established.
+
+However, it is widely recognized that internal and/or external thinning of the nail plate can result in erythronychia. The most common endogenous cause of focal nail plate thinning is interruption of cell division in the nail matrix; this frequently manifests as Beau's lines—horizontal grooves in the nail plate that grow with the nail. The most common external cause of erythronychia is filing or buffing of the dorsal surface of the nail plate. Elderly patients typically have thinner nails; therefore, focal erythronychia in the elderly may represent a non-pathologic process. Indeed, although we are aware of only one other report that specifically describes transverse erythronychia, transverse erythronychia may represent an incidental finding that is not commonly reported in the literature.
+
+## Conclusion
+
+Erythronychia describes a benign red discoloration affecting the nails of one or multiple digits. It is most commonly observed in the fingernails, but may occasionally affect the toenails as well. Although it is most prevalent among middle-aged men and women, erythronychia has also been reported in younger individuals and the elderly.
+
+The specific region of the nail affected in erythronychia may vary: red discoloration may appear within the nail plate, nail bed, and/or lunula. However, the most common variant of erythronychia is longitudinal erythronychia, which is characterized by a longitudinal band that travels from the proximal nail fold to the distal tip of the nail plate. Longitudinal erythronychia is classified into four categories based on the number of digits affected and the number of red bands that appear on each digit.
+
+Transverse erythronychia is characterized by linear pink-red bands that traverse the distal fingernails horizontally. This rare variant of erythronychia has been described in only two individuals, including our patient. We hypothesize that in our patient transverse erythronychia may represent an early manifestation of erythronychia that subsequently evolves into the more common longitudinal presentation.
+
+Erythronychia is frequently idiopathic, especially when it presents as one or more longitudinal red bands affecting multiple digits.
+
+However, longitudinal erythronychia can be associated with numerous local and systemic cutaneous conditions. Therefore, in addition to a complete clinical history, an evaluation of the nails or the patient or both may be warranted in individuals who present with red discoloration of their nails.
+
+## Acknowledgements
+
+No funding or sponsorship was received for this study or publication of this article. All named authors meet the International Committee of Medical Journal Editors (ICMJE) criteria for authorship for this manuscript, take responsibility for the integrity of the work as a whole, and have given final approval for the version to be published.
+
+Disclosures. Carina Chang, Bryce D. Beutler and Philip R. Cohen have nothing to disclose.
+
+Compliance with Ethics Guidelines. Informed consent was obtained from the patient for being included in the study.
+
+Data Availability. Data sharing is not applicable to this article as no datasets were generated or analyzed during the current study.
+
+Open Access. This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/
+by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.
+
+## References
+
+1. Baran R. The red nail—always benign? Actas Dermosifiliogr. 2009;100:106–13 (PMID: 20096204). 2. Jellinek NJ. Longitudinal erythronychia: suggestions for evaluation and management. J Am Acad Dermatol. 2011;64:167e1–11 (PMID: 20709428).
+
+3. Siragusa M, Schepis C, Palazzo R, Fabrizi G, Guarneri B, Del Gracco S, Spada RS, Ferri R. Skin pathology findings in a cohort of 1500 adult and elderly subjects. Int J Dermatol. 1999;38:361–6
+(PMID: 10369546).
+
+4. Baran R. Red nails [abstract]. European Nail Society Meeting. 2004 Nov 17; Florence. Dermatol Online J.
+
+2005;11(1):9.
+
+5. Cohen PR. Red lunula: case report and literature review. J Am Acad Dermatol. 1992;26:292–4 (PMID: 2645322).
+
+6. Baran R, Dawber RPR, Richert B. Physical signs. In:
+Baran R, Dawber RPR, de Berker DAR, et al., editors. Baran and Dawber's diseases of the nails and their management, chap 2. 3rd ed. Osney Mead: Blackwell; 2001. p. 48–103.
+
+7. Cohen PR. The lunula. J Am Acad Dermatol.
+
+1996;34:943–53 (PMID: 8647987).
+
+8. Siragusa M, Del Gracco S, Elia M, Ferri R, Schepis C.
+
+Peculiar dyschromic changes of finger nails in a patient with multiple system atrophy [letter]. Int J Dermatol. 1998;37:156–60 (PMID: 9542679).
+
+9. Cohen PR. Incidental (malignancy) and coincidental (idiopathic polydactylous longitudinal erythronychia) conditions in patients with segmental neurofibromatosis. Cutis. 2013;91(4):179–80 (PMID: 23763076).
+
+10. Cohen PR. Longitudinal erythronychia associated with graft-versus-host disease. Skinmed.
+
+2011;9(5):327–9 (PMID: 22165051).
+
+11. de Berker DA, Perrin C, Baran R. Localized longitudinal erythronychia: diagnostic significance and physical explanation. Arch Dermatol. 2004;140:1253–7 (PMID: 15492189).
+
+12. Baran R, Perrin C. Longitudinal erythronychia with distal subungual keratosis: onychopapilloma of the nail bed and Bowen's disease. Br J Dermatol.
+
+2000;143:132–5 (PMID: 10886147).
+
+13. Harwood M, Telang GH, Robinson-Bostom L, Jellinek N. Melanoma and squamous cell carcinoma on different nails of the same hand. J Am Acad Dermatol. 2008;58:323–6 (PMID: 18222331).
+
+14. de Berker D. Erythronychia. Dermatol Ther.
+
+2012;25:603–11 (PMID: 23210759).
+
+15. Cohen PR. Idiopathic polydactylous longitudinal erythronychia. J Clin Aesthet Dermatol. 2011;4(4):22–8 (PMID: 21532874).
+
+16. Cohen PR. Longitudinal erythronychia: individual or multiple linear red bands of the nail plate: a review of clinical features and associated conditions. Am J Clin Dermatol. 2011;12:217–31 (PMID:
+21668031).
+
+17. Siragusa M, Schepis C, Cosentino FI, Spada RS, Toscano G, Ferri R. Nail pathology in patients with hemiplegia. Br J Dermatol. 2001;144:557–60 (PMID:
+11260014).
+
+18. Abimelec P, Dumontier C. Basic and advanced nail surgery: part 2. Indications and complications.
+
+Chapter 24. In: Scher RK, Daniel III CR, editors.
+
+Nails: diagnosis, therapy, surgery. 3rd ed. 2005; Philadelphia: Elsevier Saunders. p. 291–308.
+
+19. Baran R, Haneke E, Drape J-L, Zook EG, Kreusch JF.
+
+Tumours of the nail apparatus and adjacent tissues.
+
+Chapter 11. In: Baran R, Dawber RPR, de Berker DAR, et al., editors. Baran and Dawber's diseases of the nails and their management. 3rd ed. 2001; Osney Mead: Blackwell. p. 515–630.
+
+20. Baran R, Perrin C. Localized multinucleate distal subungual keratosis. Br J Dermatol. 1995;133:77–82 (PMID: 7669645).
+
+21. Higashi N. Focal acantholytic dyskeratosis. Hifu.
+
+1990;32:507–10.
+
+22. Baran R, Perrin C. Focal subungual warty dyskeratoma. Dermatology. 1997;195:278–80 (PMID:
+9407181).
+
+23. Cogrel O, Beylot-Barry M, Doutre MS. Subungual squamous cell carcinoma revealed by longitudinal erythronychia. Ann Dermatol Venereol. 2008;135:883–5 (PMID: 19084707).
+
+24. Reuter G, Keller F, Samama B, Boehm N. Maladie de Bowen ungueale a type d'erythronychie longitudinale: aspect dermoscopique et etude virologique.
+
+Ann Dermatol Venereol. 2005;132:569.
+
+25. Dalle S, Depape L, Phan A, Balme B, Ronger-Savle S,
+Thomas L. Squamous cell carcinoma of the nail apparatus: clinicopathological study of 35 cases. Br J Dermatol. 2007;156:871–4 (PMID: 17263801).
+
+26. Munro CS, Cox NH. An acantholytic dyskeratotic epidermal naevus with other features of Darier's disease on the same side of the body. Br J Dermatol.
+
+1992;127:168–71 (PMID: 1390147).
+
+27. Cambiaghi S, Brusasco A, Grimalt R, Caputo R.
+
+Acantholytic dyskeratotic epidermal nevus as a mosaic form of Darier's disease. J Am Acad Dermatol. 1995;32:284–6 (PMID: 7829719).
+
+28. Hoffman MD, Fleming MG, Pearson RW. Acantholytic epidermolysis bullosa. Arch Dermatol.
+
+1995;131:586–9 (PMID: 7741547).
+
+29. Dhitavat J, Macfarlane S, Dode L, Leslie N, Sakuntabhai A, MacSween R, Saihan E, Hovnanian A.
+
+Acrokeratosis verruciformis of Hopf is caused by mutation in ATP2A2: evidence that it is allelic to Darier's disease. J Invest Dermatol. 2003;120:229–32 (PMID: 12542527).
+
+30. Juhlin L, Baran R. Hereditary and congenital nail disorders. Chapter 9. In: Baran R, Dawber RPR, de Berker DAR, et al., editors. Baran and Dawber's diseases of the nails and their management. 3rd ed. 2001; Osney Mead: Blackwell. p. 370–424.
+
+31. Berk DR, Taube JM, Bruckner AL, Lane AT. A sporadic patient with acrokeratosis verruciformis of Hopf and a novel ATP2A2 mutation [letter]. Br J Dermatol. 2010;163:653–4 (PMID: 20518781).
+
+32. Rallis E, Economidi A, Papadakis P, Verros C.
+
+Acrokeratosis verruciformis of Hopf (Hopf disease): case report and review of the literature. Dermatol Online J. 2005;11(2):10 (PMID: 16150218).
+
+33. de Berker DAR, Baran R, Dawber RPR. The nail in dermatological diseases, Chap 5. In: Baran R, Dawber RPR, de Berker DAR, et al., editors. Baran and Dawber's diseases of the nails and their management. 3rd ed. 2001; Osney Mead: Blackwell.
+
+p. 172–222.
+
+34. Tosti A, Baran R, Dawber RPR. The nail in systemic diseases and druginduced changes, Chap 6. In:
+Baran R, Dawber RPR, de Berker DAR, et al., editors.
+
+Baran and Dawber's diseases of the nails and their management. 3rd ed. 2001; Osney Mead: Blackwell. p. 223–329.
+
+35. Mancuso G, Fanti PA, Berdondine RM. Nail changes as the only skin abnormality inmyeloma-associated systemic amyloidosis [letter]. Br J Dermatol.
+
+1997;137:471–2 (PMID: 9349355).
+
+36. Cholez C, Cuny J-F, Pouaha J, Thomas P, Tromp G,
+Truchetet F. Nail abnormalities and scleroderma-like lesions on the face associated with systemic amyloidosis. Ann Dermatol Venereol.
+
+2005;132:252–4 (PMID: 15924049).
+
+37. Derrick EK, Price ML. Primary systemic amyloid with nail dystrophy. J R Soc Med.
+
+1995;88(5):290P–1P (PMID: 7636826).
+
+38. Prat C, Moreno A, Vinas M, Jucgla A. Nail dystrophy in primary systemic amyloidosis [letter]. J Eur Acad Dermatol Venereol. 2008;22:107–9 (PMID:
+18181984).
+
+39. Desirello G, Nazzari G, Stradini D, Fusco F, Crovato F. Primary amyloidosis. G Ital Dermatol Venereol.
+
+1988;123:99–101 (PMID: 3410506).
+
+40. Sanli H, Arat M, Oskay T, Gurman G. Evaluation of nail involvement in patients with chronic cutaneous graft versus host disease: a single-center study from Turkey. Int J Dermatol. 2004;43:176–80 (PMID: 15009386).
+
+41. Palencia SI, Rodriguez-Peralto JL, Castano E, Vanaclocha F, Iglesias L. Lichenoid nail changes as sole external manifestation of graft vs. host disease. Int J
+Dermatol. 2002;41:44–5 (PMID: 11895513).
+
+42. Liddle BJ, Cowan MA. Lichen planus-like eruption and nail changes in a patient with graft-versus-host disease [letter]. Br J Dermatol. 1990;122:841–3
+(PMID: 2369565).
+
+43. Siragusa M, Del Gracco S, Ferri R, Schepis C. Longitudinal red streaks on the big toenails in a patient with pseudobulbar syndrome [letter]. J Eur Acad Dermatol Venereol. 2001;15(1):85–6 (PMID: 11451339).
+
+44. Drape JL. Imaging of the tumors of the perionychium. Hand Clin. 2002;18:655–70 (PMID:
+12516980).

medical/md/PMC5744730.md

@@ -0,0 +1,304 @@
+Original
+
+![0_image_1.png](0_image_1.png)
+
+![0_image_2.png](0_image_2.png)
+
+![0_image_3.png](0_image_3.png)
+
+![0_image_4.png](0_image_4.png) Article
+Endocrinol Metab 2017;32:442-450 https://doi.org/10.3803/EnM.2017.32.4.442 pISSN 2093-596X · eISSN 2093-5978
+
+# Changes In Body Composition According To Age And Sex 
+
+![0_Image_0.Png](0_Image_0.Png) Among Young Non-Diabetic Korean Adults: The Kangbuk Samsung Health Study
+
+Seul-Ki Kim1, Yu-Hyun Kwon1, Jung Hwan Cho1, Da Young Lee2, Se Eun Park1, Hyung-Geun Oh3, Cheol-Young Park1, Won-Young Lee1, Ki-Won Oh1, Sung-Woo Park1, Eun-Jung Rhee1 1Division of Endocrinology and Metabolism, Department of Internal Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul; 2Division of Endocrinology and Metabolism, Department of Internal Medicine, Korea University Ansan Hospital, Korea University College of Medicine, Ansan; 3Department of Neurology, Soonchunhyang University Cheonan Hospital, Soonchunhyang University College of Medicine, Cheonan, Korea Background: Age-related decreases in lean mass represent a serious health problem. We aimed to analyze the risks of rapid decreases in lean mass by age and sex in relatively young Korean adults during a 4-year follow-up study. Methods: A total of 65,856 non-diabetic participants (59.5% men, mean age 39.1 years) in a health screening program were subjected to bioimpedance body composition analyses and metabolic parameter analyses at baseline and after 4 years. The participants were sub-divided according to age, and additionally to six groups by age and the degree of body weight change over the 4-year period. The actual changes in body weight, lean mass, and fat mass and the percent changes over the 4-year period were assessed. Results: The percent change in lean mass decreased and the percent change of fat mass increased with increasing age in every age and sex group. However, the annual percent decrease in lean mass and percent increase in fat mass were significantly higher among women than among men (–0.26% vs. –0.15% and 0.34% vs. 0.42%, respectively; P<0.01). Participants who were older than 50 years and had a weight loss <–5% during the 4 years had significantly greater decreases in lean mass and smaller decreases in fat mass, compared to those who were younger than 50 years. An odds ratio analysis to determine the lowest quartile of the percent change in lean mass according to age group revealed that participants older than 60 years had a significantly increased risk of a rapid decrease in the lean mass percentage (2.081; 95% confidence interval, 1.678 to 2.581). Conclusion: Even in this relatively young study population, the lean mass decreased significantly with age, and the risk of a rapid decrease in lean mass was higher among women than among men. Furthermore, the elderly exhibited a significantly more rapid decrease in lean mass, compared with younger participants.
+
+Keywords: Sarcopenia; Lean mass; Aging; Sex
+
+## Introduction
+
+The prevalence of obesity is increasing markedly worldwide, Received: 19 June 2017, **Revised**: 14 August 2017, **Accepted:** 26 September 2017 Corresponding author: Eun-Jung Rhee Division of Endocrinology and Metabolism, Department of Internal Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, 29 Saemunan-ro, Jongno-gu, Seoul 03181, Korea Tel: +82-2-2001-2485, **Fax:** +82-2-2001-1588, **E-mail:** hongsiri@hanmail.net and nearly 30% of adults older than 30 years are obese, according to current estimations [1]. However, weight gain is a complex phenomenon, as the body comprises complex components Copyright © 2017 Korean Endocrine Society This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/ licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
+
+Endocrinol Metab 2017;32:442-450 https://doi.org/10.3803/EnM.2017.32.4.442 pISSN 2093-596X · eISSN 2093-5978 such as fat, muscle, water, and bone. A simple increase in weight might be due to an increase in body fat, but might also be attributable to an increase in muscle mass or water uptake, which might have entirely different consequences from an increase in fat [2]. The results of recent studies suggest complicated interpretations of weight changes that are based on novel hypotheses, such as the existence of 'metabolically healthy obesity' or 'sarcopenic obesity' [3-5]. These concepts are very important to our understanding of the changes in body composition during aging.
+
+Weight loss is frequently observed in the elderly and is a unilaterally strong predictor of mortality [6,7]. This phenomenon might reflect difficulties with homeostatic maintenance in older age [8]. Elderly individuals experiencing weight loss would be expected to exhibit decreases in both the lean body mass and fat mass [9], and previous studies have shown that this decrease is more pronounced in lean body mass [6]. Normally, the lean body mass peaks in the third to fourth decade of life, followed by a steady decline with further aging [10,11]. In contrast, body weight increases until approximately 60 years of age, after which time ≥60% of the population will experience a decrease in weight. Therefore, fat mass accumulates during midlife [12,13]. However, older people regulate weight less effectively than to younger people because the older people are less able to conserve lean mass during weight loss [14].
+
+According to several previous studies, sex might have affect the decrease in lean mass with aging [15,16]. Compared with men, women experience more complicated changes in body composition as they pass through menopause, including an abrupt decline in estrogen production [17]. Because estrogen exerts multiple protective effects against metabolic disorders such as visceral obesity, osteoporosis, and atherosclerosis, women suffer from various metabolic diseases that lead to an increased risk of cardiovascular mortality after menopause [18,19]. 
+
+Studies have suggested sex- and age-related associations of weight changes with new-onset disabilities [20-23]. Nevertheless, it remains controversial whether changes in body composition differ by age or sex. Therefore, in this study we aimed to analyze the changes of body weight and body composition during a 4-year follow-up study.
+
+## Methods Subjects
+
+This is a retrospective single-center study conducted as part of the Kangbuk Samsung Health Study, which included partici-
+  443 pants in a medical health checkup program at the Health Promotion Center of Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Korea. Most study participants were the employees of various industrial companies around the country, as well as their family members. The medical health checkup programs were implemented to promote employee health through regular checkups and to enhance the early detection of existing diseases. 
+
+The initial study population comprised 69,143 participants who participated in the medical checkup program between January and December 2010, as well as a repeated medical checkup between January and December 2014. Participants with diabetes in 2010 or missing values were excluded from the study. Finally, a total of 65,856 participants were enrolled in the initial study. The study protocol was approved by the Institutional Review Board of Kangbuk Samsung Hospital (KBSMC 2014-11030). The requirement for informed consent was waived because the study used non-identified data that were routinely collected during the health screening process.
+
+## Anthropometric Measurements And Laboratory Assessments
+
+Medical history, medication use, and health-related behavioral data were collected using a self-administered questionnaire. Physical and serum biochemical parameters were measured by trained staff during the health examinations. A current smoker was defined as a participant who replied "yes" to the question "Do you smoke currently?" on the self-questionnaire. Body weight was measured to the nearest 0.1 kg using a digital scale while the participant wore light clothing without shoes. Height was measured to the nearest 0.1 cm. The body mass index (BMI) was calculated as the weight in kilograms divided by the height in meters squared. Trained nurses used standard mercury sphygmomanometers to measure the participants' seated blood pressure. 
+
+All participants were examined after an overnight fast. The hexokinase method was used to measure fasting serum glucose concentrations (Hitachi Modular D2400, Roche, Tokyo, Japan). An enzymatic calorimetric test was used to measure the total cholesterol and triglyceride concentrations. The high and low density lipoprotein cholesterol concentrations were measured using the selective inhibition and a homogeneous enzymatic calorimetric test, respectively. The serum insulin level was measured using an electrochemiluminescence immunoassay and a Modular Analytics E170 device (Roche).
+
+The presence of diabetes mellitus was determined according to the participants' self-questionnaire responses and fasting serum blood glucose and glycated hemoglobin (HbA1c) levels, as suggested by the American Diabetes Association [24]. In brief, diabetes was defined as a fasting serum glucose level of ≥126 mg/dL or HbA1c of ≥6.5%, a self-reported history of diabetes, or the current use of antidiabetic medication. 
+
+## Body Composition Analysis
+
+The participants' body compositions were measured using segmental bioelectric impedance analysis (BIA) with eight tactile electrodes according to the manufacturer's instructions (InBody 3.0, Biospace, Seoul, Korea). The lean mass (kg), fat mass (kg), percent fat mass (%), and waist-hip ratio were measured. BIA is a useful and well-correlated measurement of body fat relative to lean mass [25,26]. The analyzer calculates the participant's tissue and fluid compartments using an imperceptible electrical current passed through pads placed on one hand and foot. The analyzer uses the measured resistance and reactance values to mathematically calculate the lean mass using the formula V=ρ×H²/R, where the conductive volume (V) represents the lean mass, ρ is the specific resistivity of the conductor, height (H) is the length of the conductor, and body resistance (R) is measured using four surface electrodes placed on the right hand and foot [27].
+
+## Statistical Analysis
+
+The participants were divided into two groups according to either an age cutoff of 50 years or sex, and into four groups according to age (<40, 40 to 49, 50 to 60, and >60 years old). In addition, the participants were divided into six groups by age 
+(<50 years vs. >50 years) and the degree of body weight change during the 4-year period (<–5%, –5% to 5%, and >5%). 
+
+We compared the weight loss, lean mass loss, and fat mass loss among these six subgroups based on the lowest quartile.
+
+Data are presented as mean±standard deviation or number with percentages. A one-way analysis of variance and the chisquare test were used to compare changes in the metabolic parameters from the baseline to the 4-year follow-up, as well as the baseline characteristics of the study participants by age and degree of weight change. Tukey B method was used for the *post* hoc analyses. 
+
+A logistic regression analysis was performed to evaluate the odds ratio (OR) for a rapid annual decrease in lean mass, defined as members in the lowest quartile of the annual percent change in lean mass among different age groups. The cutoffs for quartile groups of annual percent change in lean mass were as follows: <–0.54%, –0.54% to –0.15%, –0.16% to 0.23%, and 
+>0.23% in men; <–0.67%, –0.67% to –0.25%, –0.26% to 0.17%, 
+and >0.17% in women. A stepwise regression model was used for this analysis. 
+
+PASW Statistics version 23.0 (IBM Co., Armonk, NY, USA) 
+was used for the statistical analyses. All reported P values are two-tailed, and a P value <0.05 was considered statistically significant. 
+
+## Results
+
+The general characteristics of the participants at baseline are presented in Table 1. The mean age of the participants was 39 
+
+| Table 1. General Characteristics of the Participants at Baseline  and after 4 Years (n=65,856) Variable Value Age, yr 39.1±6.5 Male sex 39,156 (59.5) Fasting blood glucose, mg/dL 92.1±8.6 Aspartate aminotransferase, IU/L 22.9±34.5 Alanine aminotransferase, IU/L 23.9±31.1 Total cholesterol, mg/dL 195.4±33.7 Triglyceride, mg/dL 115.5±76.5 High density lipoprotein cholesterol, mg/dL 56.4±13.8 Low density lipoprotein cholesterol, mg/dL 117.5±30.6 Glycated hemoglobin, % 5.59±0.3 Systolic blood pressure, mm Hg 113.7±12.6 Diastolic blood pressure, mm Hg 72.2±9.3 Body weight, kg 66.1±12.2 Body mass index, kg/m2 23.3±3.1 Muscle mass, kg 46.9±9.2 Body fat mass, kg 16.4±5.3 Body weight change, kg 0.36±3.4 Percent change of body weight, % 0.64±5.1 Lean mass change, kg –0.50±1.7 Percent change of lean mass, % –0.78±2.6 Annual percent change of lean mass, % –0.19±0.6 Fat mass change, kg 0.91±2.9 Percent change of fat mass, % 1.48±4.4 Annual percent change of fat mass, % 0.37±1.1 Regular exercise 15,184 (23.1) Current smoker 14,480 (22.0) Alcohol consumption 10,930 (16.6) Values are expressed as mean±SD or number (%).   |
+|--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+
+![3_image_0.png](3_image_0.png)
+
+years, and 59.5% were men. The mean BMI of the participants was 23.3 kg/m2, or slightly overweight.
+
+## Changes Of Metabolic Parameters At Baseline And 4-Year
+
+follow-up according to age cutoff of 50 years and gender Over the 4-year interval, the overall changes in body weight were 0.40 kg among participants younger than 50 years and –0.34 kg among those 50 years or older (Table 2). Both the change in lean mass and percent change in lean mass were significantly greater in the older group (–0.92 kg vs. –0.48 kg and 
+–1.41% vs. –0.74%, respectively; P<0.01) (Table 2). Additionally, the change in fat mass and percent change in fat mass were significantly smaller in the older group (0.71 kg vs. 0.92 kg and 1.16% vs. 1.50%, respectively; P<0.01) (Table 2). 
+
+When the participants were divided into two groups by sex, the change in lean mass and percent change in lean mass were significantly greater in women relative to men (–0.58 kg vs. 
+
+–0.46 kg and –1.03% vs. –0.61%, respectively; P<0.01) (Table 2). Furthermore, women had a significantly greater percent increase in fat mass, compared with men (1.66% vs. 1.36%, P<
+0.01) (Table 2).
+
+## Comparison Of The Mean Metabolic Parameter Values Among The Groups Divided By Age And Weight Change
+
+The subjects were divided into six groups by age (cutoff, 50 years) and body weight loss degree (<–5%, –5% to 5%, and 
+>5%) over 4 years (Table 3). Of the 65,856 participants, most exhibited weight changes within the range of –5% to 5% (n=47,583, 72.2%); 11.1% (n=7,364) had weight changes <–5%, and 16.7% (n=10,909) had weight changes >5% (Table 3). 
+
+Participants aged ≥50 years had significantly greater absolute losses in lean mass relative to those aged <50 years in both the 
+<–5% and –5% to 5% weight change groups (–1.92 kg vs. 
+
+–2.20 kg and –0.57 kg vs. –0.88 kg, respectively; P<0.01) (Table 3, Fig. 1). Similar results were observed for the percent change in lean mass (–2.81% vs. –3.29% and –0.89% vs. 
+
+–1.36%, respectively; P<0.01). Otherwise, the absolute and percent losses of fat mass were significantly smaller among those aged ≥50 years versus those aged <50 years in the <–5% 
+weight change group (–2.41 kg vs. –3.49 kg and –3.62% vs. 
+
+–5.06%, respectively; P<0.01). Among participants who gained weight (>5%) during the 4-year period, the absolute and percent changes in lean mass were significantly smaller among participants aged ≥50 years than among those aged <50 years (0.60 kg vs. 0.83 kg and 0.89% vs. 1.25%, respectively; P<
+0.01) (Table 3, Fig. 1).
+
+## Changes Over Time In The Percent Changes Of Lean Mass And Fat Mass By Age And Sex
+
+Greater percent decreases in lean mass over the 4-year period were observed with increasing age, regardless of sex (Fig. 2). However, women experienced a greater percent decrease in lean 
+
+| Table 2. Baseline Values and Changes in Metabolic Parameters during the 4-Year Follow-up Period Variable <50 yr (n=62,132) ≥50 yr (n=3,724) P value Men (n=39,156)   | Women (n=26,700)   | P value      |       |           |           |       |
+|----------------------------------------------------------------------------------------------------------------------------------------------------------------------|--------------------|--------------|-------|-----------|-----------|-------|
+| Age, yr                                                                                                                                                              | 38.2±5.4           | 54.5±5.3     | <0.01 | 39.5±6.6  | 38.5±6.3  | <0.01 |
+| Male sex                                                                                                                                                             | 36,703 (59.1)      | 2,453 (65.9) | <0.01 | -         | -         | -     |
+| Body weight, kg                                                                                                                                                      | 66.1±12.3          | 65.4±10.1    | <0.01 | 72.9±9.8  | 56.0±7.7  | <0.01 |
+| Body mass index, kg/m2                                                                                                                                               | 23.3±3.1           | 23.8±2.6     | <0.01 | 24.4±2.9  | 21.8±2.8  | <0.01 |
+| Muscle mass, kg                                                                                                                                                      | 46.9±9.3           | 46.1±8.3     | <0.01 | 53.2±5.7  | 37.6±3.8  | <0.01 |
+| Body fat mass, kg                                                                                                                                                    | 16.4±5.4           | 16.5±4.8     | 0.04  | 16.5±5.5  | 16.2±5.1  | <0.01 |
+| Body weight change, kg                                                                                                                                               | 0.40±3.5           | –0.34±2.7    | <0.01 | 0.40±3.5  | 0.30±3.3  | 0.52  |
+| Percent change of body weight, %                                                                                                                                     | 0.70±5.2           | –0.45±4.1    | <0.01 | 0.65±4.8  | 0.62±5.6  | <0.01 |
+| Lean mass change, kg                                                                                                                                                 | –0.48±1.7          | –0.92±1.7    | <0.01 | –0.46±1.8 | –0.58±1.5 | <0.01 |
+| Percent change of lean mass, %                                                                                                                                       | –0.74±2.5          | –1.41±2.5    | <0.01 | –0.61±2.5 | –1.03±2.7 | <0.01 |
+| Annual percent change of lean mass, kg                                                                                                                               | –0.18±0.6          | –0.35±0.6    | <0.01 | –0.15±0.6 | –0.26±0.7 | <0.01 |
+| Fat mass change, kg                                                                                                                                                  | 0.92±2.9           | 0.71±2.4     | <0.01 | 0.93±2.9  | 0.88±2.9  | 0.04  |
+| Percent change of fat mass, %                                                                                                                                        | 1.50±4.4           | 1.16±3.7     | <0.01 | 1.36±3.9  | 1.66±5.0  | <0.01 |
+| Annual percent change of fat mass, kg                                                                                                                                | 0.38±1.1           | 0.29±0.9     | <0.01 | 0.34±1.0  | 0.42±1.2  | <0.01 |
+| Values are expressed as mean±SD or number (%).                                                                                                                       |                    |              |       |           |           |       |
+
+| Table 3. Comparison of Mean Metabolic Parameter Values among the Groups Divided by Age and Weight Changea                                                                                                                                                                                                                                                                                                                 | Age ≥50 yr and  weight change  >5%  (n=299)   |            |               |              |              |            |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|-----------------------------------------------|------------|---------------|--------------|--------------|------------|
+| Age, yr                                                                                                                                                                                                                                                                                                                                                                                                                   | 38.2±5.4                                      | 55.1±5.9   | 38.6±5.3      | 54.4±5.3     | 36.7±5.3     | 54.2±5.1   |
+| Male sex                                                                                                                                                                                                                                                                                                                                                                                                                  | 3,634 (52.5)                                  | 297 (67.3) | 27,149 (60.9) | 1,978 (66.3) | 5,920 (55.8) | 178 (59.5) |
+| Body weight, kg                                                                                                                                                                                                                                                                                                                                                                                                           | 68.2±12.8                                     | 66.5±10.5  | 66.3±12.3     | 65.5±9.9     | 64.1±11.8    | 62.7±10.1  |
+| Body mass index, kg/m2                                                                                                                                                                                                                                                                                                                                                                                                    | 26.3±3.2                                      | 24.3±2.7   | 23.3±3.1      | 23.8±2.6     | 22.6±3.1     | 22.9±2.7   |
+| Muscle mass, kg                                                                                                                                                                                                                                                                                                                                                                                                           | 46.8±9.6                                      | 46.5±8.6   | 47.2±9.2      | 46.2±8.2     | 45.9±9.1     | 44.3±8.1   |
+| Body fat mass, kg                                                                                                                                                                                                                                                                                                                                                                                                         | 18.5±5.6                                      | 17.2±4.8   | 16.3±5.2      | 16.5±4.8     | 15.4±5.5     | 15.7±5.0   |
+| Body weight change, kg                                                                                                                                                                                                                                                                                                                                                                                                    | –5.55±2.6                                     | –4.83±1.7  | 0.15±1.7      | –0.18±1.6    | 5.32±2.4     | 4.73±1.7   |
+| Percent change of body weight, %                                                                                                                                                                                                                                                                                                                                                                                          | –8.10±3.1                                     | –7.25±2.3  | 0.25±2.6      | –0.26±2.5    | 8.34±3.5     | 7.61±2.7   |
+| Lean mass change, kg                                                                                                                                                                                                                                                                                                                                                                                                      | –1.92±1.7                                     | –2.20±1.6  | –0.57±1.5     | –0.88±1.5    | 0.83±1.6     | 0.60±1.5   |
+| Percent change of lean mass, %                                                                                                                                                                                                                                                                                                                                                                                            | –2.81±2.4                                     | –3.29±2.4  | –0.89±2.2     | –1.36±2.3    | 1.25±2.5     | 0.89±2.4   |
+| Annual percent change of lean mass, %                                                                                                                                                                                                                                                                                                                                                                                     | –0.70±0.6                                     | –0.82±0.6  | –0.22±0.6     | –0.34±0.6    | 0.31±0.6     | 0.22±0.6   |
+| Fat mass change, kg                                                                                                                                                                                                                                                                                                                                                                                                       | –3.49±2.6                                     | –2.41±2.1  | 0.77±1.9      | 0.84±1.9     | 4.44±2.3     | 4.13±2.0   |
+| Percent change of fat mass, %                                                                                                                                                                                                                                                                                                                                                                                             | –5.06±3.6                                     | –3.62±3.1  | 1.22±2.9      | 1.31±2.9     | 7.00±3.6     | 6.74±3.4   |
+| Annual percent change of fat mass, %                                                                                                                                                                                                                                                                                                                                                                                      | –1.27±0.9                                     | –0.90±0.8  | 0.30±0.7      | 0.33±0.7     | 1.75±0.9     | 1.69±0.9   |
+| Regular exercise                                                                                                                                                                                                                                                                                                                                                                                                          | 1,613 (23.3)                                  | 100 (22.7) | 994 (22.3)    | 718 (24.1)   | 2,716 (25.6) | 93 (31.1)  |
+| Current smoker                                                                                                                                                                                                                                                                                                                                                                                                            | 1,275 (18.4)                                  | 66 (15.0)  | 9,940 (22.3)  | 494 (16.6)   | 2,627 (24.8) | 78 (26.1)  |
+| Alcohol consumption                                                                                                                                                                                                                                                                                                                                                                                                       | 1,101 (15.9)                                  | 92 (20.9)  | 7,552 (16.9)  | 678 (22.7)   | 1,441 (13.6) | 66 (22.1)  |
+| Values are expressed as mean±SD or number (%). a Mean values of all groups were significantly different when analyzed by one-way analysis of variance test.  Age <50 yr and  weight change  Variable <–5%  (n=6,923) Age ≥50 yr and  weight change  <–5%  (n=441) Age <50 yr and  weight change  –5% to 5%  (n=44,599) Age ≥50 yr and  weight change  –5% to 5%  (n=2,984) Age <50 yr and  weight change  >5%  (n=10,610) |                                               |            |               |              |              |            |
+
+![4_image_0.png](4_image_0.png)
+
+Fig. 1. Comparison of the mean percent change of body weight, lean mass, and fat mass among three groups divided by the percent weight change over 4 years and age at baseline.
+
+mass relative to men, and older participants (≥50 years) experienced a greater decrease relative to younger participants. Regarding fat mass, women of all age groups younger than 60 years had similar differences in the percent change in fat mass over 4 years, whereas those aged ≥60 had a relatively smaller percent increase in fat mass. Among men, the percent increase in fat mass began to decrease from age 40 to 49 years and exhibited a similar trend thereafter (Fig. 2). 
+
+## Risk For Rapid Annual Decrease Of Lean Mass
+
+When the ORs for a rapid decrease in the percent lean mass, defined as members in the lowest quartile of the percent change in 446  
+
+![5_image_0.png](5_image_0.png)
+
+| Table 4. Odds Ratios for a Rapid Annual Decrease in Lean Mass (Lowest Quartilea ) No. of subjects (%) Model 1 Model 2                                                                                                                                                                                                                           | Model 3             | Model 4             |                     |                     |                     |
+|-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|---------------------|---------------------|---------------------|---------------------|---------------------|
+| 30s                                                                                                                                                                                                                                                                                                                                             | 8,361/53,829 (23.3) | 1.000               | 1.000               | 1.000               | 1.000               |
+| 40s                                                                                                                                                                                                                                                                                                                                             | 6,810/26,303 (25.9) | 1.148 (1.106–1.191) | 1.148 (1.106–1.191) | 1.205 (1.143–1.271) | 1.200 (1.134–1.270) |
+| 50s                                                                                                                                                                                                                                                                                                                                             | 1,038/3,135 (33.1)  | 1.626 (1.504–1.759) | 1.627 (1.504–1.760) | 1.576 (1.436–1.730) | 1.573 (1.422–1.741) |
+| ≥60s                                                                                                                                                                                                                                                                                                                                            | 223/589 (37.9)      | 2.002 (1.692–2.369) | 2.000 (1.690–2.367) | 1.921 (1.585–2.328) | 2.081 (1.678–2.581) |
+| Model 1, no adjustment; Model 2, adjusted for sex, body mass index; Model 3, adjusted for model 2 plus fat mass, lean mass, glycated hemoglobin, and  waist circumference; Model 4, model 3 plus exercise, alcohol drinking, and smoking status. a The cutoffs for the lowest quartile groups are as follows: <–0.54% in men, <–0.67% in women. |                     |                     |                     |                     |                     |
+
+lean mass, were analyzed in different age groups, we observed a significantly increase in the OR with age (Table 4). Participants aged ≥60 years had a more than 2-fold increased risk of a rapid decrease in the percent lean mass, compared to those aged ≤40 years old after adjusting for confounding variables (OR, 2.081; 95% confidence interval, 1.678 to 2.581) (Table 4). 
+
+## Discussion
+
+In this large population study of young, non-diabetic Korean participants in a health check-up program, we found that the percent change in lean mass decreased and the percent change in fat mass increased as the participants aged. When participants were divided into two groups according to an age cutoff of 50 years, those older than 50 years had a significantly greater decrease in lean mass relative to those younger than 50 years. In addition, the decrease in lean mass with aging was more prominent among women than among men. 
+
+In aging humans, the muscle mass decreases despite an increase in body weight [28,29]. Recent studies have shown significant associations between sarcopenia, muscle mass and 
+  447 strength, and increased mortality in the elderly [30,31]. A decreased muscle mass results in a decrease in the muscle strength needed to support the skeletal structure, leading to reduced bone mass and an increased incidence of osteoporosis in the elderly 
+[32]. Most studies of the relationship of muscle mass and strength with metabolic disease have been performed in the elderly. By contrast, the results of our study suggest the importance of muscle mass maintenance, even in a relatively young population.
+
+In our study, women had a significantly higher tendency toward a decreased lean mass with increasing age, compared with men. Women generally have a greater proportion of fat tissue and smaller proportion of lean mass, compared with men [33]. Therefore, one might assume that women would experience smaller weight losses relative to men because of this remaining fat mass. This supposition has been proven in several previous studies [7,15,28,34]. However, women in our study population had greater weight losses relative to men. This difference might be attributable to the relatively younger population of female participants, compared to those in other previous studies. The mean age of our study population was 39.1 years, and most female participants were perimenopausal. Data from cross-sectional and longitudinal studies suggest that the greatest rate of 
+
+![6_image_0.png](6_image_0.png)
+
+decline in lean mass may occur during the perimenopausal years, followed by a more gradual decline thereafter [35,36]. 
+
+One strength of our study is the demonstration for the first time that even among young women, weight loss would lead to a greater loss of lean mass with increasing age. Postmenopausal women often experience a decrease in lean mass and increase in fat mass [37], and often an increase in body weight. However, our study observed a steady decrease in body weight and a decrease in fat mass with aging among women. This difference might be attributable to racial differences between the Asian women who participated in our study and women of Caucasian or African descent who participated in previous studies, or to other individual medical factors such as the use of hormone replacement therapy [38,39].
+
+Our study also has a few limitations. First, this was a singlecenter study, and therefore may not be generalizable to the entire Korean population. Second, as we did not consider individual medication histories, we could evaluate the potential effects of medications such as hormone replacement therapy. Third, the 4-year follow-up period was fairly short, and a longer follow-up is needed to investigate actual patterns of changes in body composition. Lastly, we excluded patients with diabetes at baseline to avoid bias, but did not absolutely exclude other diseases that could influence body weight, such as chronic kidney disease [40], albuminuria [41], or hidden malignancy [42], because our study based on medical checkup program in apparently healthy young people. In fact, there were relatively small numbers of participants who answered 'yes' to the question of past history of cancer (~less than 200 subjects), which proportion that could rarely affect the result of this study. Nevertheless, our study is clinically important in that it is the first large-population retrospective study of healthy Korean young adults to demonstrate changing body composition patterns.
+
+In conclusion, we observed body weight changes and body composition changes during a large 4-year follow-up study of non-diabetic Korean young adults, and found that the lean mass significantly decreased with increasing age, even among relatively young adults. In addition, women had a greater risk of a rapid decrease in lean mass, relative to men. This difference in body composition during the 4-year study might be attributable to aging processes and sex-related genetic differences, as well as racial differences. A larger population that includes multiple races and is conducted over a longer period of time is needed to understand the mechanism underlying the observed changes in body composition patterns; thus, facilitating the application of these findings to the management of elderly and social health.
+
+## Conflicts Of Interest
+
+No potential conflict of interest relevant to this article was reported.
+
+## Orcid
+
+Eun-Jung Rhee *https://orcid.org/0000-0002-6108-7758*
+
+## References
+
+1. World Health Organization. Obesity and overweight [Internet]. Geneva: World Health Organization; c2017 [cited 2017 Oct 19]. Available from: http://www.who.int/mediacentre/ factsheets/fs311/en/.
+
+2. Garthe I, Raastad T, Sundgot-Borgen J. Long-term effect of nutritional counselling on desired gain in body mass and lean body mass in elite athletes. Appl Physiol Nutr Metab 2011;36:547-54.
+
+3. Seo MH, Rhee EJ. Metabolic and cardiovascular implications of a metabolically healthy obesity phenotype. Endocrinol Metab (Seoul) 2014;29:427-34.
+
+4. Kang YM, Jung CH, Cho YK, Jang JE, Hwang JY, Kim EH, 
+et al. Visceral adiposity index predicts the conversion of metabolically healthy obesity to an unhealthy phenotype. PLoS One 2017;12:e0179635.
+
+5. Choi KM. Sarcopenia and sarcopenic obesity. Endocrinol Metab (Seoul) 2013;28:86-9.
+
+6. Newman AB, Yanez D, Harris T, Duxbury A, Enright PL, 
+Fried LP, et al. Weight change in old age and its association with mortality. J Am Geriatr Soc 2001;49:1309-18.
+
+7. Newman AB, Lee JS, Visser M, Goodpaster BH, Kritchevsky SB, Tylavsky FA, et al. Weight change and the conservation of lean mass in old age: the Health, Aging and Body Composition Study. Am J Clin Nutr 2005;82:872-8.
+
+8. Arnold AM, Newman AB, Cushman M, Ding J, Kritchevsky S. Body weight dynamics and their association with physical function and mortality in older adults: the Cardiovascular Health Study. J Gerontol A Biol Sci Med Sci 2010;65:6370.
+
+9. Williamson DF, Pamuk ER. The association between weight loss and increased longevity. A review of the evidence. Ann Intern Med 1993;119(7 Pt 2):731-6.
+
+10. Allen TH, Anderson EC, Langham WH. Total body potassium and gross body composition in relation to age. J Gerontol 1960;15:348-57.
+
+11. Pierson RN Jr, Lin DH, Phillips RA. Total-body potassium in health: effects of age, sex, height, and fat. Am J Physiol 1974;226:206-12.
+
+12. Borkan GA, Norris AH. Fat redistribution and the changing body dimensions of the adult male. Hum Biol 1977;49:495513.
+
+13. Chumlea WC, Garry PJ, Hunt WC, Rhyne RL. Distributions of serial changes in stature and weight in a healthy elderly population. Hum Biol 1988;60:917-25. 
+
+14. Roberts SB, Fuss P, Heyman MB, Evans WJ, Tsay R, Rasmussen H, et al. Control of food intake in older men. JAMA 
+1994;272:1601-6.
+
+15. Visser M, Pahor M, Tylavsky F, Kritchevsky SB, Cauley JA, Newman AB, et al. One- and two-year change in body composition as measured by DXA in a population-based cohort of older men and women. J Appl Physiol (1985) 2003; 94:2368-74. 
+
+16. Hughes VA, Frontera WR, Roubenoff R, Evans WJ, Singh MA. Longitudinal changes in body composition in older men and women: role of body weight change and physical activity. Am J Clin Nutr 2002;76:473-81.
+
+17. Karvonen-Gutierrez C, Kim C. Association of mid-life changes in body size, body composition and obesity status with the menopausal transition. Healthcare (Basel) 2016;4:E42.
+
+18. Lovejoy JC, Champagne CM, de Jonge L, Xie H, Smith SR. 
+
+Increased visceral fat and decreased energy expenditure during the menopausal transition. Int J Obes (Lond) 2008;32:
+949-58.
+
+19. Wellons M, Ouyang P, Schreiner PJ, Herrington DM, Vaidya D. Early menopause predicts future coronary heart disease and stroke: the Multi-Ethnic Study of Atherosclerosis. 
+
+Menopause 2012;19:1081-7. 
+
+20. Chen H, Bermudez OI, Tucker KL. Waist circumference and weight change are associated with disability among elderly Hispanics. J Gerontol A Biol Sci Med Sci 2002;57:
+M19-25.
+
+21. Houston DK, Stevens J, Cai J, Morey MC. Role of weight history on functional limitations and disability in late adulthood: the ARIC study. Obes Res 2005;13:1793-802.
+
+22. Lee JS, Kritchevsky SB, Tylavsky F, Harris T, Simonsick EM, Rubin SM, et al. Weight change, weight change intention, and the incidence of mobility limitation in well-functioning community-dwelling older adults. J Gerontol A Biol 
+
+## Sci Med Sci 2005;60:1007-12.
+
+23. Launer LJ, Harris T, Rumpel C, Madans J. Body mass index, weight change, and risk of mobility disability in middle-aged and older women. The epidemiologic follow-up study of NHANES I. JAMA 1994;271:1093-8.
+
+24. American Diabetes Association. 2. Classification and diagnosis of diabetes. Diabetes Care 2017;40(Suppl 1):S11-24.
+
+25. Wang H, Hai S, Cao L, Zhou J, Liu P, Dong BR. Estimation of prevalence of sarcopenia by using a new bioelectrical impedance analysis in Chinese community-dwelling elderly people. BMC Geriatr 2016;16:216. 
+
+26. Gibson AL, Holmes JC, Desautels RL, Edmonds LB, Nuudi L. Ability of new octapolar bioimpedance spectroscopy analyzers to predict 4-component-model percentage body fat in Hispanic, black, and white adults. Am J Clin Nutr 2008;87: 332-8.
+
+27. Kyle UG, Genton L, Karsegard L, Slosman DO, Pichard C. 
+
+Single prediction equation for bioelectrical impedance analysis in adults aged 20: 94 years. Nutrition 2001;17:248-53. 
+
+28. Forbes GB. Longitudinal changes in adult fat-free mass: influence of body weight. Am J Clin Nutr 1999;70:1025-31. 
+
+29. Williamson DF. Descriptive epidemiology of body weight and weight change in U.S. adults. Ann Intern Med 1993;119 (7 Pt 2):646-9.
+
+30. Brown JC, Harhay MO, Harhay MN. Sarcopenia and mortality among a population-based sample of communitydwelling older adults. J Cachexia Sarcopenia Muscle 2016; 7:290-8.
+
+31. Roshanravan B, Patel KV, Fried LF, Robinson-Cohen C, de Boer IH, Harris T, et al. Association of muscle endurance, fatigability, and strength with functional limitation and mortality in the health aging and body composition study. J 
+Gerontol A Biol Sci Med Sci 2017;72:284-91.
+
+32. Verschueren S, Gielen E, O'Neill TW, Pye SR, Adams JE, 
+Ward KA, et al. Sarcopenia and its relationship with bone mineral density in middle-aged and elderly European men. Osteoporos Int 2013;24:87-98. 
+
+33. Mauvais-Jarvis F. Sex differences in metabolic homeostasis, diabetes, and obesity. Biol Sex Differ 2015;6:14.
+
+34. Heitmann BL, Garby L. Composition (lean and fat tissue) of weight changes in adult Danes. Am J Clin Nutr 2002;75: 840-7. 
+
+35. Poehlman ET, Toth MJ, Gardner AW. Changes in energy balance and body composition at menopause: a controlled longitudinal study. Ann Intern Med 1995;123:673-5.
+
+36. Aloia JF, McGowan DM, Vaswani AN, Ross P, Cohn SH. 
+
+Relationship of menopause to skeletal and muscle mass. Am J Clin Nutr 1991;53:1378-83.
+
+37. Aloia JF, Vaswani A, Russo L, Sheehan M, Flaster E. The influence of menopause and hormonal replacement therapy on body cell mass and body fat mass. Am J Obstet Gynecol 1995;172:896-900. 
+
+38. Sorensen MB, Rosenfalck AM, Hojgaard L, Ottesen B. 
+
+Obesity and sarcopenia after menopause are reversed by sex hormone replacement therapy. Obes Res 2001;9:622-6.
+
+39. Chen Z, Bassford T, Green SB, Cauley JA, Jackson RD, LaCroix AZ, et al. Postmenopausal hormone therapy and body composition: a substudy of the estrogen plus progestin trial of the Women's Health Initiative. Am J Clin Nutr 2005;82: 651-6. 
+
+40. Souza VA, Oliveira D, Barbosa SR, Correa JODA, Colugnati FAB, Mansur HN, et al. Sarcopenia in patients with chronic kidney disease not yet on dialysis: analysis of the prevalence and associated factors. PLoS One 2017;12:e0176230.
+
+41. Han E, Lee YH, Kim G, Kim SR, Lee BW, Kang ES, et al. 
+
+Sarcopenia is associated with albuminuria independently of hypertension and diabetes: KNHANES 2008-2011. Metabolism 2016;65:1531-40. 
+
+42. Solheim TS, Blum D, Fayers PM, Hjermstad MJ, Stene GB, 
+Strasser F, et al. Weight loss, appetite loss and food intake in cancer patients with cancer cachexia: three peas in a pod?: 
+analysis from a multicenter cross sectional study. Acta Oncol 2014;53:539-46. 

medical/md/PMC6086208.md

@@ -0,0 +1,351 @@
+
+
+![0_image_2.png](0_image_2.png)
+
+![0_image_4.png](0_image_4.png)
+
+journal homepage: www.elsevier.com/locate/toxrep
+
+![0_image_3.png](0_image_3.png)
+
+![0_image_5.png](0_image_5.png)
+
+Microcystins in water and in microalgae
+
+![0_image_1.png](0_image_1.png)
+
+Do microcystins as microalgae contaminants warrant the current public alarm?
+
+![0_image_0.png](0_image_0.png)
+
+![0_image_6.png](0_image_6.png)
+
+Stefano Scoglio Nutritherapy Research Centre, Urbino, Italy ARTICLE INFO
+
+| Keywords: Microcystins Cyanobacteria Klamath algae Aphanizomenon flos aquae Spirulina Chlorella Water safety   |
+|----------------------------------------------------------------------------------------------------------------|
+
+## Abstract
+
+Microcystins have been the subject of increasingly alarming popular and scientific articles, which have taken as their unquestionable foundation the provisional Guideline of 1 μg/L established by the WHO Panel on microcystins levels in water, and mechanically translated by the Oregon government as 1 μg/g of Klamath Aphanizomenon flos aquae microalgae. This article underlines the significant limitations and ultimately scientific untenability of the WHO Guideline on microcystins in water, for being based on testing methodologies which may lead to a significant overestimation of the toxicity of microcystins. I propose criteria for the realization of new experimental studies on the toxicity of microcystins, based on the essential understanding that drinking water is contaminated by whole cyanobacterial microalgae rather than purified microcystins, while it is important to differentiate between water and cyanobacterial supplements. It is indeed a mistake to automatically apply standards that are proper for water to cyanobacterial supplements, as they have different concentrations of the antioxidant substances that inactivate or significantly reduce the toxicity of microcystins, a fact that also require that each cyanobacterial supplement be tested individually and through realistic testing methodologies.
+
+## 1. Introduction
+
+Microcystins are cyclic non-ribosomal peptides produced by some cyanobacteria such as Microcystis aeruginosa, the main producer of these cyanotoxins. They are considered powerful hepato-toxins, and are treated as very dangerous, even though on the ground of rather questionable scientific data. Yet, every so often appears an article that raises concerns about the possible toxicity of microalgae, and particularly of the cyanobacterium Aphanizomenon flos aquae (AFA) from Klamath Lake, Oregon, USA, due to microcystins contamination. In 2012, for example, 2 articles were published, one from researchers of the Italian Istituto Superiore di Sanità [1], and a second one from a German University team [2]. Both of them report that some Klamath algae products tested were above the limit of 1 μg/g of microcystins, the safety limit established by the Government of Oregon for the cyanobacterial supplements, and this is supposed to constitute some kind of danger, even though the authors never tested the actual toxicity of such cyanobacterial supplements, and only took for granted the 1 μg/L of the WHO Guideline, and its automatic application to microalgae at 1 μg/g.
+
+Is this alarm and concern about Klamath AFA, as well as other microalgae such as Spirulina or Chlorella, warranted? And more widely, is the danger of microcystins as high as it has been purported to be?
+
+Often, the special focus on Klamath AFA rests on the claim that Spirulina and Chlorella are not affected by cyanobacterial toxins.
+
+However, this is clearly not true. For instance, in 2001 an Italian group of researchers from the Istituto Superiore di Sanità (ISS) tested Spirulina products sold in shops in Rome and found them contaminated by anatoxins [3]. A study on Spirulina products sold in China found a large number of them contaminated by microcystins [4]. More recently, a study where the authors tested the three microalgae Spirulina, Chlorella and Klamath, found that among the 3 main edible microalgae the most microcystins-contaminated was Chlorella, followed by Spirulina, with Klamath AFA being actually the least contaminated. When considering all the possible contaminants, and not just microcystins, the researchers ([5], p. 10) concluded that "…the most contaminated products were those containing Spirulina".
+
+However, all three microalgae have been widely distributed worldwide for decades, and no proven toxicity cases have ever been reported. This applies not only to Spirulina and Chlorella but also to the Aphanizomenon flos aquae Ralphs ex Born. & Flah. Var. flos aqua strain from Upper Klamath Lake, OR, USA, a strain that has been established as a non-toxic [6], and only potentially subjected to microcystin contamination. Could this be due to the fact that microcystins are not as dangerous as generally thought? Could it be that the limits established https://doi.org/10.1016/j.toxrep.2018.07.002 Received 24 January 2018; Received in revised form 8 July 2018; Accepted 24 July 2018
+
+## E-Mail Address: Scoglio@Nutriterapia.It.
+
+by some governments, based on the WHO's 1998 Guideline of 1 μg/L of water, which the Government of Oregon has translated automatically as 1 μg/g of Klamath AFA, are not only excessively stringent, but also not supported by convincing scientific data?
+
+## 2. Microcystins: How Dangerous Are They?
+
+The recommended maximum level of 1 μg of microcystins per liter of water was established by a special Panel of the WHO, only in relation to water, and only as a guideline [7]. The panel of the WHO established the guideline by taking into account only 3 animal studies on the liver toxicity of microcystins:
+1) In the first study [8], an extract of Microcystis aeruginosa containing microcystins ranging from 750 μg/kg/bw to 12,000 μg/kg/bw, were administered dietarily (not by gavage) to mice for 1 year, a period that for mice corresponds to chronic exposure. While at the higher levels there was significant liver damage, the level of 750 μg/kg/bw did not differ, in terms of mortality or histopathological liver changes, from the control. Thus, even though the study did not reach any conclusion about a possible NOAEL, the authors concluded that: "…the oral consumption of toxic M. aeruginosa by mice has relatively little effect at low doses" (p. 304), where the low dose was the one of 750 μg/kg/bw. This study is interesting for different reasons: a) the toxin was administered dietarily; b) it was administered for a whole year; c) it was administered as a natural component of the cyanobacterial microalgae. Transferred to a man of 60 kg, the 750 μg/kg/bw dose would mean that 45,000 μg
+(or 45 mg) of microcystins taken daily as natural component of whole cyanobacterial algae, would not generate any harm. True, as Falconer et al. point out, both the control group and lower dose group developed some minor liver alterations with increasing age; but the fact that there was no difference between the control group, which did not ingest any algae, and the lower dose group, clearly indicates that at the lower dose of 750 μg/kg/bw no harm was caused by the algae, and the only harm found was the same as the one, probably due to age and environmental conditions, that afflicted also the control group mice. In this case, there was no need for a Chronic Exposure Uncertainty Factor, given that 1 year of administration for mice is equal to chronic exposure. Therefore, the UF reduction standard should have been 100, which would mean that a 60 kg human being could consume 450 μg /day of microcystins for life without any harm, clearly assuming that such microcystins were ingested as natural component of whole cyanobacterial algae. The administration of the toxin as the natural component of the cyanobacterial microalgae, which was the methodology used by Falconer et al. [8], may be considered the closest to the actual human ingestion of microcystins, given that in real life water is not contaminated by pure, laboratory produced microcystins, but by the whole Microcystis aeruginosa with its natural content of microcystins. Even if applying a UF reduction of 1000, the chronic daily safe intake, for a 60 kg human, would be 45 μg.
+
+2) In another study [9], different amounts of microcystins were administered to pigs, even in this case as components of the Microcystis aeruginosa cyanobacterial scum that was frozen, then thawed, then administered to the pigs. Here too the administration was dietary and without gavage, and so most similar to normal human consumption; pig is considered, among the animals, the one physiologically most similar to humans; and finally the study tested again the whole cyanobacterial microalgae. The lower dose of 280 μg/kg/bw day was found to be the safe NOAEL (No Adverse Effect Limit). The authors still applied a safety or uncertainty reduction factor of 1000 to the 280 μg/kg/bw level, concluding thus (p. 138):
+"This then provides a guideline safe intake for humans of 0.28 μg/
+kg/ day, which should result in no adverse effect as seen by direct liver injury. To apply this to a 60 kg adult drinking 2 L water/day, a consumption of water containing 8.4 μg toxins/L should be safe…".
+
+Given the physiological similarity of pigs to humans, possibly the UF
+reduction for inter- species variability could have been lower than ×10:
+with a ×6 UF, the safe guideline would have been 0.46 μg/kg/day, which for a 60 kg human would mean a safe intake of 28 μg/day, or 14 μg/L of water.
+
+3) The third study considered was the one by Fawell et al. [10],
+whose data were published again in Fawell et al. [11] (this is the article we will analyze). This was the article that in the end was chosen by the WHO Panel, led by the same Prof. Fawell, for the determination of the Guideline. With mice used as subjects of the study, the final NOAEL was established at 40 μg/kg/bw. In this case, the transposition to humans would give the dose of 2400 μg as a safe daily dose, which, once reduced by the Uncertainty Factor of 1000, roughly corresponds to 1 μg/L
+of water (assuming a daily consumption of up to 2 L of water as the 80%
+supplier of microcystins for human beings). The question to ask is: what was in Fawell's study that made it preferable to the two other studies by Falconer?
+
+The WHO's Panel document does not offer any explanation for that, probably because there was none, except the need to reach as strict a guideline as possible. In fact, the Fawell's study was flawed under many respects. One thing that nobody seems to have noticed is the fact that Fawell et al. [11] administered the "purified microcystins…prepared in distilled water" (p. 163). Here we have two full "unnatural" and unrealistic factors: a) no one drinks purified microcystins, except in the toxicologist's lab; b) no one drinks, normally, distilled water, which is deprived of any substance, such as the minerals present in drinkable water, that can play a buffering role (even if minimal) relative to the toxin, in addition to the protective molecules already present in the whole Microcystis aeruginosa (of which we shall talk later).
+
+Moreover, the fact that Fawell et al. had chosen mice as their subjects constituted another weakness of the study, which is indirectly recognized by the authors themselves when they write that, between mouse and rat, "…the mouse was the more sensitive of the two species to the toxin." (p. 164). Finally, Fawell's method of administration was gavage, which is clearly not the normal way humans or animals drink water.
+
+In spite of all these unnatural and artificial shortcomings, the WHO
+Panel chose Fawell's study: as a consequence, the WHO Guideline regulated drinking water, which is normally contaminated by Microcystis aeruginosa with its natural content of microcystins, by first discarding the two studies that did actually reproduce natural and normal drinking water conditions, and then selecting the only study that had adopted an unrealistic methodology by using purified microcystins in purified (distilled) water administered through gavage, all conditions that are never to be found in real drinking water situations.
+
+Besides its methodological flaws, there is another critical passage in Fawell et al. [11] study, the jump from a possible NOAEL of 200 μg/kg/ bw to a NOAEL of 40 μg/kg/bw, a jump that allowed Fawell et al. to reach a safe value of 2500 μg of daily consumption of microcystins, which was then subjected to the rather high Uncertainty Factor of 1000. The uncertainty factors normally used are 100 for a NOAEL from an animal study, and 10 from a study of human volunteers (http://archive. food.gov.uk/committees/evm/papers/evm0105.pdf). To understand how we rarely deviate from this parameter, one needs only look to the treatment of one of the most dangerous agricultural insecticides, Chlorpyrifos, so toxic that its use in private homes has been altogether banned. The NOAEL for this very harmful insecticide was established by applying a reduction factor of 100 in the acute, and 160 in the chronic. If we had applied the same criterion for microcystins, we would have obtained, even starting with the lowest result of 2500 μg by Fawell et al., a safe daily consumption of 25 μg for the acute and of about 16 μg for the chronic. At these levels, microcystins would be a minor problem, relevant only to extreme situations. Instead, by applying the UF of
+×1000, the final value set by the WHO's Panel was of 2.5 μg/day, and thus of 1 μg/L of water.
+
+Maybe due also to the weaknesses of the WHO panel's decision process, the value was established only as a Guideline, subsequently to Table 1
+
+| Table 2 Thirteen week repeat dose study - blood chemistry      |                                   |              |             |              |
+|----------------------------------------------------------------|-----------------------------------|--------------|-------------|--------------|
+| (mean ± s.d.)                                                  | Alkaline                          | Alanine      | Aspartate   |              |
+| phosphatase                                                    | aminotransferase aminotransferase |              |             |              |
+| Group Sex                                                      | (U/I)                             | (U/I)        | (U/I)       |              |
+| 1                                                              | M                                 | 91 ± 22.2    | 27+8.0      | 68±27.7      |
+| 2                                                              | M                                 | 95±29.2      | 37±17.2     | 64±12.2      |
+| 59" ± 28.0                                                     | 121°±43.7                         |              |             |              |
+| 3                                                              | M                                 | 94  32.3     |             |              |
+| 4                                                              | M                                 | 2° ± 103.2   | 159         | 121 b ± 26.3 |
+| 1                                                              | F                                 | 167 ± 24.6   | 3±11.3      | 101±38.3     |
+| 2                                                              | F                                 | 187±76.2     | 25±7.8      | 74±13.2      |
+| 3                                                              | F                                 | 156±33.4     | 27±9.4      | 74±22.1      |
+| 4                                                              | F                                 | 39 123.7     | 20 149.1    | 144-71.7     |
+| Gamma                                                          |                                   |              |             |              |
+| glutamyl trans-                                                | Total                             | Abumin       |             |              |
+| Group Sex                                                      | aminase (U/I)                     | protein (g%) | (g%)        |              |
+| 6±1.0                                                          |                                   |              |             |              |
+| 1                                                              | M                                 | 5.5±0.32     | 3.2±0.19    |              |
+| 2                                                              | M                                 | 4±0.7        | 5.1±0.26    | 3.0±0.13     |
+| 3                                                              | M                                 | 3°±0.4       | 4.8 b ±0.29 | 2.8°±0.13    |
+| M                                                              | 4.8°±0.21                         | 2.8°±0.11    |             |              |
+| 4                                                              | 4±0.4                             |              |             |              |
+| 1                                                              | F                                 | 4±1.0        | 5.1±0.30    | 3.1±0.14     |
+| 2                                                              | F                                 | 3:0.5        | 5.2±0.28    | 3.2.10.16    |
+| 3                                                              | F                                 | 3±0.0        | 5.3±0.31    | 3.4" ± 0.14  |
+| F                                                              |                                   |              |             |              |
+| 4                                                              | 340.4                             | 5.1 ± 0.22   | 3.1.1.0.18  |              |
+| Group 1=0 (control); group 2=40 µg kg                          | 1 bodyweight per day              |              |             |              |
+| microcystin-LR; group                                          | 3=200 μg kg                       | -1           | bodyweight  | pert day     |
+| microcystin-LR; group 4=1000 µg kg-1                           | bodyweight per day                |              |             |              |
+| microcystin-LR. "Significantly different from controls P<0.05; |                                   |              |             |              |
+| 5significantly different from controls P<0.01; significantly   |                                   |              |             |              |
+| different from controls P<0.001                                |                                   |              |             |              |
+
+be verified and tested more deeply. Yet, almost 20 years have passed, no reevaluation of the Guideline have been performed, and the guideline has become a de facto mandatory standard for many health authorities, though not for all of them ( [ 12 ], pp. 53–55), and a reference standard for many toxicologists.
+
+This consideration acquires particular weight if we consider that the WHO Panel on microcystins was so intensely driven by a super-precautionary desire to establish the lowest possible safety standard, as to completely overlook the flaws of Fawell et al.'s study, including the very questionable jump from a possible NOAEL at 200 µ g/kg/bw to the 40 µ g/kg/bw NOAEL. To check for possible liver damages, they tested the mice's liver for enzymes ( Table 1 ).
+
+As we can see, in the 200 µ g/kg/bw group, or Group 3, there was actually a stability in the male group and a reduction in the female group of alkaline phosphatase (ALP); and reduction, for both male and female groups, of gamma glutamyl transaminase (GGT) levels, in relation to the control group, a finding that actually supports the notion that the liver's metabolism of the mice had actually improved relative to control; as to alanine aminotransferase (ALT) and aspartate aminotransferase (AST), there was an increase of these enzymes in the male group, which was not confirmed, though, in the female group, where there was a reduction. Overall, the findings of the liver enzymes analysis did not support the idea that the 200 µ g/Kg/bw was not a safe level. Yet, the authors ([11], p. 165) state that:
+"…the significance of these findings remains unclear. Results, however, which were both clear and in agreement with other work done, were produced by histopathological examination of the liver.
+
+Here the lesions observed were generally slight and occurred predominantly in the top dose group."
+After having liquidated as "unclear" hepato-chemical data which did not match the original toxicity level hypothesis, the authors focused on the histopathological lesions, which they themselves admit were
+"generally slight" and mostly "in the top dose group", that is in the mice that took the dose of 1000 µ g/kg/bw. Again, not much of a proof that the 200µg/kg/bw was not the proper NOAEL
+The supposed proof that the only true safe level was 40 µ g/kg/bw came from microscopic examination of the liver tissue of the mice.
+
+Here, the damaging changes are described as "…multifocal minimal/
+slight chronic inflammation with deposits of hemosiderin and multifocal single hepatocyte degeneration." So, the liver damage was verified through two forms of degeneration: the chronic inflammation with hemosiderin deposit which was minimal; and a multifocal "single hepatocyte degeneration". Even this does not seem to be very significant, as it involves only a few single hepatocytes.
+
+Moreover, these light damages "…were predominantly found in animals from the top dose group…", again not in the 200 µ g/kg/bw group. But the authors add that there were "… similar but less marked lesions occurring in a smaller number of a mid dose group": such small number is just 1 male and 1 female out of 30 mice.
+
+Moreover, the authors state that the lesions, that is the "single hepatocyte degeneration" was "less marked" than those of the top dose group. Given that "single hepatocyte degeneration" is already a very "slight" damage, a lesion less marked than that seems indeed a very, very slight lesion, one that it would take only a very powerful interpretive lens to appreciate. It is true that the authors also define the
+"single hepatocyte degeneration" as "multi-focal", but this could just mean a few foci. Certainly not enough to rush into discarding the 200 μg/kg/bw, especially in light of the fact, underlined by the authors themselves, that mice is much more sensitive to toxins than rats or pigs
+(or humans), and that the administration method was gavage, which is known to highly increase the toxicity of the toxins ingested ([13], pp.
+
+102–3):
+"Indeed, gavage corresponds to a bolus dose, resulting in tissue concentrations higher than those attained after the more gradual introduction of a dietary treatment, giving time to the detoxification/excretion systems to be efficient."
+In comparison, Funari et al. ([13], p. 103) continue:
+"When mice were subchronically administered with MC-LR-containing extracts through the diet, a regimen more similar to human exposure, the NOAEL value was higher (333 μg/kg/bw/day)".
+
+Given the extremely tenuous data to discard the 200 μg/kg/bw as the safe limit, we can safely assume that if the microcystins had been administered through a more physiological dietary route, even if through unnatural and unrealistic factors such as distilled water and purified microcystins, the 200 μg/kg/bw would have likely been the actual NOAEL, one slightly lower than the 280 μg/kg bw NOAEL previously established by Falconer et al. [9], or the 333 μg/kg bw NOAEL
+set by Schaeffer et al. [14], through fully natural means (dietary administration, microcystins as natural component of Microcystins aeruginosa, regular drinking water).
+
+And again, even if the 200 μg/kg/bw was not considered safe enough, given the extremely tenuous toxicity data at that level, why not test lower NOAELs at 180, 150 or 100 μg/kg/bw? For example, a NOAEL of 150 μg/kg/bw. would have produced, even by applying the high 1000x uncertainty factor, a safe daily exposure level, for a 60 kg individual, of 9 μg, and thus an acceptable content of 4.5 μg/L of water
+(at 2 L of consumption per day). This level would have significantly reduced the problem of microcystins, at least in normal water conditions.
+
+When analyzing the way in which the WHO Panel's Guideline was set, one cannot avoid the sensation that the logical order of research was reversed: rather than doing tests and deriving a limit, it looks like the limit to be achieved was established first, and then the tests were accustomed to that requirement. This is made even more evident by the strange twist that one finds at the end of the 1994 study by Falconer et al., which first and throughout proposed a NOAEL of 280 μg/kg/bw, and then in the last paragraphs (p. 138), as to adjust to an external, lastminute requirement, in order to settle to the required limit of 1 μg/L,
+chooses to apply an almost unheard uncertainty reduction factor of 10,000!
+
+It is interesting to analyze briefly such twist. In the 1994 study, Falconer et al. lowered the previous NOAEL of 45 μg/day to one of 16.8 μg/day for a 60 kg human. In this study, there was no chronic exposure, but the subjects of the study were pigs, thus with a possible lesser UF for inter-species variability. Yet, apparently this very precautionary approach did not seem enough, because all of a sudden, at the very end of the same article, without ever erasing the claim of the 16.8 mcg/day NOAEL as the natural outcome of the study, Falconer et al. [9] have a second thought, and argue that the 1000 UF may not be enough, because we also need to consider the fact that microcystins may play a role in tumor promotion, so that a further 10 uncertainty factor needs to be applied, bringing the total UF to an unprecedented 10,000, and only thus the result in line with the guideline of 1 μg/L
+water.
+
+Apart from the fact that the shift is clearly contradictory with the immediately previous and strongly worded establishment of the NOAEL
+at 8.4 μg/L, the logic itself of the shift does not seem to hold: cancer promotion would be an indirect effect of microcystins toxicity, not a direct result of it, and at most would be a component of chronic exposure. If we were to apply a 10x factor for any type of damage produced by a toxin, the uncertainty factor would easily grow into the millions, as any new damage discovery, such as cardiovascular, respiratory, or urinary, would require a further 10 UF. Besides, the statement by ([9], p.138) that "…tumor promotion by these toxins…is now thoroughly established" was a very perfunctory conclusion, one that was inconclusive then and is most inconclusive now [15]. In sum, the bad timing and faulty logic of Falconer et al.'s shift only reveals a too eager availability of many toxicologists to want to join the WHO Panel in erring on the super-precautionary side.
+
+In fact, that Fawell et al. [10,11] guideline decision was seriously faulted is beginning to be recognized by other toxicologists ([13], p.
+
+110):
+"In the case of MC-LR, WHO [7] selected the already mentioned subchronic NO(A)EL of 40 μg/kg/bw/day [10]. The choice of this NO(A)EL represents an example of the application of a conservative approach, indeed: it has been obtained in a study on mice, which are more sensitive to acute effects of MC-LR than rats; furthermore, in the study the space among doses is large, the effects at LO(A)EL are slight and involve a limited number of animals, and finally the route of exposure is gavage rather than dietary [10]."
+The awareness that Fawell's approach was faulted in multiple ways seems to be quite common, and the only virtue of this otherwise faulted study seems to be its "conservatism". But was it conservatism? Or wasn't it instead an unwarranted revolution, which radically altered a previous situation, whereby microcystins were an unknown contaminant that never seems to have created much of a problem, except in very extreme situation such as dialysis patients, or animals gorging on blue green toxic blooms, or poor countries with very poor sanitation and water controls? The truth, indeed, would have been truly "conservative": microcystins is a relatively non threatening toxin in normal conditions, ordinarily found below any toxicity risk thresholds in relation to normal dietary exposure and as natural component of Microcystis aeruginosa (or other microcystin-producing cyanobacteria).
+
+Sure, it would still need to be monitored and controlled, but without turning it into a ferocious potential killer to be handled with a sledgehammer rather than with a chisel.
+
+The fact that within the toxicological community the discussion has been reopened, and not all toxicologists accept the 1 μg/L of water Guideline, manifests a deserving honesty of thought. However, there are still toxicologists who seem bent towards always raising at all costs the alarm bar on natural toxins, indifferent to the social and financial costs of such a war. That is why governments would be wise to listen to such toxicologists with a grain of salt, refusing to jump into extreme conclusions. The "king" should know that for the militant toxicologist an error that sets the standard of public alarm higher is but a "noble lie" to establish his or her radical worldview, and should thus refuse to easily raise public alarm and expenditure.
+
+It would be time to reconsider the results of the tests that were done with natural and realistic methods, all of which, as we have seen, even by applying a strong UF of ×1,000, generated a chronic between 16.8 μg/day and 45 μg/day for the usual 60 kg human. At this level, microcystins would have remained a small toxicological problem, with a significantly reduced alarm and public expenditure in this area, as the current level of microcystins in water was found to be "…from below 1.0 μg MC-LR equiv./L to more than 8.0 μg/L in raw water…" [16].
+
+Instead, still today there are those who push towards standards even lower than 1 μg/L, while proposing new and more expensive microcystins tests [17,2].
+
+Unfortunately, there seems to be a strong tradition among too many toxicologists who prefer non physiological, not realistic methods of toxins administration. In a recent article by Buratti et al. [12], two tables summarize the studies that have been done over the years to establish a reference value for MC-LR. Concerning the studies done on acute toxicity on various types of microcystins, of the 14 studies reported none was done through dietary intake, and all of them used either gavage, intra-peritoneal or intra-venous methods of administration. As to the subacute/subchronic toxicity, of a total of 18 studies reported, 9 used an intra-peritoneal injection, 2 used inhalation, and of the remaining 7 based on oral administration, only 4 were done through dietary intake, while 3 were done through gavage [12]. When we add to this list the most important of all studies, the one by Fawell et al. [10,11] used to set the WHO's Guideline, we get an overall picture of only 4 studies out of 19 done through ordinary dietary routes of administration, and 15 done with non physiological methods, such as i.p or gavage. Moreover, of the 4 studies that used dietary consumption of drinking water as the method of administration, 3 were essentially irrelevant, because they did not even test for hepatic damage, and used only very low quantities of MC-LR, between 1 μg/L–40 μg/L, that is quantities that are anyway below the 40 μg/L used to set the WHO's Guideline, so with the only plausible intention of possibly lowering the standard of the WHO's Guideline [18–20].
+
+In sum, out of 33 studies (14 on acute and 19 on subacute/subchronic toxicity) only 1 was done through normal dietary means and with normal drinking water. It would be about time that any future decision on toxins in food or drinking water be based on studies using realistic and physiological methods, discarding any test that is done through toxins purified from the matrix they are normally ingested with, and through methods of administration such as intra-peritoneal, intra-venous or gavage. I find it sorrily indicative, that "…there have been no pharmacokinetic studies with orally administered microcystins" (https://pubchem.ncbi.nlm.nih.gov/compound/Microcystin_
+LR\#section=OtherPreventative-Measures, p. 13).
+
+As a matter of fact, not all authorities follow unquestionably the WHO Guideline. The US EPA, for instance, sets a limit of 3 μg/L of water for school-aged children and adults, while Health Canada has a limit of 1.5 μg/L ([12], Table 10). Thus, there seems to be a move towards less excessively stringent standards for microcystins in water.
+
+Let's take the following statement ([13], p. 111):
+"For an adult with a 60-kg bw, the acute no-effect total dose is 150 μg/ person…At this level of exposure to total MCs, no acute effect is expected, also considering that the evaluation has been based on data on MC-LR, which is among the most toxic variants."
+If we were to apply to this standard a UF for chronic exposure of 6, as for Chlorpyrifos, we would have a standard of 25 μg/day; and even by applying a UF of 10, we would still have a 15 μg/day. These are the results obtained when the route of administration considered is dietary.
+
+Any future study on microcystin toxicity should be characterized by the following elements: a) the subjects of the studies should be preferably rats, or even better pigs; and if mice is used, it must be done with the awareness of their heightened sensitivity to the toxin; b) they should be preferably performed for periods that incorporate the chronic exposure, thus reducing the overall UF to 100; c) the studies should be realistic, also in terms of including not only MCLR, but also for the other variants (such as MCLA). However, the only realistic and scientifically sound way of doing the test on all variants of MCs is to get them as natural components of the whole Microcystis aeruginosa, as it is the whole cyanobacterium that contaminates water, not any purified toxin from it; d) the animals should be fed through a normal dietary route
+(not through gavage or injections); e) finally, even though water is contaminated by the whole cyanobacterium, not all cyanobacteria are the same, and thus every single cyanobacterium should be tested independently, and in the form in which it is ingested, as water if in water, or as supplement if a supplement.
+
+## 3. Microcystins: Microalgae Vs. Water
+
+Paradoxically, when the Oregon's health authorities, without doing any specific tests on the toxicity of the AFA microalgae from Upper Klamath Lake, took the 1 μg/L WHO's Guideline and applied it automatically to AFA algae as 1 μg/g, logically they did not make a serious transferring mistake, as water is indeed contaminated by whole cyanobacteria. But they made a big factual mistake, as they applied to AFA
+microalgae a WHO's Guideline which was established by testing unrealistically purified microcystins through gavage, a way of administration that certainly has nothing to do with the normal intake of AFA
+microalgae.
+
+However, the mistake by the Oregon government was made even worse by the fact that they regulated whole cyanobacterial microalgae, not water, and so the need to consider the role that other cyanobacterial molecules play in relation to microcystins toxicity should have emerged even more clearly. Even if, say, the standard chosen had been based on the Falconer et al. [8] study, where the test was done on water contaminated by the microalgae rather than the toxin, my argument is that it would still be necessary to define the level of toxicity of cyanobacterial supplements on their own, by testing specifically their individual level of toxicity. To begin with, it is clear that one cannot transfer automatically a value that is established for a liquid product onto a dried supplement. In fact, while in a dry product you can refer the value to a gram of dried supplement, you do not know how much Microcystis aeruginosa is present in the water to produce 1 μg/L, because the concentration of the toxin in the cyanobacterium is variable. In other words, the Microcystis aeruginosa in drinking water may contain 10 μg/g, so that the liter of water needs only to be contaminated by just 100 mg. of the microalgae to achieve the limit of 1 μg/L. Why is this relevant? Because there is a big difference between 1 μg of toxin contained in 100 mg and 1 μg contained in 1 g of the whole cyanobacterium. Microcystins perform their toxic activity by destroying essential hepatic enzymes (PP1 and PP2A) via oxidation. They are thus oxidating toxins. However, there have been numerous studies, some of them available since 1991, proving that pretty much all anti-oxidant substances counteract the toxicity of microcystins, substances such as: vitamin E [21]; polyphenols [22]; carotenes [23]; selenium [24]; GSH
+or glutathione [25], sylimarin [26], as well as microalgal polysaccharides [27]. All these substances either inactivate or greatly reduce microcystins's toxicity. The interesting thing is that all microalgae, in different measures, contain most of these antioxidant substances, and many of them in relevant quantity. For instance, in a recent study which our research group has authored [28], we have proved the ability of an extract of AFA Klamath to increase, up to more than 40%, the plasma concentration in human subjects of carotenes, tocopherols (vitamin E) and very powerful xantophylilc carotenoids such as lutein, astaxanthin and lycopene. To this it must be added that both Klamath algae and Spirulina are rich in the specific cyanobacterial pigment phycocyanin.
+
+Recently we have proved [29] that the specific phycocyanin from AFA
+Klamath microalgae has the highest ORAC, i.e. the official standard of anti-oxidant capacity, among all purified molecules.
+
+Here, we need to go back to Falconer et al. [8] study, because we may get an idea of why it had the highest NOAEL of all the studies that were looked at on microcystins. We already saw that in that study, as opposed to the purified microcystins used by Fawell et al. (and most other toxicologists), the actual Microcystis aeruginosa with its natural content of microcystins was used. However, in reality the authors explained ([8], p. 292) that they made an extract of the cyanobacterial microalgae:
+"Bulk cyanobacterial bloom was concentrated, frozen at −10 °C,
+thawed, mixed with an equal concentration of water, and left overnight at 4 °C. The suspension was then centrifuged at approximately 1500 g for 30 min to remove cell debris and the clear
+
+![5_image_0.png](5_image_0.png)
+
+blue supernatant was collected for use."
+It is then clear that these authors used an extract that concentrated at the same time microcystins and phycocyanins, the powerful antioxidant blue pigment that turned the supernatant blue. Given the high ORAC of such phycocyanins, this is the reason why the factual NOAEL
+of Falconer et al. [8] study was so much higher (750 μg/kg/bw/day)
+than the NOAEL of the Falconer et al. [9] study (280 μg/kg/bw/day),
+where the whole Microcystis rather than extract was used; which in turn was so much higher than the NOAEL of the Fawell et al. [10,11]
+study with purified microcystins (40 μg/kg/bw/day). This is a further confirmation of the need to test realistically with the whole Microcystis contaminated water when talking of water; with the whole microcystins-contaminated cyanobacterial supplement when testing for supplements; and with the actual cyanobacterial extract concentrating one or more of its antioxidant molecules when testing for an extract based supplement.
+
+Another particularly relevant way of mycrocystins detoxification has been recently underlined ([12], p. 20): "The role of GSH and its concentration are crucial factors for MC detoxification". One of the keys to counteract, and in fact detoxify microcystins, is to increase the levels of endogenous GSH (glutathione peroxidase). This is exactly what happened when 10 healthy subjects were administered a Klamath AFA
+algae product, in the first study on AFA performed by our research group at the University of Urbino (Fig. 1 - [30], p. 69).
+
+We must also consider the fact that microcystins's toxicity is "a multi-pathways process…and it has been proposed that it is the result of
+'cross-talking' and cooperative effects between different pathways, responsible for cytoskeleton alterations, lipid peroxidation, oxidative stress and apoptosis …" ([12], p. 24). Now, we have already seen how AFA Klamath algae is able to counteract oxidative stress and supports the level and action of endogenous antioxidants. But Klamath algae, or extracts thereof, have shown to be able to greatly reduce lipid peroxidation, on average by 34–37% in 1–2 months, as measured by malonildialdehyde (MDA) plasma concentration, both in animal and human studies [28,31,32]. Moreover, a study performed at the University of Salamanca, Spain, showed the ability of a Klamath algae
+
+extract, even just at the nanomolar level, to completely prevent the increase in apoptosis of human neuronal cells [33]. Finally, as it is well known that the target organ for microcystins's toxicity is the liver, it is important to underline the hepato-protective activity of cyanobacterial phycocyanins [34], and how an extract of Aphanizomenon flos aquae was able to greatly reduce the damage to the liver by paracetamol intoxication [35].
+
+Before closing, I would like to stress the fact that recently the distinction between the toxic effect of purified microcystins, and the whole microalgae containing it, has been available not just indirectly from a more detailed analysis of the two Falconer et al. studies (10988, [9]), or of Schaeffer et al. study, but through a straight comparison of the toxicity of those two substances [36,37]. For instance, in a study on the toxic effect on bivalves of purified or concentrated microcystins on the one hand, and of the whole Microcystis aeruginosa naturally containing the same amount of microcystins on the other, it was found that, while the purified microcystins did create some liver challenge with a parallel significant increase in endogenous GSH, the whole algae with the same amount of microcystins did not ([36], p. 742):
+"Intact M. aeruginosa cells did not induce any significant response from the mussels, showing that these animals are quite resistant to the cyanobacteria if they are intact".
+
+To understand why, we need to look at the chart reporting the GST
+increases and decreases in the various organs of the bivalve (Fig. 2). As we can see, the GST increase caused by the concentrated or purified microcystin's toxicity is pretty significant in all organs, with the whole Microcystis aeruginosa being always close to control. In fact, it is interesting to notice how the whole Microcystis aeruginosa, in spite of having the same amount of toxin as the microcystin extract and as the purified microcystins, in 3 out of 5 organs generates indeed a small decrease of GST relative to control, which may be significant as we are about to see.
+
+There is, though, an anomaly: in the labial pulps, the extract and the purified toxins caused an opposite effect, namely a radical decrease of GST. The authors thus explain the anomaly (p. 744):
+"Both the pure toxins and, even more, the Microcystis extract caused a sharp decrease in GST activity. This suppression may be an indication that these organs may be responsible for the control of the MC intake and by that reduce the amount of toxin that enters the mussels".
+
+Thus, the labial pulps, by blocking the entering microcystins, generate such an accumulation as to force the expenditure of most of the available GST, which is thus radically reduced compared to control. In light of this, it emerges as particularly relevant the fact that the whole microalgae the GST, instead of being reduced as with the microcystins extract or purified, actually increased relative to control, in spite of the fact that the level of toxins in the whole algae is the same as in the extract and the purified microcystins. This can only mean one thing: the algae as a whole contains enough of its own antioxidants as to inactivate the microcystins, and possibly to promote the formation of GST
+itself in an area where the control of toxins is especially relevant.
+
+This is the same reason why, as noted above, in 3 out of 5 organs, where the microcystin challenge is lower than in the labial pulps, the whole microalgae not only did not increase the GST production as both microcystins extract and purified toxins did, but in fact it actually decrease the GST level even relative to control: this can only mean, again, that the microcystins content of the whole microalgae is completely offset by its content of antioxidant molecules, to the point that it actually reduces the need for the endogenous antioxidant protection by endogenous GST.
+
+Those who stress the risk of MC toxicity in microalgae, instead of just mechanically transposing the unrealistic water standard of 1 μg/
+L–1 g of microalgae, should therefore adopt a proper scientific approach, testing specifically each cyanobacterial supplement as such, be it whole microalgae such as Klamath AFA algae, or Spirulina or Fig. 1. Increase in the levels of plasma GSH (+16.8%) after 1 month of supplementation with an AFA algae product.
+
+![6_image_0.png](6_image_0.png)
+
+Chlorella, or specific extracts thereof, on mice or other animals. Indeed, when that was done, results clearly showed the untenability of crying out loud only for the fact that the MC level is just slightly above the mythical 1 μg/mg guideline. In the already quoted study by Schaeffer et al. [14], mice who had been dietarily fed for 6 months AFA Klamath microalgae providing 333 μg/kg/bw/day of microcystins, at the end of the 6 months period were in excellent health, with a liver in perfect condition. What is to be noticed is also the fact that the 333 μg/kg/bw/
+day was actually the only level of microcystins tested, which means that if higher levels of microcystins as contaminants of Klamath algae had been tested, the NOAEL could have been similarly higher. The authors of the study concluded (p. 73) that:
+"…the safe level of MCLR as a contaminant of A. flos aquae products is calculated to be 10.0 μg MCLR/g".
+
+Of course, everyone is entitled to disagree with this result, as verification and falsification are the fundamental principles of scientific research. But in order to prove this result wrong, one must repeat the experiment by using the whole cyanobacterial microalgae, with the same or variable quantities of contaminating microcystins, administered through proper dietary means. Any other way would not be proper experimental science, but an a priori application of merely theoretical standards.
+
+In 1999, the Italian Istituto Superiore di Sanità, requested by the public prosecutors of the Court of Rome first, and finally of the Court of Urbino, Italy, tested microcystins-containing Klamath AFA algae on mice for almost one year in different concentrations, and established, as officially reported in the final decision, that the product is safe and suited for human consumption (Ufficio del G.I.P. di Urbino, Decreto di Archiviazione del procedimento, 29 Ottobre 1999).
+
+Not all toxicologists insist on adopting abstract standards, established by testing with purified microcystins in purified water, to be then transposed automatically to microalgae. During the meetings of the Government of Oregon panel, which eventually established the only existing standard on microcystins in microalgae by applying to AFA
+Klamath supplements the 1 μg/g rule derived from the WHO water Guideline, there were differing positions. Proposals were presented, by such renown toxicologists such a Prof. Carmichael and Dr. Gary Flamm, for microcystins limits such as 5 μg/g up to 10 μg/g (documentation available at the Oregon Department of Agriculture). It is time to reevaluate the wisdom of such positions, putting them to the test of proper experimental science. It is my intention, as a follow-up to this review article, to perform a further experimental animal study to assess, along the lines of scientific research proposed here, the actual toxicity of microalgal and cyanobacterial supplements.
+
+## Conflict Of Interest
+
+Dr. Stefano Scoglio is R&D Director of a company distributing also cyanobacterial nutritional supplements.
+
+## Appendix A. Supplementary Data
+
+Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.toxrep.2018.07.002.
+
+## References
+
+[1] S. Vichi, et al., Contamination by Microcystis and microcystins of blue–green algae food supplements (BGAS) on the Italian market and possible risk for the exposed population, Food Chem. Toxicol. 50 (2012) 4493–4499.
+
+[2] A.H. Heussner, et al., Toxin content and cytotoxicity of algal dietary supplement, Toxicol. Appl. Pharmacol. 265 (December (2)) (2012) 263–271.
+
+[3] R. Draisci, et al., Identification of anatoxins in blue-green algae food supplements using liquid chromatography-tandem mass spectrometry, Food Addit. Contam. 18
+(June (6)) (2001) 525–531.
+
+[4] Y. Jiang, et al., Detection of the hepatotoxic microcystins in 36.660 kinds of cyanobacteria Spirulina food products in China, Food Addit. Contam. Part A Chem.
+
+Anal. Control Expo. Risk Assess. 25 (7) (2008) 885ff.
+
+[5] P. Gallo, et al., Contaminazione da biotossine in prodotti ittici e integratori alimentari, Ingredienti Alimentari. XI, Ottobre (2012), pp. 6–11.
+
+[6] W. Carmichael, et al., Harvesting of Aphanizomenon Flos Aquae Ralfs ex Born. &
+Flah. Var. flos aquae (Cyanobacteria) from Klamath Lake for human dietary use, J.
+
+Appl. Phycol. 12 (2000) 585–595.
+
+[7] WHO, Cyanobacterial toxins: microcystin-LR in drinking-water, originally published in guidelines for drinking-water quality, Addendum to Vol. 2. Health Criteria and Other Supporting Information, 2nd ed., World Health Organization, Geneva, 2003 1998.
+
+[8] I.R. Falconer, et al., Oral toxicity of a bloom of the Cyanobacterium Microcystis Aeruginosa administered to mice over periods up to 1 year, J. Toxicol. Environ.
+
+Health 24 (3) (1988) 291–305.
+
+[9] I.R. Falconer, et al., Toxicity of the blue-green alga (cyanobacterium) Microcystis Aeruginosa in drinking water to growing pigs, as an animal model for Human injury and Risk Assessment, Environ. Toxic. Water Qual. 9 (1994) 131–139.
+
+[10] J.K. Fawell, C.P. James, H.A. James, Toxins from Blue-Green Algae: Toxicological Assessment of microcystin-LR and a Method for Its Determination in Water. Report No. FR 0359/2/ DoE 3358/2, Foundation of Water Research, Marlow, UK, 1994, pp. 1–46.
+
+[11] J.K. Fawell, et al., The toxicity of cyanobacterial toxins in the mouse: I MicrocystinLR, Hum. Exp. Toxicol. 18 (1999) 162–167.
+
+[12] F.M. Buratti, et al., Cyanotoxins: producing organisms, occurrence, toxicity, mechanism of action and human health toxicological risk evaluation, Arch. Toxicol. 91
+(3) (2017) 1049–1130 Mar.
+
+[13] E. Funari, E. Testai, Human health risk assessment related to cyanotoxins exposure, Crit. Rev. Toxicol. 38 (2008) 97–125.
+
+[14] D.J. Schaeffer, et al., Risk assessment of microcystins in dietary aphanizomenon flos aquae, Ecotoxicol. Environ. Saf. 44 (1999) 73–80.
+
+[15] IARC, Ingested nitrate and nitrite, and cyanobacterial peptide toxins, IARC Working Group on the Evaluation of Carcinogenic Risks to Humans vol. 94, (2010), pp.
+
+1–412 v-vii.
+
+[16] S.J. Hoeger, et al., Occurrence and elimination of cyanobacterial toxins in drinking water treatment plants, Toxicol. Appl. Pharmacol. 203 (2005) 231–242.
+
+[17] T. Yoshida, Y. Ueno, et al., Acute Oral Toxicity of microcystin-LR, a cyanobacterial hepatoxin, in mice, Nat. Toxins 5 (3) (1997) 91–95.
+
+[18] C. Wang, et al., The toxic effects of microcystin-LR on mouse lungs and alveolar type II epithelial cells, Toxicon 115 (2016) 81–88.
+
+[19] X. Li, et al., Chronic exposure to microcystin-LR affected mitochondrial DNA
+maintenance and caused pathological changes of lung tissue in mice, Environ Pollut. 210 (2016) 48–56.
+
+[20] Y. Ueno, et al., No chronic oral toxicity of a low dose of microcystin-LR, a cyanobacterial hepatotoxin, in female BALB/c mice, Environ. Toxicol. 14 (1) (1999)
+45–55.
+
+[21] M.M. Gehringer, et al., An investigation of the role of vitamin E in the protection of mice against microcystin toxicity, Environ. Toxicol. 18 (April (2)) (2003) 142–148.
+
+[22] R. Jayaraj, et al., Hepatoprotective efficacy of certain flavonoids against microcystin induced toxicity in mice, Environ. Toxicol. 22 (October (5)) (2007) 472–479.
+
+[23] R. Matsushima-Nishiwaki, et al., Suppression by carotenoids of microcystin-induced morphological changes in mouse hepatocytes, Lipids 30 (November (11)) (1995)
+1029–1034.
+
+[24] M.M. Gehringer, et al., An investigation into the effect of selenium supplementation on microcystin hepatotoxicity, Toxicon. Mar 41 (4) (2003) 451–458.
+
+[25] S.J. Hermansky, et al., Evaluation of potential chemoprotectants against microcystin-LR hepatotoxicity in mice, J. Appl. Toxicol. 11 (February (1)) (1991) 65–73.
+
+[26] K.A. Mereish, et al., Protection against microcystin-LR-induced hepatotoxicity by Silymarin: biochemistry, histopathology, and lethality, Pharm. Res. 8 (February (2))
+(1991) 273–277.
+
+[27] Z.A. Mohamed, Polysaccharides as a protective response against microcystin-induced oxidative stress in Chlorella vulgaris and Scenedesmus quadricauda and their possible significance in the aquatic ecosystem, Ecotoxicology 17 (August (6))
+(2008) 504–516.
+
+[28] S. Scoglio, et al., Effect of a two-months treatment with Klamin®, a Klamath algae extract, on the general well-being, antioxidant profile and oxidative status of postmenopausal women, Gynecol. Endocrinol. 25 (4) (2009) 235–240.
+
+[29] S. Benedetti, et al., Oxygen radical absorbance capacity of phycocyanin and phycocyanobilin from the food supplement Aphanizomenon flos-aquae, J. Med. Food 13 (February (1)) (2010) 223–227.
+
+[30] S. Benedetti, et al., Stato antiossidante e perossidazione lipidica in risposta alla supplementazione con alga Klamath, Medicina Naturale (Novembre) (2003) 67–72.
+
+[31] S. Sedriep, et al., Beneficial nutraceutical modulation of cerebral erythropoietin expression and oxidative stress: an experimental study, J. Biol. Regul. Homeost.
+
+Agents 25 (April–June (2)) (2011) 187–194.
+
+[32] G.C. Kuriakose, M.G. Kurup, Evaluation of renoprotective effect of Aphanizomenon flos-aquae on cisplatin-induced renal dysfunction in rats, Ren. Fail. 30 (7) (2008)
+717–725.
+
+[33] Y. Benedetti, Neuromodulating and Neuroprotective Activity of Microalga Aphanizomenon flos Aquae, Università di Urbino, Facoltà di Scienze, Dottorato in Metodologie Biochimiche e Farmacologiche, 2012.
+
+[34] Y. Ou, et al., Protective effect of C-phycocyanin against carbon tetrachloride-induced hepatocyte damage in vitro and in vivo, Chem. Biol. Interact. 185 (April (2))
+(2010) 94–100.
+
+[35] G.C. Kuriakose, M.G. Kurup, Antioxidant and hepatoprotective activity of Aphanizomenon flos-aquae Linn against paracetamol intoxication in rats, Indian J.
+
+Exp. Biol. Nov 48 (11) (2010) 1123–1130.
+
+[36] V.M. Vasconcelos, et al., Dynamics of glutathione-S-transferases in Mytilus galloprovincialis exposed to toxic Microcystis aeruginosa cells, extracts and pure toxins, Toxicon 50 (November (6)) (2007) 740–745.
+
+[37] X.Y. Li, et al., Oral exposure to Microcystis increases activity-augmented antioxidant enzymes in the liver of loach (Misgurnus mizolepis) and has no effect on lipid peroxidation, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 141 (July (3))
+(2005) 292–296.

medical/md/PMC6136111.md

@@ -0,0 +1,535 @@
+# Measuring The Impact Of Tinnitus On Aided Listening Effort Using Pupillary Response Josefine Juul Jensen1,2, Susanna L. Callaway2, Thomas Lunner3,4,5, And Dorothea Wendt5,6
+
+Trends in Hearing Volume 22: 1–17
+! The Author(s) 2018 Article reuse guidelines:
+sagepub.com/journals-permissions DOI: 10.1177/2331216518795340 journals.sagepub.com/home/tia
+
+## Abstract
+
+Tinnitus can have serious impact on a person's life and is a common auditory symptom that is especially comorbid with hearing loss. This study investigated processing effort required for speech recognition in a group of hearing-impaired people with tinnitus and a control group (CG) of hearing-impaired people without tinnitus by means of pupillary response.
+
+Furthermore, the relationship between the pupillary response, self-rating measures of tinnitus severity, and fatigue was examined. Participants performed a speech-in-noise task with a competing four-talker babble at two speech intelligibility levels (50% and 95%) with either an active or inactive noise-reduction scheme while the pupillary response was recorded. Tinnitus participants showed significantly smaller time-dependent pupil dilations and significantly higher fatigue ratings. No correlation was found for the tinnitus severity and pupillary response, but a significant correlation was found between the tinnitus severity and fatigue. As participants with tinnitus generally reported higher fatigue and showed smaller task-evoked pupil dilations, it was speculated that this may suggest an increased activity of the parasympathetic nervous system, which governs the bodily response during rest. The finding that tinnitus participants showed higher fatigue has clinical implications, highlighting the importance of taking steps to decrease the risk of developing long-term fatigue. Finally, the tinnitus participants showed reduced pupillary responses when noise reduction was activated, suggesting a reduced effort from hearing aid signal processing.
+
+## Keywords
+
+tinnitus, pupillometry, pupil dilation, effort, hearing impairment, noise reduction, hearing aids, fatigue, need for recovery Date received: 18 January 2018; revised: 14 June 2018; accepted: 9 July 2018
+
+## Introduction
+
+Tinnitus is a common auditory symptom that can affect all people with or without hearing loss (Langguth, Kreuzer, Kleinjung, & De Ridder, 2013). Tinnitus is defined as the perception of meaningless sound that occurs without any external sound stimuli (Langguth et al., 2013). The literature estimates that 5% to 15% of the global adult population have chronic tinnitus
+(Axelsson & Ringdahl, 1989; Hoffmann & Reed, 2004; Khedr et al., 2010; Lasisi, Abiona, & Gureje, 2010; Michikawa et al., 2010; Nondahl et al., 2002; Ries, 1994; Shargorosky, Curhan, & Farwell, 2010; Xu et al.,
+2011). The effect and impact of tinnitus vary from nonexistent to profound (Baguley, Andersson, McFerran, &
+McKenna, 2013), and the majority of people are relatively unaffected by their tinnitus. For approximately 10% to 20% of tinnitus sufferers, tinnitus can affect sleep, mood, and daily life activities (Davis & Rafaie, 2000). It is generally estimated that approximately 2%
+of the tinnitus population is so severely affected by their tinnitus that quality of life is severely impaired
+(Langguth et al., 2013; Rossiter, Stevens, & Walker, 2006). Although it is well established that tinnitus patients subjectively report that tinnitus disturbs the 1Department of Nordic Studies and Linguistics, University of Copenhagen, Denmark 2Centre for Applied Audiology Research, Oticon A/S, Smørum, Denmark 3Department of Behavioral Sciences and Learning, Linko¨ping University 4The Swedish Institute for Disability Research, Linko¨ping University and O¨ rebro University, Sweden 5Eriksholm Research Centre, Snekkersten, Denmark 6Hearing Systems Group, Department of Electrical Engineering, Technical University of Denmark, Kongens Lyngby, Denmark Corresponding author:
+Josefine Juul Jensen, Oticon A/S, Kongebakken 9, 2765 Smørum, Denmark.
+
+Email: josj@oticon.com cognitive mechanisms of concentration (Andersson, Lyttkens, & Larsen, 1999; Tyler & Baker, 1983), evidence for the involvement of tinnitus in other cognitive mechanisms is weak. Whether tinnitus affects performance on cognitive tasks is under debate, especially regarding its effects on behavioral and objective measures, and further research within the field is warranted
+(Andersson & McKenna, 2006; Mohamad, Hoare, & Hall, 2016; Tegg-Quinn, Bennet, Eikelboom, &
+Baguley, 2016). For the cognitive component of working memory (WM), results vary. Rossiter et al. (2006) found that tinnitus participants performed worse on a reading span test, suggesting a poorer WM capacity. Similarly, Stevens, Walker, Boyer, and Gallagher (2007) found significantly slower reaction times on a dual-task paradigm for tinnitus patients, suggesting a poorer WM performance in high-demand tasks. However, neither study controlled for hearing loss, which may have been the main factor contributing to the group effects (Tegg-Quinn et al., 2016). Hallam, McKenna, and Shurlock (2004) compared tinnitus and nontinnitus patients with similar hearing status on performance with a dual task and found poorer performance in the tinnitus patients. For the component of attention, Cuny, Norena, El Massioui, and Che´ry-Croze (2004) investigated auditory attention in individuals with unilateral tinnitus. They found that participants with unilateral tinnitus had more difficulty shifting attention to the nontinnitus ear, and that the participants had a biased attention toward the tinnitus ear. They also found tinnitus severity to be associated with less efficient attention capability. Stevens et al.
+
+(2007) found similar results in their study in which they investigated reaction times using the Stroop color–word test, where words for colors are written in alternating corresponding and noncorresponding colors. The tinnitus group (TG) had slower reaction times, and the authors interpreted that to mean tinnitus causes an impairment in attention . In contrast, Heeren et al. (2014) found no significant difference between tinnitus and control participants in an attention test. The support behind tinnitus affecting cognitive mechanisms is mixed, and it is deemed necessary to explore the degree to which factors such as hearing loss may be involved. The literature has suggested that only few differences in objective measures are found when individuals with hearing loss are used as controls, perhaps because hearing loss and tinnitus may have similar cognitive consequences
+(Andersson & McKenna, 2006; McKenna & Hallam, 1999; Tegg-Quinn et al., 2016).
+
+Research on possible effects of tinnitus on the cognitive mechanism of effort is unexplored. Effort can be defined as the intentional allocation of resources that are applied to overcome obstacles when pursuing a goal in a task (Pichora-Fuller et al., 2016). For processing effort, the applied resources are mental resources, and two factors are involved in processing effort. One factor is the processing demand, which is created by the task or the environment in which the processing occurs. The other factor is related to the listener and can be dependent on hearing loss (Mattys, David, Bradlow, & Scott, 2012; Wendt, Koelewijn, Ksiazek, Kramer, & Lunner, 2017), cognitive abilities such as WM (Koelewijn, Zekveld, Festen, & Kramer, 2014), or individual motivation to expend mental effort (PichoraFuller et al., 2016). Based on the aforementioned research, it is probable that tinnitus affects processing effort, as tinnitus may affect factors related to the listener, for example, cognitive abilities.
+
+Effort (as the umbrella term for processing effort, listening effort, and cognitive effort) can be assessed with behavioral, subjective, and physiological methods
+(Ohlenforst et al., 2017; Pichora-Fuller et al., 2016).
+
+Within the physiological methods, the pupillary response is considered to reflect processing load (Beatty, 1982; Pichora-Fuller et al., 2016; Zekveld & Kramer, 2014).
+
+The task-evoked pupil dilation response can be associated with both the sympathetic nervous system (SNS)
+and parasympathetic nervous system (PNS) branches of the autonomic nervous system. These branches are in the control of different responses, where the SNS controls the ''fight or flight'' response necessary in stressful situations, and the PNS controls the ''rest or digest''
+response, which is active in situations that do not require the body to prepare for fighting or fleeing. Although both branches are active during pupil dilation, it is mainly governed by the SNS system (Kahneman, 1973), but the balance of the branches may be askew in certain populations (Wang et al., 2018). Pupillometry has been applied to obtain measures of cognitive processing load (Beatty, 1982; Kahneman, 1973). Furthermore, it has been used successfully as an index of effortful listening during speech recognition to investigate the effect of hearing status, hearing aid (HA) signal processing, or task difficulty on effort, within the field of hearingrelated research (e.g., Wendt et al., 2017; Zekveld, Kramer, & Festen, 2010).Those studies measured pupil dilation, while participants recognized everyday sentences in background noise. Commonly, three different parameters of pupil dilation are assessed with pupillometry in those studies: the peak of the pupil dilation (PPD),
+the latency of the peak dilation, and the mean pupil dilation within a given time frame (Zekveld, Kramer, &
+Festen, 2011). It has been suggested that the PPD reflects momentary, task-induced effort, and it has been demonstrated that the pupil dilation can change according to hearing status and task demands. For example, Ohlenforst et al. (2017) showed that PPD changed depending on the listener's hearing abilities and that individuals with hearing loss had large PPDs over a wider range of signal-to-noise ratios (SNRs) compared with normal hearing (NH) controls, whose PPD was at its maximum in a narrower range of SNRs.
+
+Although the PPD has traditionally been used as a measure in pupillometry studies, some recent studies show that other ways of analyzing pupillary response can be more sensitive (Kuchinsky et al., 2013; Wendt et al., 2018; Winn, Edwards, & Litovsky, 2015). For instance, growth curve analysis (GCA) has been applied in recent studies to model the change of the pupillary response over time, rather than analyzing static effects at a particular point in the pupil dilation (Mirman, Dixon, & Magnuson, 2008). With GCA, parameters of the pupillary response, such as steepness of the dilation, the overall shape, and the overall slope, can be investigated. As the GCA may reveal the impact of tinnitus on the time course of the pupillary response, which may not be reflected in the PPD, it was included in this study.
+
+Many persons with hearing loss report tinnitus.
+
+However, to the best of the authors' knowledge, the impact of tinnitus on processing effort, as indicated by the pupillary response, has not yet been studied. As previous studies have suggested that several listener-related factors may influence the pupil response evoked by a task, such as the hearing status (Ohlenforst et al., 2017; Zekveld et al., 2011), cognitive abilities such as WM capacity (Zekveld & Kramer, 2014), and the age of the participant (Zekveld et al., 2011), it seems pertinent to investigate whether tinnitus is another listener-related factor that may impact processing effort.
+
+In this study, it was hypothesized (H1) that individuals with tinnitus and hearing loss (TG) will display an increased task-evoked processing effort as assessed by the pupillary response compared with those with hearing loss who do not have tinnitus (CG). As it has already been shown, listener-dependent factors such as hearing loss can increase processing effort; thus, it seems reasonable to suspect that tinnitus further adds to effort.
+
+In addition to listener-dependent factors, it has also been shown that signal-related factors influence processing effort (Koelewijn, Zekveld, Festen, & Kramer, 2012; Ohlenforst et al., 2017; Wendt et al., 2017). It has previously been seen that HA processing can reduce listening effort for people with hearing loss. Wendt et al. (2017)
+investigated the benefit of HA signal processing by measuring the PPD during a speech-in-noise test (hearing in noise test [HINT], Nilsson, Soli, & Sullivan, 1994) in participants with aided hearing loss. Pupillary response was measured at two different intelligibility levels, and two different settings of the HAs, that is, with an active and inactive noise reduction (NR) scheme. They found that the PPD decreased, indicating a reduced processing effort, as a function of the intelligibility (from 50% to 95%) and as a function of the NR scheme. Interestingly, they demonstrated a reduced processing effort even at ceiling performance levels.
+
+Based on the aforementioned rationale, it was hypothesized (H2) that applying an NR scheme would significantly reduce processing effort as assessed by pupillary response. Furthermore, based on previous research showing that tinnitus severity was related to less efficient attention capability (Cuny et al., 2004), it was hypothesized (H3) that subjective tinnitus severity would correlate with objective PPD, such that the worse you perceive your tinnitus, the more effort you expend in the task.
+
+Being required to spend more effort in order to meet demands (such as understanding speech with a hearing loss) may accumulate, with the consequence of fatigue over time. Fatigue is a complex phenomenon that can occur in the short term as a consequence of spending extra mental effort during, for example, a challenging task or a shorter period of increased demands at work.
+
+It can also be a continuous state as a consequence of a persistent disease or lack of possible recovery after longer periods of stress (Hornsby, Naylor, & Bess, 2016)—and perhaps tinnitus. Implications suggest that people with hearing loss are more fatigued than normal-hearing individuals (Kramer, Kapteyn, & Houtgast, 2006; Nachtegaal, Festen, & Kramer, 2012). To the best of our knowledge, no study has investigated the presence of fatigue in individuals with tinnitus.
+
+However, research suggests that tinnitus is associated with emotional exhaustion (He´bert, Canlon, & Hasson, 2012), sleep disturbance (Alster, Shemesh, Ornan, &
+Attias, 1993), and insomnia (Cro¨nlein, Langguth, Geisler, & Hajak, 2007; Folmer & Griest, 2000). In line with the hypothesis that people with tinnitus expend more effort and the suggestion that consequences of effort accumulate over time, this study also investigated self-reported daily life fatigue. Consequently, it was hypothesized (H4) that people with tinnitus and hearing loss show increased ratings of self-reported daily life fatigue than people with hearing loss and no tinnitus and that self-rated tinnitus severity will correlate with selfrated fatigue, meaning the worse you perceive your tinnitus, the more fatigued you are likely to feel.
+
+## Materials And Methods Participants
+
+Sixteen participants with chronic tinnitus lasting at least 6 months with an average age of 62 years, ranging from 45 to 79 years, were included in the TG, and 16 participants with an average age of 67 years, ranging from 47 to 84 years, were included in the CG. All participants were native Danish speakers and had bilateral sensorineural hearing loss (Figure 1). The pure-tone average from 500 to 4000 Hz ranged from 18 to 75 dB HL with an average of 42 dB HL for the TG and from 36 to 66 dB HL with
+
+![3_image_0.png](3_image_0.png)
+
+an average of 49 dB HL for the CG. The participants were all experienced and bilaterally fitted HA users, having used HAs for the majority of the day for at least 3 months, and had no history of eye disease or eye operations. Independent samples t-tests were performed to compare the groups. No significant differences were found on age and gender nor between the 4-point averages on the right and left ear (cf. Table 1).
+
+Participants were given both verbal and written instructions prior to giving written consent. The ethics of this project were approved by the Research Ethics Committees of the Capital Region of Denmark.
+
+## Speech Material And Noise Conditions
+
+Sentences from the Danish HINT (Nielsen & Dau, 2011)
+were presented in a four-talker babble consisting of four overlapping talkers. The masker was constructed with four single audio files of two male and two female speakers. All of them were nonprofessional speakers reading text from a newspaper. All audio files had an equivalent long-term average frequency spectrum to the Danish HINT sentences, and speech pauses longer than 0.05 s were removed from the recordings. A spatial setup
+(Figure 2) of five loudspeakers was used in which the target HINT sentences were presented from the front of the speaker (at 0) and the four-talker babble
+
+| F(df)      | Significance   | t    |      |
+|------------|----------------|------|------|
+| Age        | 2.8 (30)       | .107 | 1.45      |
+| Gender     | 0.2 (30)       | .629 | 0.34 |
+| PTA4 Right | 1.4 (30)       | .254 | 0.49      |
+| PTA4 Left  | 0.8 (30)       | .375 | 0.14 |
+| p <.05.    |                |      |      |
+
+masker was presented from the sides and back of the participant. Each competing talker of the babble masker was presented spatially from one of the four loudspeakers. One male and one female speaker were always presented from the 90- and 270- azimuth position, ensuring that the effect of competing talkers was balanced across all conditions.
+
+A single trial consisted of the duration of the masker presentation that started 3 s prior to the HINT sentence onset and terminated 3 s after sentence offset. Thus, each trial length varied according to the length of the HINT
+sentence, with a mean duration of 7.5 s. Subsequent to the offset of noise, participants were asked to repeat back the sentence to the best of their ability. Each participant performed three training lists of 20 sentences each at the beginning of the session, where the first list was
+
+![4_image_0.png](4_image_0.png)
+
+performed in order to familiarize themselves with the procedure, and the second and third lists were performed to estimate the 50% and 95% speech reception threshold
+(SRT50 and SRT95). SRT50 and SRT95 were defined as the individual levels of SNRs where the participant recognized 50% and 95%, respectively.
+
+## Nr Scheme
+
+The participants were tested in two different conditions while wearing HAs. In Condition 1 (NoNR), no NR scheme was applied, and amplification was provided with only the proprietary rationale, Voice Aligned Compression (VAC; Le Goff, 2015). The VAC rationale is a curvilinear wide dynamic range compression and is characterized by providing less compression at high input levels and more at low input levels, with a compression knee point between 30 and 40 dB SPL, depending on the frequency region and magnitude of hearing loss.
+
+In the other HA condition (NR), an NR scheme was applied in addition to the VAC rationale prescribed amplification. This scheme consisted of different blocks of processing. First, three fixed beamformers combined two microphone signals in order to enhance omnidirectional and rear cardioid signals. Next, a two-channel minimum variance distortion-less response beamformer
+(Kjems & Jensen, 2012) was applied to attenuate interfering signals using spatial filtering when the signals did not come from the front of the listener where the target was located. Then, a single-channel postfilter (Jensen &
+Pedersen, 2015) removed interfering noise in postprocessing of the signal.
+
+## Estimation Of L50 And L95
+
+To have comparable speech intelligibility levels, each participant's Level 50 (L50, corresponding to SRT50)
+and Level 95 (L95, corresponding to SRT95) were identified. The individual L50s and L95s were estimated with a word-correct scoring for sentences presented in fourtalker babble. The estimations were obtained with HAs set in the NoNR condition. An adaptive procedure was applied to both levels. An adaptive procedure (Levitt, 1971) was used to estimate L95. In this procedure, the L95 was estimated from the SRT80 by fitting a psychometric function to the data. The average L50 for the TG
+was 0.4 dB SNR (2.5) and for the CG was 0.4 dB SNR (2.7), with no significant difference between groups, F(1, 31) ¼ 0.00, p ¼ .97. The average L95 for the TG was 6.3 dB SNR (3.8) and for the CG was 6.8 dB SNR
+(3.6), with no significant difference between groups, F(1, 31) ¼ 1.8, p ¼ .29. Participants completed four test lists after training: two in NoNR (at L50 and L95) and two in NR (at L50 and L95). Each test list consisted of 25 sentences, and the order of list presentation was randomized using the random number function in Excel
+(Microsoft- Office Proofing Tools,  2012 Microsoft Corporation). This function returns a random number evenly distributed between 0 and 1, which changes on calculation. Participants wore HAs during the entire test (including training), and while they were performing the speech recognition task, an eye-tracking camera recorded their pupil dilation online.
+
+## Tinnitus Handicap Inventory
+
+The Tinnitus Handicap Inventory (THI; originally developed by Newman, Jacobsen, & Spitzer, 1996) assesses the degree of severity of tinnitus in terms of quality of life. The Danish version of the THI (Zachariae et al.,
+2000) was used in this study. The participants in the TG were asked to fill out the THI at the beginning of the session. The THI consists of 25 questions (e.g.,
+''Because of your tinnitus, is it difficult for you to concentrate?'') where answer options are either yes (4 points), sometimes (2 points), or no (0 points). The THI
+scores range from 0 to 100 points, which correspond to a range of tinnitus categorizations (very mild, mild, moderate, severe, or catastrophic). The average THI score was 38, corresponding to moderate tinnitus, ranging from 20
+(mild tinnitus) to 70 (severe tinnitus). One participant was excluded due to a THI score of 12 (very mild tinnitus).
+
+## Thermometer
+
+The Tinnitus Thermometer (IDA Institute) is a tool that gauges how the person feels about their tinnitus at that very moment. It is a smiley face scale with corresponding numbers from 0 to 10, where 0 represents no tinnitus, and 10 represents worst tinnitus Some patients with tinnitus have varied experiences in how their tinnitus affects them
+(e.g., Stouffer & Tyler, 1990), and the tool can be used to assess how a patient feels about their tinnitus at a given moment. The thermometer was not used for statistical analysis, but it was applied to ensure that the participant was actually experiencing tinnitus on the day of the experiment.
+
+## Need For Recovery Scale
+
+The Need for Recovery (NFR; developed by van Veldhoven & Broersen, 2003) is intended as a surveillance approach to discover early signs of fatigue and prevent them from developing into long-term fatigue that could require a leave of absence. The NFR is an 11-item scale that measures symptoms of daily-life fatigue where the subject must answer either ''yes or ''no''.
+
+Yes indicates the unfavorable situations, except for one question, whereas No indicates the unfavorable situation. To calculate the score, the number of yes answers
+(and the single item where no is unfavorable) are divided by the total number of items (11) and then multiplied by a 100 to get the score as percentage. The greater the score, the greater the NFR, indicating a greater level of fatigue. A Danish translation was used in this study.
+
+## Apparatus And Spatial Setup
+
+Pupillary response was measured using an eye-tracker system (iView X RED System; Sensor-Motoric Instruments, Teltow, Germany) that recorded pupil dilation with a sampling rate of 60 Hz. The infrared camera with an automatic eye and head tracker was placed in front of the participant with a distance of approximately 60 cm to measure both eyes remotely. Stimuli presentation was controlled using MATLAB-based programming (MathWorks, Natick, MA). Auditory signals were routed through a sound card (RME Hammerfall DSB multiface II; Audio AG, Haimhausen, Germany) and played back via five Genelec 8040A loudspeakers
+(Genelec Oy, Iisalmi, Finland). The experiment was performed in an acoustics-treated, double-walled IACNORDIC (IAC Acoustics, Hvidovre, Denmark) sound booth. Participants' pupil x and y traces of both eyes were recorded to detect horizontal and vertical eye movements, respectively. For the analysis, only data from the left eye were used.
+
+## Pupil Data Analysis
+
+Peak pupil dilation. To avoid any potential effects of training, excitement, or arousal, the pupil traces from the first five trials were excluded from the data analysis. The recordings from the pupillary response of the remaining 20 trials were analyzed as follows: In the first step, eye blinks, eye movements, and other artifacts were removed from the recordings. This was achieved by removing pupil diameter values that exceeded the mean diameter by more than three standard deviations (SDs). Trials that contained more than 20% eye-blinks, eye movements, or missing data, and eye-movements larger than 10- from the fixation target, were excluded from the analysis. The detected eye blinks and movements were removed using a linear interpolation. The interpolation was applied 5 samples before and ended 10 samples after the blinks or movements. In a second step, high-frequency artifacts were removed by passing a 5-point moving average smoothing filter over individual trials.
+
+The third step included a baseline correction for all remaining traces. A baseline value was estimated using the mean pupil size approximately 1 s before sentence onset (where the participant listened to only noise; Figure 3). This baseline value was then subtracted from the whole pupil curve within each trial. The baselinecorrected pupil responses were then averaged across all remaining trials for each condition. Finally, the PPD was calculated for each participant and each condition
+(NoNR L50, NR L50, NoNR L95, and NR L95),
+which was defined as the maximum pupil dilation within the time interval between the sentence onset and noise offset.
+
+Growth curve analysis. In addition to the PPD, GCA
+(Mirman, 2014) was used to model change in pupillary response over time, as it has been applied in previous studies on pupillometry (Kuchinsky et al., 2013; Wendt et al., 2018; Winn et al., 2015). The GCA is a multilevel regression technique that fits orthogonal polynomials to the time course pupil data in order to examine morphology of the pupillary response. By applying this statistical model, the hypothetical effect of tinnitus on processing effort can be investigated over time.
+
+In this study, a third-order (cubic) orthogonal polynomial was applied with fixed effects of SNR, NR, and group. In addition, the linear term was included in the model as a random term in order to represent the distributed variance at the individual level and compensate for the overall slope. The model was applied to the overall time course of pupil dilation within a time window from 2 to 7 s of stimulus presentation. A third-order (cubic) orthogonal polynomial was applied which used a linear combination of three orthogonal time terms
+(linear, quadratic, and cubic). The intercept is interpreted as an indicator of the overall height or mean of the pupillary response. The linear term indicates the overall slope of the pupil curve, the quadratic term represents the shape, and thus the symmetric rise and fall rate around
+
+![6_image_0.png](6_image_0.png) 
+
+a primary inflection point of the primary reflection. The cubic term supposedly reflects the differences in the rise and fall, thus reflecting the steepness of the curve around the inflection point (see Mirman et al., 2008). An analysis of variance (ANOVA) was performed in order to compare model fit in each condition. The ANOVA showed that the cubic term had an effect when comparing the two groups and improved the model fit. Thus, the following formula was used for the GCA.
+
+## Pupildilation  Ð Þ 1 Þ Linear Þ Quadratic Þ Cubic
+
+ Group þ ð Þ 1 þ LinearjSubject The lme4 package (Bates, Ma¨chler, Bolker, & Walker, 2015) was employed in R-studio (Version 1.1.383, 2009–2017 RStudio, Inc.) for the GCA computations.
+
+For more detailed information about the GCA methods, principles, and applications, see Mirman et al. (2008).
+
+Individual coefficients were extracted from the GCA for the tinnitus participant, meaning each individual has a coefficient for the intercept, linear, and quadratic term for each condition; the average of these per individual was later used for statistical analysis.
+
+## Statistical Analyses
+
+Before investigating the hypotheses, an ANOVA was conducted on the speech recognition performance. This was to confirm that the groups did not differ on performance, meaning that performance would not be speculated to cause any pupil differences between groups. To test whether the TG group showed increased task-evoked processing effort as assessed by the pupillary response (H1), an ANOVA was conducted on the PPD and on the GCA. The above analyses were also conducted to test H2, that is, applying an NR scheme would significantly reduce processing effort. To test whether the worse you perceive your tinnitus, the more effort you expend in a task (H3), a Pearson correlation and Spearman's rho analyses were carried out to investigate correlations between subjective measures of tinnitus and objective pupil data. Finally, to test H4, that is, the TG would show increased self-reported daily life fatigue and that tinnitus severity would correlate with fatigue severity, a t-test was conducted on the groups' subjective measures of fatigue, and correlation analyses were conducted between the subjective tinnitus and fatigue measures. In addition, to investigate an effect of the experiment over time, a t-test was conducted on the individual pupil baselines for participants' first and last condition of the experiment.
+
+## Results Speech Recognition Performance
+
+Primarily, a t-test was conducted to investigate differences in the individually adapted SNRs. There were no significant differences in the SNRs in the 50% intelligibility level between groups, F(1, 30) ¼ 0.0, p ¼ .99 nor the 95% level, F(1, 30) ¼ 1.8, p ¼ .29. For the performance, Figure 4 shows the mean response accuracy across participants for the speech recognition task. The highest accuracy was measured for the L95 conditions (between 92.7% and 97.9% for TG and 94.8% and 98.1% for CG). For the L50, the recognition performance was between 61.8% for the NoNR and 89.6% for the NR
+for the TG, and 61.9% for the NoNR and 89.3% for the NR for CG. For both groups, speech recognition performance during the NoNR L50 condition was quite
+
+![7_image_0.png](7_image_0.png)
+
+high. The performance on the speech recognition task was analyzed using an ANOVA with intelligibility level
+(L50 and L95) and NR scheme (NoNR, NR) as the within-subject factors and group as the between-subject factor. The ANOVA revealed a main effect of intelligibility, F(1, 30) ¼ 247.6, p < .001, indicating a significant improvement in speech recognition at L95, but no significant effect of the group, F(1, 30) ¼ 0.582, p ¼ .45.
+
+In addition, a main effect of NR was measured, F(1, 30) ¼ 265.6, p < .001, indicating significantly increased speech recognition when NR was applied but no significant effect of the group, F(1, 30) ¼ 0.679, p ¼ .42. Finally, an interaction effect between intelligibility and NR was found, F(1, 30) ¼ 132.3, p < .001. Most importantly, the lack of significant group differences in the aforementioned factors makes the groups adequate for comparisons on pupil dilation.
+
+## Does Tinnitus Affect Pupillary Response?
+
+Peak pupil dilation. The PPD was calculated based on the remaining trials for each condition. The PPDs are plotted in Figure 5 for all four test conditions. The effect of intelligibility level, NR, and group on PPD was analyzed by ANOVA with intelligibility level (L50 and L95) and NR scheme (NoNR and NR) as the within-subject factors and with group as the betweensubject factor. The ANOVA revealed a main effect of intelligibility, F(1, 31) ¼ 10.1, p < .005, indicating a significantly increased PPD at L50. An effect of the NR on PPD was found, F(1, 31) ¼ 10.4, p < .005, indicating a significantly reduced PPD for the NR conditions. However, no significant differences between groups on level, F(1, 30) ¼ 0.3, p ¼ .59, or on NR, F(1, 30) ¼ 1.8, p ¼ .19, were found. These results may indicate that tinnitus does not further add to the PPD in a speech recognition in noise task. No significant differences in the pupil baseline values were found between the four conditions nor between groups.
+
+Pupil GCA. As no differences were identified between the groups in the PPD, the GCA was applied to model further changes of the pupillary response over time between both groups. The results (shown in Figures 6–9) depict the pupil dilation data relative to the baseline and fitted model responses as a function of time. An ANOVA Type III with a p value criterion of <.05 was conducted on the individual coefficients to examine any significant differences in the coefficients between groups related to the condition (NoNRL50, NR L50, NoNRL95, and NRL95). Type III was chosen because it ensures consistency in comparison. Table 2 provides the results in which beta values associated with each polynomial term are presented. The GCA demonstrated that TG
+showed significantly smaller pupil dilations in the intercept, linear, and quadratic terms in condition NoNRL50
+(b ¼ 0.05; p ¼ .001, b ¼ 0.11; p ¼ .001, and b ¼ 0.07; p ¼ .001), the intercept and linear terms for condition NoNRL95 (b ¼ 0.10; p ¼ .001 and b ¼ 0.06; p ¼ .001),
+and for condition NRL95 (b ¼ 0.17; p ¼ .001 and b ¼ 0.15; p ¼ .001).
+
+## Does Tinnitus Severity Affect Pupillary Response?
+
+Tinnitus Handicap Inventory. The THI was applied to assess the TG participants' self-perceived tinnitus severity. The average THI score was 38 (SD 15.5), ranging from 20 to 70, with N ¼ 9 in the mild category, N ¼ 6 in the moderate category, and N ¼ 1 in the severe category. To investigate relationships between tinnitus self-ratings and processing effort (H3), a Pearson correlation analysis was conducted. No significant correlation was found between any measures, except for the THI and the selfrating of daily life fatigue (NFR), where a significant, moderate correlation was found (r ¼ .57, p < .05; cf.
+
+next section). No significant correlations were found between the THI and the PPD in any conditions.
+
+In addition, a Spearman's rho analysis was conducted between the THI and the individual coefficients for the intercept and linear terms of the growth curve. This was performed in order to investigate whether there were correlations between the severity of the tinnitus (assessed by THI) and the average temporal changes of the pupil dilation. No significant correlations were found between the THI and any of the pupil variables (r ¼ .24, p ¼ .36 for NoNR50; r ¼  .08, p ¼ .77 for NR50; r ¼ .08, p ¼ .76 for NoNR95; and r ¼ .04, p ¼ .88 for NR95).
+
+## Does Tinnitus And Tinnitus Severity Affect Fatigue?
+
+NFR, pupil baselines. The NFR was performed to measure participants' level of self-reported daily life fatigue. The average test result of the TG was 51.5% (SD 28.9%), ranging from 9% to 90%, and for the CG, the average was 23.1% (SD 18.1%), ranging from 9% to 63%. An
+
+![8_image_0.png](8_image_0.png)
+
+![8_image_1.png](8_image_1.png)
+
+9
+
+![9_image_0.png](9_image_0.png)
+
+![9_image_1.png](9_image_1.png)
+
+| Formula code: PupilDilation  (1 þ Linear þ Quadratic þ Cubic)  Group þ (1 þ LinearjSubject) NoNR L50 TG > CG NR L50 TG > CG NoNR L95 TG > CG                                                                                                                                                               | NR L95 TG > CG   |                |     |      |                |    |      |                |     |      |                 |     |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------|------------------|----------------|-----|------|----------------|----|------|----------------|-----|------|-----------------|-----|
+| Term                                                                                                                                                          | b                | F(df)          | p   | b    | F(df)          | p  | b    | F(df)          | p   | b    | F(df)           | p   |
+| Intercept                                                                                                                                                     | 0.05             | 14.1 (1, 1094) | *** | 0.00 | 0.38 (1, 1134) | 1  | 0.03 | 29.4 (1, 1135) | *** | 0.17 | 46.61 (1, 1098) | *** |
+| Linear                                                                                                                                                        | 0.11             | 25.8 (1, 1092) | *** | 0.00 | 0.07 (1, 1133) | 1  | 0.08 | 16.9 (1, 1135) | *** | 0.15 | 39.2 (1, 1094)  | *** |
+| Quadratic                                                                                                                                                     | 0.07             | 18.4 (1, 1098) | *** | 0.00 | 0.40 (1, 1135) | 1  | 0.02      | 0.21 (1, 1135) | 1   | 0.01 | 2.1 (1, 1098)   | 1   |
+| Cubic                                                                                                                                                         | 0.00             | 0.0 (1, 1098)  | 1   | 0.00 | 0.09 (1, 1135) | 1  | 0.01      | 0.01 (1, 1135) | 1   | 0.01 | 3.1 (1, 1098)   | 1   |
+| Note. F(df) ¼ F value with (degrees of freedom). Beta values represent a contrast estimate, such that they signify how much greater the effect was for the TG |                  |                |     |      |                |    |      |                |     |      |                 |     |
+
+Note. F(df) ¼ F value with (degrees of freedom). Beta values represent a contrast estimate, such that they signify how much greater the effect was for the TG
+
+compared with the CG. TG ¼ tinnitus group; CG ¼ control group. ***p <.001. **p <.01.
+
+Table 2. Linear Mixed Model Fit by Maximum Likelihood Formula and Output of the Analysis of Variance Type iii on the GCA for the Pupillary Responses Recorded in Conditions for Two Groups.
+
+![10_image_0.png](10_image_0.png) 
+
+independent samples t test showed a significant difference in the fatigue scores, F(1, 30) ¼ 6.1, p ¼ < .005, indicating a greater level of fatigue for the TG. Figure 10 shows the individual NFR scores for each group, where the scores have been sorted from smallest to largest scores in each group.
+
+A significant, moderate correlation was found between the THI and the NFR scores, (r ¼ .58, p < .05), indicating that the greater the degree of tinnitus severity, the greater the level of fatigue. Figure 11 displays a scatterplot of the THI scores as a function of NFR scores.
+
+Ultimately, because group differences on NFR were identified, it was investigated whether the course of the experiment had an effect on pupil baseline. A paired samples t test showed a significant reduction in the pupil baseline from the first to the last condition of the experiment, F(1, 30) ¼ 3.6, p ¼ .001, with a mean difference of 0.22 mm, but no significant difference between groups (p ¼ .12 for the first condition and p ¼ .08 for the last condition).
+
+## Discussion
+
+This study investigated the effect of tinnitus on processing effort as indicated by the pupillary response while recognizing sentences in noise in a group of hearingimpaired (HI) people with tinnitus. Pupillary response was measured while participants were performing the Danish speech-in-noise test at two different speech intelligibility levels (L50 and L95) with an NR scheme either inactive or active (NoNR and NR). To the best of our knowledge, this is the first study that has examined the effect of tinnitus on effort by means of pupillometry during speech recognition in noise.
+
+Generally, the pupil data analysis revealed a main effect of speech intelligibility and NR on pupil dilation, which corroborates previous pupillometry studies
+(Ohlenforst et al., 2017; Wendt et al., 2017; Zekveld et al., 2010, 2011). With regard to the effect of tinnitus on effort, it was hypothesized (H1) that the TG would show greater pupillary responses, indicating a greater task-induced effort; furthermore, it was hypothesized
+
+![11_image_0.png](11_image_0.png) 
+
+(H2) that an NR scheme would reduce the pupillary responses. It was also hypothesized (H3) that the subjective measure of the perceived severity of the tinnitus would correlate with the pupillary response parameters, such that the worse the tinnitus was experienced, the greater the effort that was employed in the recognition task. Furthermore, that the subjective measure of tinnitus would correlate with subjective measure of self-reported daily life fatigue and NFR, indicating that the last would be greater in tinnitus patients with greater tinnitus severity. Finally, it was hypothesized
+(H4) that the TG would show significantly increased NFR than the CG. It was also investigated if the pupil baselines were affected over time from the beginning to the end of the experiment. In the following section, the results will be discussed with regard the above hypotheses.
+
+## Effect Of Tinnitus On Processing Effort
+
+The results indicated that tinnitus does not seem to have a significant effect on either the recognition performance or the PPD in any of the four conditions. A GCA was employed to quantify the influence of tinnitus on pupil dilation across time. The analyses revealed significant differences between the TG and CGs in the overall mean and the overall slope of the pupillary response in three out four conditions, as well as the shape of the primary inflection point of the curve in one condition. Interestingly, the CG showed pupil dilations with greater overall mean and overall slope. This is contradictory to the hypothesis.
+
+It is possible that tinnitus affects processing effort but that PPD is not a sufficiently sensitive measure for detecting it. This lack of sensitivity is supported by the GCA analysis, which demonstrated significantly smaller overall level and slope of the curves in the TG in three of four conditions. Because the groups were performing equally on speech recognition and have no significantly different SNRs, age, or hearing loss, it may seem counterintuitive that individuals with tinnitus and hearing loss should have smaller dilations, in the light of the research that has shown that larger peaks of dilations are associated with greater effort (e.g., Wendt et al.,
+2017; Zekveld & Kramer, 2014). However, previous studies that compared HI to NH people found that HI
+actually shows smaller PPDs than NH (Kramer et al.,
+2006; Wang et al., 2017; Zekveld et al., 2011) in some situations. Although this study did not find the TG to have smaller PPDs than the CG, the GCA showed that on temporal changes, the TG in general had smaller dilations while performing the task. Furthermore, this study found significantly increased NFR scores in the TG, indicating a group effect of (chronic) fatigue. Previous research (Wang et al., 2017) found that increased levels of NFR were associated with reduced task-evoked pupil dilation. In this study, the TG showed significantly smaller dilations on the GCA and significantly increased levels of NFR, a self-assessment of daily life fatigue. It is not clear whether it is the tinnitus or the higher level of NFR that caused differences in the pupillary response, and likewise whether it is the tinnitus that causes a greater NFR, or an increased daily life fatigue that worsens tinnitus symptoms. Nevertheless, it is speculated that the tinnitus patients may have greater inhibition of the PNS, which could have caused the relatively smaller temporal changes in pupillary responses. Wang et al.
+
+(2018) applied pupillometry to investigate processing effort required for speech recognition in noise.
+
+Interestingly, they tested this in both light and dark, as the SNS and PNS have different amounts of contribution to the pupil response according to the amount of light.
+
+By testing pupil dilation in both light and dark, the authors were able to disentangle the contribution to the pupil response for those two branches of the autonomic nervous system. They found that individuals with greater needs for recovery (independent of hearing status) showed smaller PPDs when tested in light, and they speculated that a smaller dilation indicated a higher PNS activity. They reason that the PNS is essential during recovery from stress, such that individuals who on a daily basis experience a greater NFR (i.e., a greater level of fatigue) may have an excessively activated PNS in stress situations, when the SNS should be in charge.
+
+Likely, tinnitus affects the ability to ''wind down,'' as tinnitus is often most disturbing in otherwise calm situations, such as reading in quiet or attempting to fall asleep. It may be possible that persons with tinnitus experience a greater PNS activity as a result of this, thus disturbing the ''rest and digest'' response. Wang et al. (2017) did not find significant differences in NFR
+between HI and NH and speculated whether other factors such as anxiety and personality may be better predictors of daily life fatigue. This study showed that tinnitus may be a predictor of NFR, highlighting the need for research to control for tinnitus when investigating topics such as fatigue as well as task-evoked pupil dilation. Furthermore, previous research (e.g., Jiang et al., 2003) found increased levels of fatigue in individuals with anxiety, and anxiety has previously been found to be comorbid with tinnitus (Guitton 2006; Landgrebe & Langguth, 2011; Pattyn et al., 2016), emphasizing the need to consider tinnitus in patients when conducting research. The pupil baseline was analyzed for changes from the beginning to the end of the experiment, to investigate any acute fatigue influence on pupillary responses. A significant reduction in the pupil baseline was found, but no significant differences were found between groups. This suggests an effect of acute fatigue of the experiment on all participants, regardless of the presence of tinnitus or higher NFR. This effect has previously been reported (e.g., Klingner, 2010). It is interesting that this effect does not seem to differ between groups, as the TG showed signs of greater long-term fatigue. An effect of the experiment was found despite having included two breaks during the experiment, and the freedom of taking more breaks for the participants.
+
+This study further investigated the benefit of an NR
+scheme for the two groups. Wendt et al. (2017) showed that participants with hearing loss show a benefit of an NR scheme that is applied in modern HAs on effort. We hypothesized that this effect is also found in the current study, and found no significant difference between groups in PPD as a function of the active NR scheme.
+
+Interestingly, even though the TG showed smaller dilations, there was a tendency that the reduction in PPD
+was larger for the TG than the CG. Thus, even though the TG may have smaller dilations (possibly due to an increased PNS activity), they still show a benefit of the signal processing on processing effort that is similar to the CG. These results have clinical implications, providing evidence to clinicians that difficult-to-fit patients, such as those with tinnitus, can benefit equally from having a program in their HAs with advanced signal processing, giving them the benefit of reduced effort.
+
+## Correlations Between Pupillary Response, Tinnitus Severity, And Nfr
+
+This study found no significant correlations between tinnitus self-report measurements and PPDs, nor the average individual coefficients of the GCA model. There was evidence to support a hypothetical relationship between degree of tinnitus and pupillary responses (e.g., Stevens et al., 2007, who found slower reaction times in tinnitus patients; Cuny et al., 2004, who found tinnitus severity to be associated with attentional disturbances; Rossiter et al., 2006, who found poorer performance on WM tasks in tinnitus patients). However, it is noted that discrepancies between subjective measures and performance on behavioral tasks or objective measurements in tinnitus research are often found (Andersson & McKenna, 2006).
+
+As mentioned earlier, the TG was significantly more fatigued based on NFR scores, and the THI significantly and moderately correlated with NFR. It is unclear whether fatigue causes tinnitus symptoms to worsen or if tinnitus causes fatigue, but a relationship between the two seems to exist. This is not unexpected and is consistent with previous studies. For example, tinnitus has been found to be connected with emotional exhaustion (He´bert et al., 2012), with sleep disturbance (Alster et al., 1993),
+and with insomnia (Cro¨nlein et al., 2007; Folmer &
+Griest, 2000). The prevalence of fatigue in participants with tinnitus has clinical implications. In addition to personal costs, fatigue may have socioeconomic consequences, because it can result in longer leaves of absences from work. Persons in employment who suffer from the combination of hearing loss and tinnitus may be at a similar risk of developing chronic fatigue similar to other chronic health conditions (Hornsby et al., 2016).
+
+Treatments for tinnitus may benefit from including aspects of treatment that identify and prevent fatigue from developing, thus keeping the risk of personal and socioeconomic costs at bay. This is especially relevant as the correlation between the measure of tinnitus severity and fatigue level indicates that the worse your tinnitus affects you, the more fatigued you are likely to be.
+
+## Limitations
+
+It is noted that there was a large variance in this study in general. The age span of all participants ranged from 45 to 84 years. The individual SNR necessary for 50% and 95% also ranged greatly, from 3.7 to 8.9 for the 50%
+level and from 1.4 to 12.8 for the 95% level. Although there were no significant differences between the groups on any of these parameters, some co-varying factors seem to exist, which could have influenced the individual amount of processing effort and pupillary response data.
+
+For example, increased age is accompanied by a greater vocabulary and linguistic expertise (Zekveld et al., 2011).
+
+This dynamic may influence the easiness of a speech recognition task such as the HINT, which was used in this study. However, Zekveld et al. (2011) found that an increased vocabulary ability was associated with greater processing effort as measured by pupillometry. They also found that older age was associated with greater processing effort. In this study, the effects of age and vocabulary were not assessed, which nonetheless may have contributed to the large variances seen in the results. Future studies could focus on including factors like age and vocabulary scores in pupil analysis models.
+
+It would be especially useful to investigate the pupillary response for speech recognition in quiet. Here, it is speculated that there may be a difference between individuals with tinnitus and hearing loss and individuals with only hearing loss, as it will be an easy condition for the group with hearing loss, but a condition where the tinnitus may be audible and disturbing. In speech-innoise situations such as the HINT, the sound pressure level is likely high enough to mask the audibility of the tinnitus. Perhaps the effects of the tinnitus would be found later (some hours after the experiment where aftermaths of acute fatigue may occur) and not actually during the task where the tinnitus may be masked.
+
+## Conclusions
+
+This study demonstrated no significant group differences in terms of processing effort as measured by the PPD
+between participants with tinnitus and hearing loss and participants with only hearing loss. However, significant differences in the overall mean and slope of the pupillary response were measured in the TG, indicating overall decreased pupillary response in the TG. It was argued that smaller dilations may be due to greater levels of daily life fatigue and NFR.
+
+Benefits of an NR scheme on effort that have previously been seen in research were found to apply equally well to individuals with tinnitus, as the reduction in PPDs due to an active NR scheme was similar for both groups.
+
+No correlation was found between subjective measures of tinnitus and PPD nor individual coefficients of the GCA. However, participants with tinnitus reported significantly increased levels of self-reported daily life fatigue on the NFR, which may have clinical as well as research implications.
+
+## Acknowledgments
+
+The authors would like to thank Oticon A/S for providing equipment and necessary resources to the study. The authors also thank Thomas Behrens sincerely for his ideas in relation to this research, as well as Renskje D. Hietkamp for her clinical support. Patrycja Ksiaz_ek also deserves deep gratitude for her support with the growth curve analysis. Finally, the authors thank the participants in this study, without whom the research would not have been possible.
+
+## Declaration Of Conflicting Interests
+
+The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
+
+## Funding
+
+The authors received no financial support for the research, authorship, and/or publication of this article.
+
+References Alster, J., Shemesh, Z., Ornan, M., & Attias, J. (1993). Sleep disturbance associated with chronic tinnitus. Biological Psychiatry, 34(1–2), 84–90. DOI: https://doi.org/10.1016/ 0006-3223(93)90260-K.
+
+Andersson, G., Lyttkens, L., & Larsen, H. C. (1999).
+
+Distinguishing levels of tinnitus distress. Clinical Otolaryngology, 24(5), 404–410. DOI: https://doi.org/ 10.1046/j.1365-2273.1999.00278.x.
+
+Andersson, G., & McKenna, L. (2006). The role of cognition in tinnitus. Acta Oto-Laryngologica, 126, 39–43. DOI: https:// doi.org/10.1080/03655230600895226.
+
+Aston-Jones, G., & Cohen, J. D. (2005). An integrative theory of locus coerulus-norepineprhone function: Adaptive gain and optimal performance. Annual Review of Neuroscience, 28, 403–450.
+
+Axelsson, A., & Ringdahl, A. (1989). Tinnitus—A study of its prevalence and characteristics. British Journal of Audiology, 23, 1. DOI: https://doi.org/10.3109/03005368909077819.
+
+Baguley, D., Andersson, G., McFerran, D., & McKenna, L.
+
+(2013). Consequences and moderating factors. In D. Baguley, G. Andersson, D. McFerran, & L. McKenna
+(Eds.), Chapter 7 Tinnitus: A multidisciplinary approach (2nd ed.). Oxford, England: Blackwell Publishing Ltd. DOI:
+https://doi.org/10.1002/9781118783009.ch7.
+
+Bates, B., Ma¨chler, M., Bolker, B. M., & Walker, S. C. (2015).
+
+Fitting linear mixed-effects models using lme4. Journal of Statistical Software, 67, 1–48.
+
+Beatty, J. (1982). Task-evoked pupillary responses, processing load, and the structure of processing resources.
+
+Psychological Bulletin, 91(2), 276–292.
+
+Cro¨nlein, T., Langguth, B., Geisler, P., & Hajak, G. (2007).
+
+Tinnitus and insomnia. Progress in Brain Research, 166, 227–233. DOI: https://doi.org/10.1016/S00796123(07)66021-X.
+
+Cuny, C., Norena, A., El Massioui, F., & Che´ry-Croze, S.
+
+(2004). Reduced attention shift in response to auditory changes in subjects with tinnitus. Audiology & Neuro-
+Otology, 9(5), 294–302. DOI: https://doi.org/10.1159/ 000080267.
+
+Davis, A., & Rafaie, E. A. (2000). Medical and surgical evaluation and management of tinnitus. Tinnitus handbook. San Diego, CA: Singular Publishing.
+
+Folmer, R. L., & Griest, S. E. (2000). Tinnitus and insomnia.
+
+American Journal of Otolaryngology, 21(5), 287–293. DOI: https://doi.org/10.1053/ajot.2000.9871.
+
+Guitton, M. J. (2006). Tinnitus and anxiety: More than meets the ear. Current Psychiatry Reviews, 2(3), 333–337. DOI:
+https://doi.org/10.2174/157340006778018139.
+
+Hallam, R. S., McKenna, L., & Shurlock, L. (2004). Tinnitus impairs cognitive efficiency. International Journal of Audiology, 43(4), 218–266. DOI: https://doi.org/10.1080/ 14992020400050030.
+
+He´bert, S., Canlon, B., & Hasson, D. (2012). Emotional exhaustion as a predictor of tinnitus. Psychotherapy and Psychosomatics, 81, 324–326. DOI: https://doi.org/ 10.1159/000335043.
+
+Heeren, A., Maurage, P., Perrot, H., De Volder, A., Renier, L.,
+Araneda, R., ... Phillippot, P. (2014). Tinnitus specifically alters the top-down executive control sub-component of attention: Evidence from the attention network task. Behavioural Brain Research, 269, 147–154. DOI: https://
+doi.org/10.1016/j.bbr.2014.04.043.
+
+Hoffmann, H. J., & Reed, G. W. (2004). Epidemiology of tinnitus. In J. B. Snow (Ed.), Tinnitus: Theory and management. Hamilton, Canada: BC Decker Inc.
+
+Horner, K. C. (2003). The emotional ear in stress. Neuroscience and Biobehavioral Reviews, 27, 437–446.
+
+Hornsby, B. W. Y., Naylor, G., & Bess, F. H. (2016). A taxonomy of fatigue concepts and their relation to hearing loss.
+
+Ear and Hearing, 37(1), 136–144. DOI: 10.1097/
+AUD.0000000000000289.
+
+Jensen, J., & Pedersen, M. S. (2015, April). Analysis of beamformer directed single-channel noise reduction system for hearing aid applications. Paper presented to the 2015 IEEE International Conference on Acoustics, Speech and Signal Processing (ICASSP), Brisbane, Australia. DOI: 10.1109/ ICASSP.2015.7179069.
+
+Jiang, N., Sato, T., Hara, T., Takedomi, Y., Ozaki, I., &
+Yamada, S. (2003). Correlations between trait anxiety, personality and fatigue: Study based on the Temperament and Character Inventory. Journal of Psychosomatic Research, 55(6), 493–500. DOI: https://doi.org/10.1016/S00223999(03)00021-7.
+
+Kahneman, D. (1973). Attention and effort. Englewood Cliffs, NJ: Prentice-Hall.
+
+Khedr, E. M., Ahmed, M. A., Shawky, O. A., Mohamed, E. S.,
+El Attar, G. S., & Mohammad, K. A. (2010).
+
+Epidemiological study of chronic tinnitus in Assiut, Egypt. Neuroepidemiology, 35(1), 45–52. DOI: https://doi.org/
+10.1159/000306630.
+
+Kjems, U., & Jensen, J. (2012). Maximum likelihood based noise covariance matrix for multimicrophone speech enhancement. 2012 Proceedings of the 20th European signal processing conference
+(EUSIPCO), Bucharest, Romania (pp. 295–299). Piscataway, NJ: IEEE.
+
+Klingner, J. M. (2010). Measuring cognitive load during visual tasks by combining pupillometry and eye tracking (Doctoral dissertation). Stanford University, CA, USA.
+
+Koelewijn, T., Zekveld, A. A., Festen, J. M., & Kramer, S. E.
+
+(2012). Pupil dilation uncovers extra listening effort in the presence of a single-talker masker. Ear and Hearing, 33(2),
+291–300. DOI: 10.1097/AUD.0b013e3182310019.
+
+Koelewijn, T., Zekveld, A. A., Festen, J. M., & Kramer, S. E.
+
+(2014). The influence of informational masking on speech perception and pupil response in adults with hearing impairment. Journal of the Acoustical Society of America, 135(3),
+1596–1606. DOI: https://doi.org/10.1121/1.4863198.
+
+Kramer, S. E., Kapteyn, T. S., & Houtgast, T. (2006).
+
+Occupational performance: Comparing normally-hearing and hearing-impaired employees using the Amsterdam Checklist for hearing and work. International Journal of Audiology, 45, 503–512. DOI: https://doi.org/10.1080/
+14992020600754583.
+
+Kuchinsky, S. E., Ahlstrom, J. B., Vaden, K. I., Cute, S. L.,
+Humes, L. E., Dubno, J. R., & Eckert, M. A. (2013). Pupil size varies with word listening and response selection difficulty in older adults with hearing loss. Psychophysiology, 50, 23–34. DOI: https://doi.org/10.1111/j.14698986.2012.01477.x.
+
+Landgrebe, M., & Langguth, B. (2011). Tinnitus and anxiety.
+
+In A. R. Møller, B. Langguth, D. De Ridder, & T. Kleinjung (Eds.), Textbook of tinnitus. New York, NY:
+Springer. DOI: https://doi.org/10.3109/
+15622975.2011.575178.
+
+Langguth, B., Kreuzer, P. M., Kleinjung, T., & De Ridder, D.
+
+(2013). Tinnitus: Causes and clinical management. The Lancet Neurology, 12(9), 920–930. DOI: https://doi.org/
+10.1016/S1474-4422(13)70160-1.
+
+Lasisi, A. O., Abiona, T., & Gureje, O. (2010). Tinnitus in the elderly: Profile, correlates, and impact in the Nigerian Study of Ageing. Otolaryngology—Head and Neck Surgery, 143(4), 510–515. DOI: https://doi.org/10.1016/ j.otohns.2010.06.817.
+
+Le Goff, N. (2015). Amplifying soft sounds—A personal matter.
+
+Oticon Whitepaper. Retrieved from http://www.oticon. global/evidence Levitt, H. (1971). Transformed up-down methods in psychoacoustics. Journal of the Acoustical Society of America, 49(2B), 467. DOI: https://doi.org/10.1121/1.1912375.
+
+Mattys, S. L., David, M. H., Bradlow, A. R., & Scott, S. K.
+
+(2012). Speech recognition in adverse conditions: A review. Language and Cognitive Processes, 27, 953–978. DOI: https://doi.org/10.1080/01690965.2012.705006.
+
+McKenna, L., & Hallam, R. (1999). A neuropsychological study of concentration problems in tinnitus patients. In J. Hazel (Ed.), Proceedings of the sixth international tinnitus seminar (pp. 108–113). London, England: The Tinnitus and Hyperacusis Centre.
+
+Michikawa, T., Nishiwaki, Y., Kikuchi, Y., Saito, H.,
+Micutari, L., Okamoto, M., & Takebayashi, T. (2010).
+
+Prevalence and factors associated with tinnitus: A community-based study of Japanese elders. Journal of Epidemiology, 20(4), 271–276. DOI: https://doi.org/ 10.2188/jea.JE20090121.
+
+Mirman, D. (2014). Growth curve analysis. Retrieved from http://www.danmirman.org/gca Mirman, D., Dixon, J. A., & Magnuson, J. S. (2008). Statistical and computational models of the visual world paradigm:
+Growth curves and individual differences. Journal of Memory and Language, 59, 475–494. DOI: https://doi.org/
+10.1016/j.jml.2007.11.006.
+
+Mohamad, J., Hoare, D. J., & Hall, D. A. (2016). The consequences of tinnitus and tinnitus severity on cognition: A
+review of the behavioural evidence. Hearing Research, 332, 199–209. DOI: https://doi.org/10.1016/j.heares.2015.10.001.
+
+Nachtegaal, J., Festen, J. M., & Kramer, S. E. (2012). Hearing ability in working life and its relationship with sick leave and self-reported work productivity. Ear and Hearing, 33, 94–103. DOI: 10.1097/AUD.0b013e318228033e.
+
+Newman, C. W., Jacobsen, G. P., & Spitzer, J. B. (1996).
+
+Development of the Tinnitus Handicap Inventory. JAMA Otolaryngology—Head & Neck Surgery, 122(2), 143–148. DOI: 10.1001/archotol.1996.01890140029007.
+
+Newman, C. W., Sandridge, S. A., & Bolek, L. (2008).
+
+Development and psychometric adequacy of the screening version of the Tinnitus Handicap Inventory. Otology & Neurotology, 29, 276–281.
+
+Nielsen, J. B., & Dau, T. (2011). The Danish hearing in noise test. International Journal of Audiology, 50(3), 202–208. DOI: https://doi.org/10.3109/14992027.2010.524254.
+
+Nilsson, M., Soli, S. D., & Sullivan, J. A. (1994). Development of the Hearing In Noise Test for the measurement of speech reception thresholds in quiet and in noise. The Journal of the Acoustical Society of America, 95(2), 1085–1099. DOI: https://doi.org/10.1121/1.408469.
+
+Nondahl, D. M., Cruickshanks, K. J., Wiley, T. L., Klein, R.,
+Klein, B. E. K., & Tweedm, T. S. (2002). Prevalence and 5-year incidence of tinnitus among older adults: The epidemiology of hearing loss study. Journal of the American Academy of Audiology, 13(6), 323–331(9). DOI: 10.1001/ archotol.129.10.1041.
+
+Ohlenforst, B., Zekveld, A. A., Jansma, E. P., Wang, Y.,
+Naylor, G., Lorens, A., ... Kramer, S. E. (2017). Effects of hearing impairment and hearing aid amplification on listening effort: A systematic review. Ear and Hearing, 38(3),
+267–281. DOI: 10.1097/AUD.0000000000000396.
+
+Pattyn, T., Eede, V. D., Vanneste, S., Cassiers, L., Veltman, D.
+
+J., Van De Heyning, P., & Sabbe, B. C. G. (2016). Tinnitus and anxiety disorders: A review. Hearing Research, 333, 255–265. DOI: https://doi.org/10.1016/j.heares.2015.08.014.
+
+Pichora-Fuller, M. K., Kramer, S. E., Eckert, M., Edwards, B.,
+Hornsby, B. W. Y., Humes, L. E., ... Wingfield, A. (2016).
+
+Hearing impairment and cognitive energy: The framework for understanding effortful listening (FUEL). Ear and Hearing, 37, 5–27. DOI: 10.1097/AUD.0000000000000312.
+
+Ries, P. W. (1994). Prevalence and characteristics of persons with hearing trouble: United States, 1990–91. Vital and Health Statistics. Series 10, Data for National Health Survey, 22(188), 1–75.
+
+Rossiter, S., Stevens, C., & Walker, G. (2006). Tinnitus and its effect on working memory and attention. Journal of Speech. Language and Hearing Research, 49(1), 150–160. DOI: 10.1044/1092-4388(2006/012).
+
+Shargorosky, J., Curhan, G. C., & Farwell, W. R. (2010).
+
+Prevalence and characteristics of tinnitus among US adults. The American Journal of Medicine, 123, 711–718.
+
+DOI: https://doi.org/10.1016/j.amjmed.2010.02.015.
+
+Stevens, C., Walker, G., Boyer, M., & Gallagher, M. (2007).
+
+Severe tinnitus and its effect on selective and divided attention. International Journal of Audiology, 46(5), 208–216. DOI: https://doi.org/10.1080/ 14992020601102329.
+
+Stouffer, J. L., & Tyler, R. S. (1990). Characterization of tinnitus by tinnitus patients. Journal of Speech and Hearing Disorders, 55, 439–453. DOI: 10.1044/jshd.5503.439.
+
+Tegg-Quinn, S., Bennet, R. J., Eikelboom, R. H., & Baguley, D. M. (2016). The impact of tinnitus upon cognition in adults: A systematic review. International Journal of Audiology, 55, 533–540. DOI: https://doi.org/10.1080/ 14992027.2016.1185168.
+
+Tyler, R. S., & Baker, L. J. (1983). Difficulties experiences by tinnitus sufferers. Journal of Speech and Hearing Disorders, 48, 150–154. DOI: 10.1044/jshd.4802.150.
+
+Van Veldhoven, M. J. P. M., & Broersen, S. (2003).
+
+Measurement quality and validity of the ''need for recovery scale''. Occupational and Environmental Medicine, 60(suppl 1), i3–i9. DOI: http://dx.doi.org/10.1136/oem.60.suppl_1.i3.
+
+Wang, Y., Kramer, S. E., Wendt, D., Naylor, G., Lunner, T.,
+& Zekveld., A. A. (2018). The pupil dilation response during speech perception in dark and light: The involvement of the parasympathetic nervous system in listening effort. Manuscript submitted for publication.
+
+Wang, Y., Naylor, G., Kramer, S. E., Zekveld, A. A., Wendt, D., Ohlenforst, B., & Lunner, T. (2017). Relations between self-reported daily-life fatigue, hearing status, and pupil dilation during a speech perception in noise task. Ear and Hearing, 39, 573–582. DOI: 10.1097/
+AUD.0000000000000512.
+
+Wendt, D., Hietkamp, R. K., & Lunner, T. (2017). Impact of noise and noise reduction on processing effort: A pupillometry study. Ear and Hearing, 38, 690–700(11). DOI:
+https://doi.org/10.1097/AUD.0000000000000454.
+
+Wendt, D., Koelewijn, T., Ksiazek, P., Kramer, S. E., &
+Lunner, T. (2018). Toward a more comprehensive understanding of the impact of masker type and signal-to-noise ratio on the pupillary response while performing a speechin-noise test. Hearing Research. Advance online publication.
+
+doi:10.1016/j.heares.2018.05.006.
+
+Winn, M. B., Edwards, J. R., & Litovsky, R. Y. (2015). The impact of auditory spectral resolution on listening effort revealed by pupil dilation. Ear and Hearing, 36(4),
+e153–e165. DOI: 10.1097/AUD.0000000000000145.
+
+Xu, X., Bu, X., Zhou, L., Xing, G., Liu, C., & Wang, D.
+
+(2011). An epidemiologic study of tinnitus in a population in Jiangsu Province, China. Journal of the American Academy of Audiology, 22(9), 578–585. DOI: https:// doi.org/10.3766/jaaa.22.9.3.
+
+Zachariae, R., Mirz, F., Vendelbo Johansen, L., Andersen, S.
+
+E., Bjerring, P., & Brahe Pedersen, C. (2000). Reliability and validity if a Danish adaptation of the Tinnitus Handicap Inventory. Scandinavian Audiology, 29(1), 37–43. DOI: https://doi.org/10.1080/010503900424589.
+
+Zekveld, A. A., & Kramer, S. E. (2014). Cognitive processing load across a wide range of listening conditions: Insights from pupillometry. Psychophysiology, 51(3), 277–284.
+
+DOI: https://doi.org/10.1111/psyp.12151.
+
+Zekveld, A. A., Kramer, S. E., & Festen, J. M. (2010). Pupil response as an indication of effortful listening: The influence of sentence intelligibility. Ear and Hearing, 31, 480–490. DOI: 10.1097/AUD.0b013e3181d4f251.
+
+Zekveld, A. A., Kramer, S. E., & Festen, J. M. (2011).
+
+Cognitive load during speech perception in noise: The influence of age, hearing loss, and cognition on the pupil response. Ear and Hearing, 32(4), 4978–510. DOI: 10.1097/AUD.0b013e31820512bb.

medical/md/PMC6142153.md

@@ -0,0 +1,318 @@
+# The Connection Between Testicular Cancer, Minority Males, And Planned Parenthood
+
+American Journal of Men's Health 2018, Vol. 12(5) 1774–1783 © The Author(s) 2018 Article reuse guidelines: sagepub.com/journals-permissions DOI: 10.1177/1557988318786874 journals.sagepub.com/home/jmh https://doi.org/10.1177/1557988318786874
+
+# Wesley B. Adams, Mph(C), Bsc1**, Michael J. Rovito, Phd, Ches, Fmhi1**, And Mike Craycraft, Rph2
+
+## Abstract
+
+Testicular cancer (TCa) is the most prevalent neoplasm diagnosed in males aged 15–40 years. Lack of access to care is a key impediment to early-stage TCa diagnosis. Health equity concerns arise, however, as poor access largely manifests within underserved male populations, therefore, placing them at a higher risk to develop late-stage TCa. Planned Parenthood Federation of America (PPFA) offers a myriad of male reproductive/sexual health care options, including TCa screening and referral services. Therefore, expanding these amenities in traditionally underserved communities may address the concern of TCa screening opportunities. An ecological analysis was performed using data from the United States Cancer Statistics, American Community Survey, and PPFA databases to assess the impact of TCa upon minority males, identify associations between PPFA services and minority males, and provide future implications on the role PPFA may play in bridging health-care access gaps pertaining to TCa screenings. Results indicate that states with higher rates of poverty and uninsured individuals, as well as specifically Black/African American males, have lower TCa incidence and limited access to screening services. PPFA service presence and Black/African American, as well as uninsured, males had a negative association but revealed positive correlations with TCa incidence. Considering the emerging TCa outcome disparities among minority males, expanding PPFA men's health services is crucial in providing affordable options to help identify testicular abnormalities that are early stage or carcinoma in situ. Many at-risk males have limited means to obtain TCa screening services. Expanding this discussion could provide a foundation for future advocacy.
+
+## Keywords
+
+epidemiology of men's health, general health and wellness, health screening, testicular self-exam, access to care, health-care issues, health inequality/disparity Received January 8, 2018; revised May 22, 2018; accepted May 28, 2018 Testicular cancer (TCa) is the most prevalent neoplasm diagnosed in males aged 15–40 years (Rovito et al., 2016). A total of 8,850 new cases of TCa and 410 deaths from the disease were estimated to occur in the United States in 2017 (Siegel, Miller, & Jemal, 2017). Recent surveillance indicates a universal rise in incidence throughout all demographic subsets of young adult and adolescent at-risk males (Burkhamer, Kriebel, & Clapp, 2017).
+
+Treatment for TCa is remarkably effective, which is evidenced by an approximate 99% 5-year survival rate if diagnosed in the early stages (Stage I) of development (Howlader et al., 2015). That rate dips to 70%–75% in more advanced-stage diagnoses (greater than Stage III). Due to high survivability of the condition, which usually occurs early in a male's lifespan, clinical and public health researchers are largely concerned with long-term morbidity issues among said survivors—a consequence of invasive treatment options (i.e., orchiectomy, retroperitoneal lymph 1Behavioral Health Research Group, College of Health and Public Affairs, Department of Health Professions, University of Central Florida, Orlando, FL, USA
+2Testicular Cancer Society, Cincinnati, OH, USA
+Corresponding Author: Michael J. Rovito, PhD, CHES, FMHI, Department of Health Professions, University of Central Florida, 12805 Pegasus Drive, HPA1 Room 269, Orlando, FL 32816, USA. Email: michael.rovito@ucf.edu Creative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (http://www.creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).
+
+node dissection, radiation, and/or chemotherapy; Fung, Fossa, Williams, & Travis, 2015; Gilligan, 2015). Physiological complications, such as infertility, peripheral neuropathy, cardiovascular disease, and long-term pulmonary and neural toxicity, as well as psychological conditions, such as chronic fatigue, anxiety, fear of recurrence, and depression, are all prevalent conditions within the TCa survivor population, especially among late-stage survivors (Fung et al, 2015; Gilligan, 2015).
+
+The amount of overall TCa research that exists, including, but not limited to, survivor-based studies, is limited in both amount and scope. There is a paucity of research, for example, investigating the impact of TCa on minority populations. Despite a majority prevalence among White/
+Caucasian males, recently emerging studies indicate drastically higher proportions of late-stage TCa diagnosis and mortality in the United States among Black/African American and Latino males, as well as those under or uninsured and/or of lower socioeconomic status (SES; Bridges, Sharifi, Razzaq, & Guinan, 1998; Kamel et al., 2016; Lerro, Robbins, Fedewa, & Ward, 2014; Markt et al., 2016; Ries, 2007; Sun et al., 2011). Furthermore, this literature suggests that Latinos will have the highest TCa incidence rate of any racial/ethnic group by the year 2026. Contextual influences, further, which restricts access to health-care services, seem to exacerbate the risk of adverse health outcomes related to TCa in minority groups.
+
+## Access To Care For Underserved Males At Risk For Tca
+
+Lack of access to care is a key impediment to early-stage TCa diagnosis. The literature suggests that uninsured and underinsured males are at substantially higher risk of late-stage TCa diagnosis, with education status, family income, and provider trust serving as sizable effect modifiers (Kamel et al., 2016; Lerro et al., 2014; Markt et al., 2016; Sun et al., 2011). These factors assist in materializing health equity concerns as they largely manifest within underserved male populations (Elliott & Larson, 2004; Mulye et al., 2009; Watson, 2014).
+
+Lack of knowledge and awareness of TCa can furthermore impact stage diagnosis, as well as general screening service utilization. Recent research associated (a) lack of knowledge and awareness in the patient population and 
+(2) a lack of competency-to-treat in the provider population to delayed TCa diagnoses among male subpopulations (Cronholm, Mao, Nguyen, & Paris, 2008; Huyghe et al., 2007; Öztürk, Fleer, Hoekstra, & HoekstraWeebers, 2015). This lack of knowledge, combined with socioeconomic pressures, places underserved males at a higher risk to develop late-stage TCa, which ushers in the concern of higher mortality and worse quality of life compared to their White/Caucasian counterparts.
+
+Consequently, the role of community safety net providers (SNPs) in initiating TCa screening for at-risk males is a critical intervention needed to decrease the current disparity in TCa mortality and late-stage incidence. 
+
+Nationally, Planned Parenthood Federation of America (PPFA) is an important body to consider in bridging this gap of care and may offer potential solutions to health inequity concerns present within young adult underserved men, as it relates to TCa.
+
+## Ppfa And Male Health Services
+
+PPFA is a national mainstay SNP for reproductive and sexual health services (PPFA, n.d. ; Topulos, Greene, & Drazen, 2015). As of 2014, PPFA provided upward of 4.67 million sexual and reproductive services, globally. 
+
+Of the 2.84 million services offered within the United States, 79% were provided to patients at or below 150% of the poverty line (PPFA, 2015).
+
+Though typically conjectured as a female-specific sexual/reproductive/family planning service system (Lawrence & Ness, 2017; Topulos et al., 2015), PPFA offers a myriad of male reproductive/sexual health care options, including but not limited to erectile dysfunction, jock itch, infertility, premature ejaculation, prostate cancer, vasectomy procedural services, as well as TCa screening and referral services (PPFA, n.d.). These services are intermittently, not universally, offered throughout PPFA facilities. Furthermore, facilities providing male-specific services many times do not provide all the aforementioned amenities, most notably, TCa-related services.
+
+## Current Study
+
+No current or past research has focused on the effectiveness of such TCa screening services on early-stage diagnoses among minority, underserved males. Insufficient research, furthermore, exists studying the effects of such screening among the general population, as a whole. This gap in research is a predominant concern throughout current public health officials, especially within the United States Preventive Services Task Force, as evidenced by their respective "D" rating for testicular self-examination 
+(TSE) and clinical screening efforts for TCa in asymptomatic males. Nevertheless, certain organizations, such as the American Cancer Society (ACS), while respecting TSE promotional pushback by not offering an official recommendation, still promote routine testicular examination in the clinical setting (ACS, 2018). Especially in males at increased risk of TCa incidence (e.g., those with family history of TCa, cryptorchidism, and testicular microlithiasis, among others), regular screening, at the very least in the clinical setting, should be further promoted (Hu, Baird, & Meyers, 2018; Parenti, Giorgi, & Albello, 2014; Piltoft et al., 2017). In the context of the current study, emerging data suggest an undue burden of morbidity and mortality related to TCa is affecting men of color; therefore, it is pertinent to begin the discussion of how to assist in alleviating this concern and how to increase screening efforts among at-risk males of these socioeconomic and racial demographic subsets (Sun et al., 2011). These disparate testicular health outcomes manifesting within U.S. minority male populations present a unique opportunity for public health officials and organizations to promote early TCa screenings within underserved male populations via PPFA's male-specific services, as well as advocate further involvement of community health centers and federally qualified health centers alike.
+
+The purpose of this study is threefold: (a) to assess the impact of TCa upon subpopulations of at-risk, underserved males; (b) to identify any preliminary associations between PPFA services and minority males; and (c) to provide future implications on the role PPFA may play in bridging health-care access gaps pertaining to urogenital health information and services, including TCa screenings. Ultimately, an expansion in such services could decrease the likelihood of advanced cancer detection and thus promote optimal wellness among TCa survivors, particularly among traditionally underserved males.
+
+## Methods
+
+A descriptive correlation and regression analysis was performed using 2014 data from United States Cancer Statistics (USCS), ACS, Health Resources & Service Administration (HRSA), and PPFA databases. Bivariate Pearson r correlation coefficient analyses were performed to discern general associations, if present, between TCa impact indicators (i.e., incidence and mortality), state demographics (i.e., race, poverty, insured status, and Medically Underserved Area [MUA] score) and PPFA facility presence, as well as total services offered. All significant correlations, subsequently, were further assessed through a multiple linear regression model. Prior to this step, all variables involved were assessed for normality, homoscedasticity, linearity, and independence (multicollinearity).
+
+In the final regression model, TCa incidence was assessed as the outcome variable of interest. Prior to model interpretation, normality was assessed via P–P plots in addition to Shapiro–Wilks and Kolmogorov–
+Smirnov statistical analysis. Homoscedastic assumptions were confirmed via scatterplot review, while further residual assessment included standard residual value and Cook's Distance statistic evaluation. Finally, multicollinearity was assessed during bivariate correlational analyses, as well as in the actual final model through each individual predictor Variance Inflation Factor (VIF) value. Once confirmed, multiple linear regressions were performed to further assess the statistically significant correlations generated in bivariate analysis. These coefficients were used to determine to what extent TCa incidence was associated with SES and race indicators, and, furthermore, if PPFA service totals complimented such correlations.
+
+## Data Sources
+
+The USCS program is a surveillance system composed of the Center of Disease Control and Prevention (CDC)- funded National Program of Cancer Registries program 
+(NCPR) and the National Cancer Institute (NCI)-funded Surveillance, Epidemiology, and End Results Program 
+(SEER) databases—select SEER registries are also concurrently funded by the CDC. The NCPR program relays a highly reliable and valid database; less than 5% of incident cases were obtained from death certification, alone, while less than 3% of cases were missing sex, age, and race demographics. SEER database statistics are widely considered the gold standard for cancer incidence research and evaluation—more information about this database can be found at https://seer.cancer.gov/. Incidence data for this program are collected through 20 separate registries, established by both the NCI and CDC. 
+
+Mortality data are collected through individual death certificates within the CDC's National Center for Health Statistics, coordinated through the National Vital Statistics System, and is reflected within the USCS system. Further information regarding the USCS database can be found at www.cdc.gov/uscs.
+
+USCS data were used to extract TCa incidence and mortality rates, per 100,000, throughout each individual state. Each rate was age-adjusted to the 2,000 U.S. standard population. All conversion and age-adjustment procedures were completed prior to data access by the USCS Working Group. This, alongside 2014 demographic estimates through the ACS, generated yearly through statewide US Census Bureau community surveying, was used to assess the ecological implications of SES and racial indicators upon TCa incidence and mortality trends.
+
+Data for an additional covariate, the state MUA index score average, were obtained from the online HRSA government database. Data from this organization are completely open for public use and can be accessed at https://
+datawarehouse.hrsa.gov/tools/analyzers/hpsafind.aspx. An MUA, as defined by the HRSA, is an area suffering from low primary care providers, high infant mortality, high poverty, and/or high elderly populations (HRSA, 2018). After analyzing such variables, the HRSA grants a geographical area a score from 0 to 100, "0" representing an extremely underserved area, and "100" deeming the area not underserved. As it pertains to the current study, data regarding MUA service area scores were obtained and averaged to yield state-specific MUA scores. These scores were used concordantly with the previously mentioned variables as indicators for decreased health-care access per state.
+
+Data regarding state-specific PPFA facility totals, as well as both general male health and TCa-specific services offered through them, were collected through the individual PPFA organization websites. Research and verification of general male health and TCa-specific services offered was performed and cross-referenced by two researchers to ensure consistency in measurement. PPFA data were analyzed along with both USCS and ACS data to determine relationships between TCa impact indicators, community racial, and SES makeup, and PPFA services offered, per state.
+
+## Covariates
+
+State-specific demographic covariates used in the current study included male population totals, as well as health insurance coverage (e.g., uninsured and insured), public insurance coverage (e.g., Medicaid and VA health-care coverage), poverty rates (e.g., population residing at federal poverty line), and state-specific MUA score averages. 
+
+Race variables comprised state-specific non-Hispanic White, Black/African American, Hispanic Latino, Asian, American Indian/Alaska Native, and Pacific Islander population proportions. Extracted data were 5-year estimates from ACS 2014 databases and were specific to males aged 18–44 years. Participants were further categorized by age into 7- and 10-year tertiles (e.g. 18–24, 25–34, 35–44).
+
+All state values were weighted and controlled for population size discrepancies prior to analysis. Remaining variables included state PPFA general men's health services (MHS) and TCa-specific services (TCS) offered 
+(PPFA)—proportionate to state male population size, ages 18–44 years—as well as TCa incidence and mortality rates per 100,000 (USCS).
+
+All states within the United States were assessed, excluding Puerto Rico and the District of Columbia. Fortynine states were included in the final analysis. Incidence rates for Nevada over the 5-year measurement period were excluded as their respective registry did not meet the data quality criteria set by the USCS surveillance system.
+
+## Results Geographic Trends
+
+Over the cumulative measurement period, from 2010 to 2014, crude 5-year estimate TCa incidence totals were highest in populated states of California, Texas, New York, and Florida. When controlled for population size, however, Montana, Wyoming, New Hampshire, and Nebraska were among the leading states in TCa incidence rates per 100,000 men.
+
+Uninsured rates were highest in Texas, Florida, Georgia, New Mexico, and Mississippi for males ages 18–44 years. Though state poverty rates and state MUA 
+averages among this subset were more dispersed, a similar trend can be seen in the U.S. southeast and central regions. State population rates of 18–44 Black/African American males favored a similar southeast U.S. clustering tendency. Latino American populations were highest in New Mexico, California, and Texas. Alaskan Native/ Native American, Asian, and Pacific Islander/Hawaiian Native populations were dispersed indiscriminately.
+
+TCa incidence, along with certain SES and racial population geographic distributions, appears to be associated. 
+
+Black/African American, impoverished, uninsured populations, as well as states with lower MUA scores, seem to comprise states with lower TCa incidence (Table 1).
+
+## Tca Impact Indicators, Insurance, Poverty, And Mua Score
+
+Bivariate analyses further supported this observation, indicating a strong negative correlation between TCa incidence and higher uninsured rates, as well as a moderate correlation with state MUA average score (Table 1). 
+
+Specifically, regions with higher rates of uninsured males, and low state MUA average, consistently reflected negative correlations with incidence. This relationship was persistent throughout all tertiles, as well as total uninsured rates for the entire population age range. Poverty rates, though not as strongly correlated, also reflected statistically significant negative associations within two of the three age groups and the total population age range pertaining to TCa incidence.
+
+Regarding TCa mortality, males aged 18–24 years yield the only significant correlation among the uninsured total and tertile groups, which was a moderate positive association. There were no significant correlations between poverty and TCa mortality. The public insurance covariate demonstrated no statistically significant correlations with either TCa incidence or mortality.
+
+## Tca Impact Indicators And Race
+
+Black/African American male population rates demonstrated the strongest association (all very strong negative relationships) with TCa incidence (total and all age tertiles; Table 2). Conversely, White non-Hispanic male populations had a moderately positive correlation with TCa incidence throughout all age tertiles. No other racial or ethnic group had any significant association with TCa incidence. TCa mortality was only significantly associated with Alaskan Native and Native American popula-
+
+| Table 1. TCa Impact and SES Indicators.                                                                                                                                                       | Table 3. PPFA Bivariate Analysis.   |         |               |         |                        |          |         |          |         |
+|-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|-------------------------------------|---------|---------------|---------|------------------------|----------|---------|----------|---------|
+| Covariate                                                                                                                                                                                     | TCa incidence                       | p value | TCa mortality | p value | Covariate              | PPFA MHS | p value | PPFA TCS | p value |
+| Uninsured 18–24                                                                                                                                                                               | −.459*                              | <.001   | .359          | <.047*  |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | −.465*                              | <.001   | .311          | <.089   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.429*                              | <.002   | .333          | <.067   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.455*                              | <.001   | .338          | <.063   |                        |          |         |          |         |
+| Poverty 18–24                                                                                                                                                                                 | −.103                               | <.479   | .326          | <.073   |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | −.343*                              | <.016   | .321          | <.079   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.424*                              | <.002   | .328          | <.071   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.287*                              | <.046   | .350          | <.054   |                        |          |         |          |         |
+| Publicly Insured 18–24 −.029                                                                                                                                                                  | <.842                               | −.215   | <.244         |         |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | .223                                | <.123   | −.140         | <.451   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | .076                                | <.604   | −.127         | <.497   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | .107                                | <.107   | −.166         | <.372   | African American 18–24 | −.323*   | <.022   | −.220    | <.125   |
+| 25–34                                                                                                                                                                                         | −.322*                              | <.023   | −.216         | <.131   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.319*                              | <.024   | −.211         | <.142   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.321*                              | <.023   | −.216         | <.132   |                        |          |         |          |         |
+| Uninsured 18–24                                                                                                                                                                               | −.341*                              | <.015   | .224          | <.117   |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | −.272                               | <.056   | .206          | <.151   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.288*                              | <.043   | .207          | <.149   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.307*                              | <.030   | .217          | <.130   |                        |          |         |          |         |
+| Publicly Insured 18–24                                                                                                                                                                        | .231                                | <.106   | −.164         | <.254   |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | .544*                               | <.001   | −.193         | <.179   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | .432*                               | <.002   | −.209         | <.145   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | .427*                               | <.002   | −.197         | <.170   |                        |          |         |          |         |
+| Poverty 18–24                                                                                                                                                                                 | −.265                               | <.063   | .119          | <.410   |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | −.213                               | <.138   | −.067         | <.643   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.271                               | <.057   | .089          | <.538   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.262                               | <.066   | −.015         | <.915   |                        |          |         |          |         |
+| TCa Incidence                                                                                                                                                                                 | .366*                               | <.010   | .205          | <.157   |                        |          |         |          |         |
+| TCa Mortality                                                                                                                                                                                 | .092                                | <.622   | .194          | <.295   |                        |          |         |          |         |
+| Note. SES = socioeconomic status; TCa = testicular cancer. *Statistically significant findings. Table 2. TCa Impact and Minority Racial Groups. Covariate TCa incidence p value TCa mortality | p value                             |         |               |         |                        |          |         |          |         |
+| African American 18–24 −.822*                                                                                                                                                                 | <.001                               | −.349   | <.054         |         |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | −.820*                              | <.001   | −.352         | <.052   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.816*                              | <.001   | −.352         | <.052   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.820*                              | <.001   | −.351         | <.053   |                        |          |         |          |         |
+| Hispanic Latino 18–24 −.061                                                                                                                                                                   | <.676                               | .216    | <.244         |         |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | −.127                               | <.384   | .201          | <.278   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.100                               | <.494   | .215          | <.245   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.098                               | <.504   | .211          | <.254   |                        |          |         |          |         |
+| Asian 18–24                                                                                                                                                                                   | −.059                               | <.685   | −.094         | <.514   |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | −.086                               | <.559   | −.154         | <.286   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.119                               | <.414   | −.128         | <.376   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.093                               | <.527   | −.129         | <.372   |                        |          |         |          |         |
+| Hawaiian Native and Pacific Island 18–24 −.065 <.658                                                                                                                                          | .003                                | <.986   |               |         |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | −.074                               | <.612   | −.001         | <.992   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | −.075                               | <.609   | .012          | <.932   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | −.071                               | <.626   | .004          | <.976   |                        |          |         |          |         |
+| Alaskan Native and Native American 18–24 .204 <.160                                                                                                                                           | .356*                               | <.049   |               |         |                        |          |         |          |         |
+| 25–34                                                                                                                                                                                         | .204                                | <.159   | .362*         | <.045   |                        |          |         |          |         |
+| 35–44                                                                                                                                                                                         | .195                                | <.178   | .371*         | <.040   |                        |          |         |          |         |
+| Total                                                                                                                                                                                         | .202                                | <.165   | .364*         | <.044   | Note. MHS = men's health services; PPFA = Planned Parenthood  Federation of America, TCS = testicular cancer-specific services;  TCa = testicular cancer. *Statistically significant findings.TCa Impact Indicators, Demographics, and  PPFA PPFA MHS were positively correlated with TCa incidence rates, as well as with select group public insurance  rates (Table 3). However, conversely, MHS rates were  negatively associated with Black/African American  males, as well as select age group uninsured rates. No  significant correlations were present with other minority  group populations. There were no significant associations  between PPFA TCS rates and poverty, insurance, or TCa  impact indicator covariates. Regression Assumptions Analysis All significant correlations from bivariate analysis were  further assessed for predictive value as it relates to TCa  incidence. The final predictor variables involved in the  multiple regression model included non-Hispanic White,  and Black/African American population-adjusted sizes, as                        |          |         |          |         |
+| Note. TCa = testicular cancer.                                                                                                                                                                |                                     |         |               |         |                        |          |         |          |         |
+
+Note. TCa = testicular cancer. *Statistically significant findings.
+
+tion groups (all moderately positive relationships). Black/African Americans, though marginally significant, showed moderately strong negative associations.
+
+All significant correlations from bivariate analysis were further assessed for predictive value as it relates to TCa incidence. The final predictor variables involved in the multiple regression model included non-Hispanic White, and Black/African American population-adjusted sizes, as well as state uninsured, poverty, and MUA average values. 
+
+Prior to this regression, the previously mentioned assumption analyses were performed. P-P plots reflected a normal distribution, while nonsignificant Shapiro–Wilks and Kolmogorov–Smirnov statistics further assured 
+
+| Table 4. Multiple Regression Model With VIF Statistics. Unstandardized   | Standardized   |                          |       |           |      |      |       |
+|--------------------------------------------------------------------------|----------------|--------------------------|-------|-----------|------|------|-------|
+| coefficients                                                             | coefficients   | Collinearity  statistics |       |           |      |      |       |
+| Modela                                                                   | B              | SE                       | β     | Tolerance | VIF  |      |       |
+| t                                                                        | Sig.           |                          |       |           |      |      |       |
+| 1                                                                        | (Constant)     | 5.895                    | 1.608 | 3.667     | .001 |      |       |
+| Non-Hispanic White                                                       | 1.328          | .570                     | .211  | 2.331     | .024 | .728 | 1.373 |
+| African American                                                         | −6.678         | .870                     | −.683 | −7.679    | .000 | .753 | 1.328 |
+| Poverty rate                                                             | –3.549E–5      | .000                     | −.105 | −.969     | .338 | .503 | 1.989 |
+| Uninsured rate                                                           | –1.047E–5      | .000                     | −.065 | −.572     | .570 | .457 | 2.189 |
+| MUA average                                                              | .010           | .024                     | .038  | .426      | .672 | .735 | 1.360 |
+
+Note. MUA = Medically Underserved Area; VIF = Variance Inflation Factor. aDependent variable: TCa Incidence.
+
+normality. Scatterplot assessment showed equal variance among residual values, while the maximum standard residual value and Cook's Distance statistic were 2.140 and .518, respectively. Though independence was assumed after bivariate analysis, VIF values were all <2.00, with the exception of state uninsured rates, which had a factor of 2.189, a value still within acceptable range.
+
+## Tca Incidence Multiple Regression Analysis
+
+Multiple linear regression analyses indicated that within the primary significant covariate associations (i.e., Black/
+African American population, White non-Hispanic population, uninsured status, poverty, ages 18–44 years, and state-specific MUA scores), only race was a significant predictor for TCa incidence (Black/African American population: standardized β = −.683, p < .001; White nonHispanic population: standardized β = .211, p < .024; Table 4). The aggregate regression model, however, strongly predicted state TCa incidence (adjusted R2 = 
+.714). When removing race from the model, the predictive strength drops significantly (adjusted R2 = .173). 
+
+Uninsured rates expressed more predictive value for decreased TCa incidence in comparison to poverty rates 
+(β = −.463, p < .0, and β = .012, p < .945, respectively). 
+
+Mortality was not included within this portion of the analysis, as minimal variable subgroups reflected significant associations in correlational analysis.
+
+## Discussion
+
+The presented results suggest that certain SES and race covariates are associated with TCa incidence in the United States from 2010 to 2014. Specifically, states with higher rates of poverty, uninsured individuals, and racial minority populations have lower TCa incidence. In contrast, the final regression model deduced Black/African American and non-Hispanic White population size as the only significant negative and positive predictors of the study, respectively. Certain known biological and unexplored socioeconomic factors will be considered to better explain the racial and SES discrepancies in TCa incidence, as unearthed by the current analysis. Finally, the potential impact of PPFA in reducing known disparities present within underserved minority populations, as they relate to TCa stage diagnosis, will be explored.
+
+## Genetic Influence
+
+TCa prevalence has a historic proclivity to White male populations. The condition, relative to other cancers, is remarkably hereditary (Skakkebaek et al., 2016). Almost 25% of Testicular Germ Cell Tumor (TGCT) risk is due to genetic predisposition, and this value could rise as further genome-wide association studies ensue (Litchfield, Shipley, & Turnbull, 2015; Skakkebaek et al., 2016). 
+
+Recent findings suggest that certain p-53 response element (p-53 RE KITLG) sequence mutations—a genetic mutation predominantly found in White European populations—may increase risk and explain the pathogenesis of a large portion of TGCT cases (Zeron-Medina et al., 
+2013). Duly, the current study's final regression model further supports this notion, as non-Hispanic White males were the only significant positive predictor of cancer incidence.
+
+## Explaining Black/African American Effect Size
+
+The final regression model further infers that Black/ African Americans were a significant predictor of decreased incidence. This effect was initially suspected to be a result of the aforementioned positive relationship between White men and TCa prevalence. However, surprisingly, this variable was the strongest coefficient of the model, a trend persistent even when controlling for nonHispanic White population distribution. This finding may be the result of multiple factors. First, and most reasonably, this may be the product of study design limitation. 
+
+As an ecological, descriptive study, lack of data and analytical rigor may explain the outstanding negative effect present in the regression.
+
+Nevertheless, if methodological error was not a significant confound, findings may suggest that other sociodemographic influences affect TCa incidence in Back/African American populations. Research has shown that major risk factors for TCa, such as cryptorchidism, microlithiasis, and infertility/fecundity, strongly affect both majority and minority males, especially those of lower SES (Bayne, Alonzo, Hsieh, & Roth, 2011; Chandra, Copen, & Stephen, 2013; Kokorowski, Routh, Nelson, & Graham, 2010; Pedersen et al., 2017). In fact, nonsurgical male infertility and fecundity may affect minority populations, specifically Black/African Americans, more than the White male majority (Chandra et al., 2013). Aside from genetic bias, TCa risk should equate to most racial groups somewhat indiscriminately.
+
+Moreover, recent study suggests Black/African American males encounter severe barriers to TCa screening services, as evidenced by their increased risk of latestage development (Sun et al., 2011). This same mechanism may help explain why, even in the presence of decreased non-Hispanic White population totals, Black/African American population size strongly predicts decreased TCa incidence. In this scenario, concerns of access to health care may restrict underserved Black/African American males from accessing timely care, potentiating the risk of advanced stage development and possible misdiagnosis of cancer origin. Furthermore, Black/African American populations residing in MUAs are subject to severe health-care worker/resource shortages and limiting options for genitourinary care (Mossanen et al., 2014). This shortage in expertise may also contribute to the underreporting of TCa cases within this population.
+
+Both arguments are further supported by initial analyses yielding positive correlations between Black/African American population size and increased state uninsured rates, increased poverty rates, and decreased MUA score frequency. All variables, coincidently, infer significant health-care access concerns, and all negatively correlate with TCa incidence (strictly in correlation analysis, however).
+
+This explanation, however, poses multiple issues. First and foremost, despite the highly metastatic and unpredictable characteristics of certain TGCT histological types, methods of identifying germ cell origin, including immunohistochemistry staining, radiological study, and/ or tumor marker analysis, are exceptionally effective. Seldom is TCa origin misdiagnosed. Such outcomes are typically a result of the "burned-out" phenomenon, or human error; both events are exceptionally rare and would not fully explain the substantial residual relationship observed in the current model. Secondly, other covariates, such as poverty rates, uninsured rates, and MUA scores, were essentially unremarkable in the final regression model of the current study, suggesting that these rates were more a result of racial distribution than actual TCa impact.
+
+Though in the current model Black/African American male population size remains the largest predictor of TCa incidence, a clear explanation of this effect is unclear and warrants further investigation. We suspect that genetic factors alone, albeit significant, may not completely explain the exceptional residual effect Black/African American population size has on TCa incidence within the current model. In the context of the present study, if access to health care indeed poses a partial concern for the correct diagnoses and reporting of TCa incidence, the need for PPFA and SNPs alike is even more apparent to help limit the disparity in TCa burden present in underserved minority males, specifically Black/African Americans.
+
+## Planned Parenthood Federation Of America
+
+This conversation, in terms of burden of TCa shared among all males, not just confined to White/Caucasians, is novel and must expand to address the emerging health inequities witnessed among men of color pertaining to this disease. Moving forward, if access to care potentiates, at minimum, partial incidence discrepancy, SNPs such as PPFA are crucial in providing affordable, accessible screening services to help bridge this gap. This point is evidenced by the fact that PPFA MHS presence had a positive association with TCa incidence rates. However, as PPFA MHS presence was negatively associated with Black/African American males, as well as select age group uninsured rates, this may serve as a springboard to expand investigation into whether or not expanding such services within geographic areas with high population densities of traditionally underserved males would increase TCa incidence among these male subgroups. This would be the result of an increase in the amount of TCa screenings offered. Theoretically, if an underserved male gains access to even general MHS, health-care professionals within the PPFA setting should be capable of recognizing and addressing presenting testicular abnormalities that are early stage or carcinoma in situ.
+
+## Limitations And Future Implications
+
+The current analysis is limited. For example, the analyses do not encompass enough data pertaining to actual service availability to provide an adequate needs assessment for PPFA. In other words, although a PPFA site lists a service is available on the website, to the extent such services are offered and to what capacity, is yet to be determined. PPFA, in spite of the previous point, generally seems to be addressing the presented issue, as indicated by the positive association between TCa incidence and MHS rates, per state.
+
+Results suggest that minority populations may still face geographical barriers to accessing PPFA TCa screening services, especially among Black/African American males. This relates to the issue of distribution of MHS services and population density of men of color. State PPFA services offered per state needs further critique pertaining to minority population density.
+
+The current analysis also shows no effect of increased PPFA services, both MHS and TCS, on aggregate TCa mortality. This relationship may differ, however, if TCa mortality rates were further stratified among racial and SES groups.
+
+The nature of the ecological study design presents many limitations and challenges to generalizabilitymainly, the lack of data specificity. Though this study was able to demonstrate preliminary population trends in TCa as they relate to certain measures of SES and racial indicators, it does not specify stage of diagnosis discrepancies, as well as the individual patient characteristics of diagnoses within each state registry. Furthermore, the study time window precedes key implementations of the 2010 Patient Protection and Affordable Care Act, including the individual mandate, Medicaid expansion, and market exchanges enacted. Impact of such legislation may have further implications on TCa trends and service access not captured within the scope of this study.
+
+Furthermore, due to time constraints of the current study, individual area MUA scores were not weighted for population size or age distribution when calculating state averages, which may have slightly confounded analyses performed with this specific variable. Nevertheless, MUA 
+scores reflected minimal effect in the final model; therefore, the significant outcomes surfaced are not affected by this error.
+
+Finally, this study also fails to identify current urologic services offered throughout the United States, including private and public services, outside of PPFA facilities. This aspect alone could also explain the lack of significant findings regarding PPFA services and TCa impact. Increased urologic services in an area may yield smaller PPFA service totals but still may improve TCa mortality. Presence of external services outside of PPFA 
+may greatly confound the relationship between PPFA services and TCa impact.
+
+## Conclusion
+
+Findings from this study warrant further investigation into the variables/mechanisms that define health disparity within underserved males, as it relates to TCa. 
+
+The final regression model suggests that factors beyond the genetic forefront contribute to TCa risk within underserved communities. We suggest that this discrepancy may be due, in part, to health-care access inequity; however, this is purely speculation and by no measure proven by the given analysis. Future research should continue to investigate the correlates of certain racial and sociodemographic variables on TCa impact and further analyze the effectiveness of SNPs, such as PPFA, in lessening the burden of disease within underserved males. Especially in respects to the current political gridlock and the potential defunding of PPFA, 
+services offered through this SNP must be further assessed beyond the standard scope in which it is currently viewed. As it relates to the current study, the benefits of PPFA in improving screening coverage for males at risk of TCa may lower the high proportion of late-stage diagnosis within underserved males.
+
+## Acknowledgments
+
+The authors would like to thank everyone at the Behavioral Health Research Group, Men's Health Initiative, Inc., and the Testicular Cancer Society for their tireless efforts in executing this study as well as their devotion to promoting men's health.
+
+## Declaration Of Conflicting Interests
+
+The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
+
+## Funding
+
+The author(s) received no financial support for the research, authorship, and/or publication of this article.
+
+## References
+
+American Cancer Society (ACS). (2018, June 30). *Can testicular cancer be found early?* Retrieved from https://www.
+
+cancer.org/cancer/testicular-cancer/detection-diagnosisstaging/detection.html Bayne, A. P., Alonzo, D. G., Hsieh, M. H., & Roth, D. R. 
+
+(2011). Impact of anatomical and socioeconomic factors on timing of urological consultation for boys with cryptorchidism. The Journal of Urology, 186(4), 1601–1605.
+
+Bridges, P. J., Sharifi, R., Razzaq, A., & Guinan, P. (1998). 
+
+Decreased survival of Black Americans with testicular cancer. The Journal of Urology, 159(4), 1221–1223.
+
+Burkhamer, J., Kriebel, D., & Clapp, R. (2017). The increasing toll of adolescent cancer incidence in the US. *Plos One*, 12(2), e0172986. doi:https://dx.doi.org/10.1371/journal. pone.0172986 Chandra, A., Copen, C. E., & Stephen, E. H. (2013). *Infertility* and impaired fecundity in the United States, 1982–2010: Data from the national survey of family growth (National Health Statistics Reports, No. 67). Hyattsville, MD: National Center for Health Statistics.
+
+Cronholm, P. F., Mao, J. J., Nguyen, G. T., & Paris, R. T. (2008). 
+
+A dilemma in male engagement in preventive services: 
+Adolescent males' knowledge and attitudes toward testicular cancer and testicular self-exam. *American Journal* of Men's Health, 3(2), 134–140. First Published April 25, 2008. doi:https://dx.doi.org/10.1177/1557988308315071 Elliott, B. A., & Larson, J. T. (2004). Adolescents in mid-sized and rural communities: Foregone care, perceived barriers, and risk factors. *Journal of Adolescent Health*, 35(4), 
+303–309. doi:https://dx.doi.org/10.1016/j.jadohealth.2003. 09.015 Fung, C., Fossa, S. D., Williams, A., & Travis, L. B. (2015). 
+
+Long-term morbidity of testicular cancer treatment. Urologic Clinics of North America, 42(3), 393–408. doi:https://dx.doi.org/10.1016/j.ucl.2015.05.002 Gilligan, T. (2015). Quality of life among testis cancer survivors. *Urologic Oncology*, 33(9), 413–419. doi:https://
+dx.doi.org/10.1016/j.urolonc.2015.05.018 Howlader, N., Noone, A., Krapcho, M., Garshell, J., Miller, D., & Altekruse, S. (2015). SEER cancer statistics review, 1975–2012, section 32, adolescent and young adult cancer by site, incidence, survival and mortality. Bethesda, MD: National Cancer Institute.
+
+Health Resources & Services Administration (HRSA). (2018). 
+
+Primary dataset: Medically underserved areas/populations (MUA/P). Retrieved from https://datawarehouse.hrsa.gov/ tools/DataPortalResults.aspx Hu, J. S., Baird, D. C., & Meyers, G. J. (2018). Testicular cancer: Diagnosis and treatment. *American Family Physician*, 
+97(4), 261.
+
+Huyghe, E., Muller, A., Mieusset, R., Bujan, L., Bachaud, J., 
+Chevreau, C., … Thonneau, P. (2007). Impact of diagnostic delay in testis cancer: Results of a large population-based study. *European Urology*, 52(6), 1710–1716. doi:https:// dx.doi.org/10.1016/j.eururo.2007.06.003 Kamel, M. H., Elfaramawi, M., Jadhav, S., Saafan, A., Raheem, O. A., & Davis, R. (2016). Insurance status and differences in treatment and survival of testicular cancer patients. Urology, 87, 140–145. doi:https://dx.doi.org/10.1016/j. urology.2015.06.059 Kokorowski, P. J., Routh, J. C., Nelson, C. P., & Graham, D. 
+
+A. (2010). Variations in timing of surgery among boys who underwent orchidopexy for cryptorchidism. *Pediatrics*, 126(3), E576–E582.
+
+Lawrence, H. C., & Ness, D. L. (2017). Planned parenthood provides essential services that improve women's health. Annals of Internal Medicine, 166(6), 443–444. doi:https:// dx.doi.org/10.7326/M17-0217 Lerro, C. C., Robbins, A. S., Fedewa, S. A., & Ward, E. M. 
+
+(2014). Disparities in stage at diagnosis among adults with testicular germ cell tumors in the national cancer data base. Urologic Oncology, 32(1), 23.e15–23.e21. doi:https:// dx.doi.org/10.1016/j.urolonc.2012.08.012 Litchfield, K., Shipley, J., & Turnbull, C. (2015). Common variants identified in genome-wide association studies of testicular germ cell tumour: An update, biological insights and clinical application. *Andrology*, 3(1), 34–46. doi:https://dx.doi.org/10.1111/andr.304 Markt, S. C., Lago-Hernandez, C. A., Miller, R. E., Mahal, B. 
+
+A., Bernard, B., Albiges, L., … Sweeney, C. J. (2016). Insurance status and disparities in disease presentation, treatment, and outcomes for men with germ cell tumors. 
+
+Cancer, 122, 3127–3135. doi:https://dx.doi.org/10.1002/ cncr.30159 Mossanen, M., Izard, J., Wright, J. L., Harper, J. D., Porter, M. 
+
+P., Daratha, K. B., … Gore, J. L. (2014). Identification of underserved areas for urologic cancer care. Cancer, 120(10), 1565–1571. doi:https://dx.doi.org/10.1002/cncr.28616 Mulye, T. P., Park, M. J., Nelson, C. D., Adams, S. H., Irwin, J. E., & Brindis, C. D. (2009). Review article: Trends in adolescent and young adult health in the United States. Journal of Adolescent Health, 45(1), 8–24. doi:https:// dx.doi.org/10.1016/j.jadohealth.2009.03.013 Öztürk, Ç., Fleer, J., Hoekstra, H. J., & Hoekstra-Weebers, J. M. 
+
+(2015). Delay in diagnosis of testicular cancer: A need for awareness programs. *Plos One*, 10(11), 1–10. doi:https:// dx.doi.org/10.1371/journal.pone.0141244 Parenti, G. C., Giorgi, U. D., Gaddoni, E., Conteduca, V., 
+Zago, S., Campioni, P., … Albello, F. (2014). Testicular microlithiasis and testicular germ cell tumors: A seven year retrospective study. *Andrology-Open Access*, 3(1). doi:https://dx.doi.org/10.4172/2167-0250.1000115 Pedersen, M. R., Bartlett, E. C., Rafaelsen, S. R., Osther, P. J., 
+Vedsted, P., Sellars, M. E., … Møller, H. (2017). Testicular microlithiasis is associated with ethnicity and socioeconomic status. *Acta Radiologica Open*, 6(8), 1. doi:https://
+dx.doi.org/10.1177/2058460117723676 Piltoft, J. S., Larsen, S. B., Dalton, S. O., Johansen, C., Baker, J. L., Cederkvist, L., & Andersen, I. (2017). Early life risk factors for testicular cancer: A case-cohort study based on the Copenhagen School Health Records Register. Acta Oncologica, 56(2), 220–224. doi:https://dx.doi.org/10.108 0/0284186X.2016.1266085 Planned Parenthood Federation of America. (PPFA). (n.d.). 
+
+Our health, our decisions, our moment, 2013–2014 annual report. Retrieved from https://www.plannedparenthood. org/files/6714/1996/2641/2013-2014_Annual_Report_ FINAL_WEB_VERSION.pdf Planned Parenthood Federation of America (PPFA). (2015). By the numbers. Retrieved from http://plannedparenthood.org/ files/3314/3638/1447/PP_Numbers.pdf Ries, L. G. (2007). Cancer survival among adults: U.S. SEER 
+program, 1988–2001. In L. A. G. Ries, J. L. Young, G. E. Keel, M. P. Eisner, Y. D. Lin & M.-J. D. Horner (Eds.), Patient and tumor characteristics (pp. 81–88). Bethesda, MD: U.S. Department of Health and Human Services, National Institutes of Health, National Cancer Institute.
+
+Rovito, M. J., Manjelievskaia, J., Leone, J. E., Lutz, M., 
+Cavayero, C. T., & Perlman, D. (2015). Recommendations for treating males: An ethical rationale for the inclusion of Testicular Self-Examination (TSE) in a standard of care. American Journal of Men's Health, 12(3), 539–545.
+
+Skakkebaek, N. E., Meyts, E. R.-D., Louis, G. M. B., Toppari, J., Andersson, A., Eisenberg, M. L., … Juul, A. (2016). Male reproductive disorders and fertility trends: Influences of environment and genetic susceptibility. *Physiological* Reviews, 96(1), 55–97. doi:https://dx.doi.org/10.1152/ physrev.00017.2015 Siegel, R. L., Miller, K. D., & Jemal, A. (2017). Cancer statistics, 2017. *CA: A Cancer Journal for Clinicians*, 67(1), 
+7–30. doi:https://dx.doi.org/10.3322/caac.21387 Sun, M., Abdollah, F., Liberman, D., Abdo, A., Thuret, R., 
+Tian, Z., … Karakiewicz, P. I. (2011). Racial disparities and socioeconomic status in men diagnosed with testicular germ cell tumors: A survival analysis. *Cancer*, 117(18), 4277–4285. doi:https://dx.doi.org/10.1002/ cncr.25969 Topulos, G. P., Greene, M. F., & Drazen, J. M. (2015). Planned parenthood at risk. The New England of Medicine, 373(10), 963. doi:https://dx.doi.org/10.1056/NEJMe1510281 U.S. Cancer Statistics Working Group. (2017). *United States* cancer statistics: 1999–2014 incidence and mortality web-based report. Atlanta: U.S. Department of Health and Human Services, Centers for Disease Control and Prevention and National Cancer Institute. Retrieved from http://www.cdc.gov/uscs Watson, J. (2014). Young African American males: Barriers to access to health care. Journal of Human Behavior in the Social Environment, 24(8), 1004. doi:https://dx.doi.org/10. 1080/10911359.2014.953416 Zeron-Medina, J., Wang, X., Repapi, E., Campbell, M., Su, D., Castro-Giner, F., … Bond, G. (2013). A polymorphic p53 response element in kit ligand influences cancer risk and has undergone natural selection. Cell, 155(2), 410– 422. doi:https://dx.doi.org/10.1016/j.cell.2013.09.017

medical/md/PMC6285296.md

@@ -0,0 +1,206 @@
+ORIGINAL ARTICLE
+
+# Rbmscs/Itga5B1 Promotes Human Vascular Smooth Muscle Cell Differentiation Via Enhancing Nitric Oxide Production
+
+Yingxin Zhang1, Jie Ding1, Cong Xu1, Hongli Yang1, Peng Xia2, Shengjun Ma2, Haiying Chen1 1Central Laboratory of Liaocheng People's Hospital, Liaocheng, Shandong, China, 2*Department of Cardiology, Liaocheng People's Hospital, Liaocheng, Shandong, China* Background and Objectives: Previous studies have shown that integrins alpha5beta1 (ITGA5B1) gene-modified rat bone marrow mesenchymal stem cells (rBMSCs) could prevent cell anoikis and increase the nitric oxide (NO) production. Here we examined the capability of rBMSCs/ITGA5B1 on the phenotype modulation of Human Pulmonary Artery Smooth Muscle Cell (HPASMC) *in vitro*. Methods and Results: The synthetic (dedifferentiated) phenotype of HPASMC was induced by monocrotaline (MCT, 
+1μM) for 24 h and then co-cultured with rBMSCs/ITGA5B1 in a transwell culture system. The activation of NO/cGMP 
+(nitric oxide/Guanosine-3', 5'-cyclic monophosphate) signaling was investigated in HPASMC. The changes of pro-inflammatory factors, oxidative stress, vasodilator, vasoconstrictor, contractile and synthetic genes, and the morphological changes of HPASMC were investigated. The results of this study showed that the NO/cGMP signal, endothelial nitric oxide synthase (eNOS) expression, the expression of the vasoprotective genes heme oxygenase-1 (HMOX1) and prostaglandin-endoperoxide synthase 2 (PTGS2) were increased, but the expression of transforming growth factor-β1 (TGF-β1), CCAAT/enhancer-binding proteins delta (Cebpd), Krüppel-like factor 4 (KLF4), and activating transcription factor 4 (ATF4) were reduced in MCT treated HPASMC co-cultured with rBMSCs/ITGA5B1. The synthetic smooth muscle cells (SMCs) phenotype markers thrombospondin-1, epiregulin and the vasoconstrictor endothelin (ET)-1, thromboxane A2 receptor (TbxA2R) were down-regulated, whereas the contractile SMCs phenotype marker transgelin expression was up-regulated by rBMSCs/ITGA5B1. Furthermore, rBMSCs/ITGA5B1 promoted the morphological restoration from synthetic (dedifferentiation) to contractile (differentiation) phenotype in MCT treated HPASMC. Conclusions: rBMSCs/ITGA5B1 could inhibit inflammation and oxidative stress related genes to promote the HPASMC cell differentiation by activation NO/cGMP signal.
+
+Keywords: Bone marrow derived mesenchymal stem cells, Integrin, Nitric oxide, Phenotypic transition, Human vascular smooth muscle cell (HPASMC)
+
+## Introduction
+
+ Pulmonary arterial hypertension (PAH) is a vascular remodeling disease with a poor prognosis and limited therapeutic option . Pulmonary vascular remodeling is the key structural alteration in the normal architecture of the walls of pulmonary arteries. Vascular smooth muscle cells 
+(SMCs) are involved in this process (1). 
+
+ Vascular SMCs exhibit phenotypic and functional plasticity in response to environment. Upon vascular injury, SMCs undergo phenotypic transition from a quiescent contractile (differentiated) to a proliferative/migratory synthetic (dedifferentiated) phenotype. This processes plays a major role in the development of vascular remodeling (2), and is accompanied by decrease in expression of SMCs-specific markers (transgelin, SM a-actin) responsible for SMCs contraction, increase in expression of synthetic SMC markers (thrombospondin, epiregulin), and production of pro-inflammatory mediators that modulate induction of proliferation and chemotaxis (3). Inflammatory infiltrates into the lungs mediate phenotypic transition in pulmonary vascular SMCs, stimulate the structural remodeling in the vasculature (4), lead to the activation of oxidative stress, cause a decrease in vasodilators 
+(nitric oxide, prostacyclins) and an increase in vasoconstrictors endothelin (ET)-1 and thromboxanes (4). 
+
+ Some studies suggest that nitric oxide (NO) has been shown to reduce inflammation, apoptosis (5), and regulate the vascular SMCs proliferation, migration and differentiation (6). NO/cGMP (cyclic 3'-5' guanosine monophosphate) signaling plays a critical role in smooth muscle tone, cardiac contractility, and cell growth (7). However, the disturbance of the endothelial cells in PAH results in the alteration of NO/cGMP signaling, then lead to a decrease in endothelial nitric oxide synthase (eNOS) expression and NO production (8). Therefore, it is important to maintain the functions of endothelial cells. 
+
+ Mesenchymal stem cells (MSCs) have been proposed to the treatment of pulmonary hypertension to improve vascular endothelial functions of the monocrotaline (MCT)- 
+injured lung. MCT is a pyrrolizidine alkaloid which selectively injures the pulmonary vascular endothelium and induces pulmonary vasculitis, can cause PAH in rats and is widely utilized to analyze the pathophysiology of PAH 
+(9). Fischer reported that the majority of MSCs were trapped inside the lungs following intravenous delivery (10), 
+and MSCs can suppress ongoing inflammation (11), these may benefit for the treatment of lung diseases. Our previous study had found that integrin alpha5 (ITGA5), integrin beta1 (ITGB1) increased the NO production and prevented the cell anoikis (12) *in vitro*. In present study, we focus on the effect of rBMSCs/ITGA5B1 on MCT induced phenotypic transition in co-cultured HPASMC 
+(Pulmonary Artery Smooth Muscle Cells) to evaluate its therapeutic potential for the future treatment of PAH.
+
+## Materials And Methods Ethics Statement
+
+ The adult male Wistar rats weighing 100∼120 g 
+(certificate number SCXK Shandong 20140007) were obtained from the animal experimental center of Shangdong University (Shandong, China). The study was approved by the Institutional Animal Care and Use Committee (Liaocheng People's Hospital, Shandong, China). All experiment with animals were conducted in accordance with the guidelines described in the National Institutes of Health 
+"Guide for the Care and Use of Laboratory Animals".
+
+## Cells And Reagents
+
+ HPASMC were purchased from Sciencell, cultured with smooth muscle cell medium with smooth muscle cell growth supplement (Sciencell Research Laboratories, Inc., 
+San Diego, CA, USA). The adult male Wistar rats were used as rBMSCs donors. The femurs and tibiae were removed from the rats and rBMSCs were isolated and cultured as we described previously (13). The pLVXmCMV-mCherry lentiviral vector backbone, the ITGA5, ITGB1 gene over-expressed lentiviral vectors pLVXmCMV-ITGA5-mCherry (LV-ITGA5) and pLVX-mCMVITGB1-mCherry (LV-ITGB1) were purchased from Biowit Technologies Co., Ltd. (Shenzhen, China). The lentiviral packaging plasmids VSV-G, psPax2 and pRSV-Rev were given as a kind gift by Dr Padraig Strappe (Central Queensland University, Australian). 
+
+## Transduction, Co-Culture And The Morphological Changes Of Hpasmc
+
+ The Lentiviral vectors production and transduction was performed as we described previously (13). rBMSCs were randomly divided into two groups for co-culture: vector group (infected with empty vector virus), and rBMSCs/ 
+ITGA5B1 group (co-infected with ITGA5 and ITGB1 virus). The transwell co-culture system was used for HPASMC and rBMSCs co-culture, briefly, HPASMC was cultured in the lower compartment of a transwell-plate 
+(Costar 3412, Corning Incorporated, NY, USA), treated with MCT (1 μM) for 24 h after HPASMC reached 50∼
+60% confluence, and named for MCT-HPASMC. Each group of rBMSCs (5 days post transduction) was placed onto 0.4 μm pore size polycarbonate membranes of the upper compartment in the transwell plate. HPASMC were randomly divided into four groups: Control group (only HPASMC), Model group (only MCT-HPASMC), Vector group (MCT-HPASMC in lower compartment and co-cultured with rBMSCs/Vector), ITGA5B1 group (MCTHPASMC in lower compartment and co-cultured with rBMSCs/ITGA5B1). The morphological changes of each group of HPASMC were investigated and photographed under light microscopy (CKX71, Olympus) after co-cultured for 72 h.
+
+## No Detection
+
+ Nitrite (the stable end product of NO) was measured by a Nitric Oxide Colorimetric Assay Kit (Biovision, Milpitas, CA, USA) in each group of HPASMC supernatants using the Griess reaction as described in the previous studies (14). The absorbance was measured by microplate reader (Multiskan MK3, Thermo scientific, USA) 
+at 540 nm. The concentration of nitrite in HPASMC supernatants was calculated by a calibration curve prepared from serial dilutions of nitrite standard solution. Each sample was analyzed in triplicate and each experiment was repeated for three times. 
+
+## Measurement Of Reactive Oxygen Species (Ros) Levels
+
+ Reactive Oxygen Species Assay Kit (Beyotime, Jiangsu, China) was used for detecting the intracellular ROS levels by the oxidation-sensitive fluorescent probe 2', 7'-dichlorofluorescein diacetate (DCFH-DA). Cells were washed twice with PBS and incubated with DCFH-DA (10 μM) 
+for 20 min after HPASMC co-cultured with rBMSCs/ 
+ITGA5B1for 72 h. ROS can oxidize non fluorescent DCFH to produce fluorescent DCF. The cellular production of fluorescent DCF was measured with flow cytometry (Becton, Dickinson) and analyzed by the BD 
+FACSDiva software.
+
+## Western Blotting
+
+ To determine the protein expression of eNOS, CCAAT/ 
+enhancer-binding proteins delta (Cebpd), Krüppel-like factor 4 (KLF4), transforming growth factor-β1 (TGF-β 1), and endothelin (ET)-1, total protein was extracted in ice-cold lysis buffer containing PMSF (Beyotime, Jiangsu, China) for 30 min on ice at 5 days post-transduction. The lysate was then centrifuged at 12,000×g for 5 min at 4oC. 
+
+The supernatant was collected and the protein concentration was determined by BCA Protein Assay Kit 
+(Beyotime, Jiangsu, China). Equal amounts of protein (20 μg) were separated by 10% SDS-PAGE, and then were electro-transferred to polyvinylidene difluoride (PVDF) 
+membranes (Millipore, Bedford, MA). The membranes were blocked with 5% skimmed milk at room temperature for 1 h, and then incubated with the primary monoclonal anti-eNOS (BD Biosciences PharMingen, San Diego, CA, 
+USA), anti-Cebpd, anti-TGF-β1, anti-ET-1, polyclonal anti-KLF4 antibody (1:1000, all from Abcam, Cambridge, UK), and monoclonal anti-β-actin antibody (1:1000, Beyotime, Jiangsu, China) respectively overnight at 4oC. 
+
+The membranes were washed three times for 5 min in TBST and then incubated with goat anti-rabbit or goat anti-mouse IgG/HRP conjugated secondary antibodies 
+(1:1000) for 1 h. The protein bands were visualized using ECL kit (Beyotime, Jiangsu, China). Images were obtained and analyzed with AlphaView analysis system 
+(ProteinSimle, USA). The expression of β-actin was used as an internal control.
+
+## Quantitative Pcr (Qpcr)
+
+ Total RNA in HPASMC was extracted by Trizol reagent 
+(Thermo Fisher Scientific), then RNA (1 μg) was reverse-transcribed using a Prime ScriptTM RT reagent Kit with gDNA Eraser in 20 μl reactions. The cDNA product was diluted 3-folds, aliquoted, and stored at −80oC. 
+
+Amplification was performed on ABI 7500 Real-Time PCR system (Applied Biosystems) using SYBR® Premix Ex TaqTM II kit (all from Takara, Dalian, China). The thermocycling conditions were 30 s pre-incubations at 95oC for one cycle, followed by 40 cycles of 95oC for 5 s and 60oC for 34 s. Primers for guanosine-3',5'-cyclic monophosphate (cGMP) were 5'-TGG AGG AGA ATA CTG 
+GCA AGG-3' (Sense) and 5'-TGG CTC TCT CCA CTG 
+CTT CA-3' (antisense), activating transcription factor 4 (ATF4), 5'-CCA ACA ACA GCA AGG AGG AT-3' 
+(Sense), 5'-AGG TCA TCT GGC ATG GTT TC-3' (antiSense), heme oxygenase-1 (HMOX1), 5'-AAC TTT CAG 
+AAG GGC CAG GT-3' (Sense), 5'-GAA GAC TGG GCT 
+CTC CTT GTT-3' (antiSense), prostaglandin-endoperoxide synthase 2 (PTGS2), 5'-GTC TGG TGC CTG GTC 
+TGA TG-3' (Sense), 5'-GCC TGC TTG TCT GGA ACA 
+AC-3' (antiSense), thromboxane A2 receptor (TbxA2R), 
+5'-TCG CTA CAC CGT GCA ATA CC-3' (Sense), 5'-TGT 
+TCA GCA GGA AGG ACA GC-3' (antiSense), Thrombospondin, 5'-TCC TCC TCA CCC TTG ACA AC-3' 
+(Sense), 5'-TGG ACA GCT CAT CAC AGG AG-3' (antiSense), transgelin (TAGLN), 5'-TCC AGG TCT GGC 
+TGA AGA AT-3' (Sense), 5'-GCT CCA TCT GCT TGA 
+AGA CC-3' (antiSense), epiregulin, 5'-TGG TGT CCG ATG TGA ACA CT-3' (Sense), 5'-TGG AAC CGA CGA 
+CTG TGA TA-3' (antiSense), and GAPDH, 5'-TGC ACC 
+ACC AAC TGC TTA GC-3'(sense), 5'-GGC ATG GAC 
+TGT GGT CAT GAG-3' (antisense). NO-reverse transcription controls (No-RT) and No-template controls 
+(NTC) were performed for each RNA type and primer pair. The fold changes amplification for targeted genes was normalized to the housekeeping gene GAPDH by the 2
+−△△CT method. Samples were analyzed in triplicate and each experiment was repeated for at least three times. 
+
+## Statistical Analysis 
+
+![3_Image_0.Png](3_Image_0.Png)
+
+ Values were expressed as means±SD. The data were analyzed by one-way ANOVA, followed by SNK-q test. The level of statistical significance was set at p<0.05.
+
+## Results Rbmscs/Itga5B1 Enchanced The No/Cgmp Signal, Enos Expression And Inhibited Ros Production
+
+ Compared to control groups, NO concentration and cGMP mRNA expression was reduced but ROS was increased in MCT treated HPASMC model groups. 
+
+However, the NO level, cGMP mRNA expression was elevated about 3.5-folds and 3-folds respectively but ROS 
+production was reduced in HPASMC co-cultured with rBMSCs/ITGA5B1 compared to model groups (Fig. 1A∼
+C). Furthermore, eNOS, which is associated with diastolic factors NO production, was activated in ITGA5B1 groups compared to model groups (Fig. 1D).
+
+## Rbmscs/Itga5B Regulated Stress Response Genes, Inflammation Factors And Diastolic-Systolic Factors In Mct Treated Hpasmc
+
+The present study found that MCT induced the oxidative stress and inflammation factors increasing in HPASMC,
+manifestied by the up-regulated stress-induced transcription factor ATF4, down-regulated vasoprotective genes HMOX1 and PTGS2 mRNA expression (Fig. 2A) and 2B), increased the pro-inflammation factors Cebpd, KLF4 and TGF- β 1 protein expression (Fig. 2C and 2D).
+
+After HPASMC co-cultured with rBMSCs/ITGA5B1, the expression of ATF4, Cebpd, KLF4, and TGF- β 1 were all depressed but HMOX1 and PTGS2 was elevated in HPASMC by introduction of rBMSCs/ITGA5B1 (Fig. 2).
+
+Furthermore and importantly, rBMSCs/ITGA5B1 could improve the unbalance state of diastolic-systolic factors expression of MCT treated HAPSMC. The eNOS expression and NO production were increased in ITGA5B1 groups as we mentioned above (Fig. 1A and 1D). The Tbxa2R
+mRNA and vasoconstrictor ET-1 protein expression was up-regulated 1.46-folds and 2.56-folds higher respectively in model groups than in control groups, but it was
+
+![4_image_0.png](4_image_0.png)
+
+![5_image_0.png](5_image_0.png)
+
+down-regulated by co-cultured with rBMSCs/ITGA5B1 
+(Fig. 2B and 2D). 
+
+## Effect Of Rbmscs/Itga5B1 On Morphological Changes And Phenotypic Transition In Hapsmc
+
+ For normal cell morphology of HPASMC in control groups, the cells were spindle-shaped with small size, but the cell morphology and overall cell size was changed much in MCT treated HPASMC groups, which showed fibroblast like and larger in volume compared to control groups. However, rBMSCs/ITGA5B1 could rescue the MCT induced HPASMC morphologic changes, the cells morphology in ITGA5B1 groups was similar to that of the control group, showing more spindle-shaped and smaller size than in model groups (Fig. 3). Moreover, the mRNA 
+expression of synthetic SMCs phenotype marker thrombospondin-1 and epiregulin were up-regulated significantly, increased above 1.4-folds and 100-folds respectively, whereas the transgelin was down-regulated nearly 2.5-folds in model groups than in control groups (Fig. 4). 
+
+Interestingly, MCT induced phenotypic transition from contractile to synthetic phenotype in HPASMCs was depressed by co-cultured with rBMSCs/ITGA5B1, the thrombospondin-1, epiregulin was decreased 2.88-folds and 3.17-folds respectively, but the contractile SMCs phenotype marker transgelin was increased 2.3-folds compared to model groups (Fig. 4). 
+
+## Discussion
+
+ Mesenchymal stem cells (MSCs) have been proposed to the treatment of pulmonary hypertension to improve vascular endothelial functions, but the low survival rates after transplantation due to cell death via anoikis driven by the loss of cell adhesion is a major obstacle to stem cell therapy (15). Our previous studies have shown that ITGA5B1 could prevent rBMSCs cell anoikis and increase the NO 
+production (12). In this study we demonstrated that rBMSCs/ITGA5B1 activated NO/cGMP signal, attenuated inflammation factors expression, oxidative stress, and improve the unbalance state of diastolic-systolic factors expression in MCT treated HAPSMC.
+
+ Endothelial cell dysfunction plays an important role in the pathogenesis of PAH and is associated with diminished eNOS-derived NO production. The endothelial barrier disruption resulted in the up-regulation of inflammatory cytokines and contribute to the development of oxidative stress, leading to generation of ROS (16). The increased ROS level can significantly inhibit the bio-availability of NO and ultimately lead to a reduction in NO-induced vasodilation of the pulmonary vasculature (4). NO 
+acts as a suppressor of SMC proliferation and endothelium derived relaxing factor, and has a great impact on the pulmonary circulation mainly through the second messenger cGMP (17). Therefore, the enhanced NO/cGMP activation by rBMSCs/ITGA5B1 may exert its regulation effect on the inflammation, oxidative stress, and diastolic-systolic factors. 
+
+ The present study demonstrated that rBMSCs/ITGA5B1 depressed the expression of pro-inflammatory factors 
+(Cebpd, KLF4 and TGF-β1), ROS production, stress response transcription factor ATF4, but up-regulated HMOX1 and PTGS2 expression, restore the MCT induced morphological changes and inhibited phenotypic tran-
+
+![6_image_0.png](6_image_0.png)
+
+sition in HPASMCs. It has been widely accepted inflammation contributes to pulmonary vascular remodeling, and the Cebpd, KLF4 and TGF-β1 is capable of regulating inflammation. Cebpd belongs to the CCAAT/enhancer-binding protein family, and these proteins functions as transcription factors in many biological processes, including pro-inflammatory gene expression (18). Cebpd is a central gene in inflammation and plays an important role in the inflammatory responses (18). For transcription factor KLF4, it involved in SMC dedifferentiation. KLF4 could induce and regulate the inflammatory factors expression in macrophages (19), bound to the TGF-β control element transgelin promoters, and suppress the SMC 
+differentiation gene expression (20). TGF-β1 is a multifunctional signaling protein involved in growth stimulation, migration, phenotypic transition and morphological changes of vascular SMC (21). In our study, we observed that the pro-inflammatory factors Cebpd, KLF4 and TGF-β1 up-regulation with the increase of ROS in MCT treated HPASMC, but they were inhibited by co-cultured with rBMSCs/ITGA5B1. Furthermore, ATF4 was down-regulated and HMOX1was up-regulated by rBMSCs/ITGA5B1. ATF4 is a master transcriptional activator of the integrated stress response, can exert its pro-inflammatory through nuclear factor-kappaB and IL-6 activation (22). HMOX1 is an oxidative stress response enzyme and generally regarded as a protective mechanism, which presents with anti-inflammatory properties and was inversely correlated to pulmonary vascular resistance (23). 
+
+Recently report demonstrated that the decreased lung vasoprotective genes HMOX1 and PTGS2 associated with greater pulmonary inflammation (24). Although the overwhelming majority of studies on PTGS2 had explored the role of it as the key factor in the cellular response to inflammation, however, there was sporadic report suggested that PTGS2 was a key regulatory enzyme in the synthesis of the antifibrotic agent prostaglandin E2 (25), and exhibited vasoprotective function (24). More importantly, there is considerable data supporting the anti-inflammatory properties of MSCs will be of benefit for many conditions (26, 27). The concept that the pathological phenotype of SMCs from a contractile to a synthetic phenotype was triggered by different environmental stress and injury events including activated inflammatory cascades 
+(28). Therefore, the inhibitory effect of rBMSCs/ITGA5B1 on pro-inflammation factors and oxidative stress may mitigate phenotypic transition. 
+
+ In case of the vessel damage under different environmental stress, vascular SMCs are able to switch from the quiescent contractile phenotype to the pro-inflammatory synthetic phenotype. In this study, MCT induced the HPASMC with hypertrophy, enhanced synthetic SMCs phenotype markers (thrombospondin-1 and epiregulin) expression and repressed contractile SMCs phenotype marker transgelin expression in model groups compared to control groups, whereas, the morphological change and phonotypic transition of HPASMC induced by MCT was reversed by co-cultured with rBMSCs/ITGA5B1. The cell shape in ITGA5B1 groups showed similar in morphology to control groups, a single layer of cells with the elongated spindle shaped cells were clearly observed in ITGA5B1 groups, and the expression of thrombospondin-1, epiregulin was decreased but transgelin was increased in ITGA5B1 groups. A recent study reported that the inhibition of thrombospondin-1 prevents TGF-β1 activation and protects against PAH development (29). 
+
+Epiregulin is an epidermal growth factor (EGF)-related growth regulating peptide which involved in vascular SMCs proliferation and induction of SMCs dedifferentiation (30). Inversely, transgelin is ubiquitously expressed in vascular SMCs and is an early marker of SMCs differentiation (31). Our results were consistent with the above reports. The mitigated phenotypic transition in ITGA5B1 groups indicated that rBMSCs/ITGA5B1 maybe the determinants for the regulation SMC phenotype marker expression and involved in the maintenance of the contractile phenotype in HPASMC.
+
+ PAH not only characterized as a disease of endothelial dysfunction but also with an imbalance between vasoconstrictors and vasodilators. Thromboxane A2 (TbxA2) 
+and ET-1 are a potent vasoconstrictor while NO has strong vasodilatory effects. TbxA2 was produced by thromboxane synthase (TbxAS) and ultimately stimulates TbxA2 receptor (TbxA2R) to induce vasoconstriction (32). ET-1 is known to be an extremely powerful vasoconstrictor, involved in vascular remodeling and plays a major role in the pathophysiology of hypertension. Supporting the concept that reducing ET-1 vasoconstrictor activity contributes to the improvement in endothelial vasodilator function (33). With the reduction of ET-1, the vasodilator NO 
+production was enhanced in ITGA5B1 groups. In consideration of NO is synthesized largely by eNOS in endothelial cell (27). The present results also support a hypothesis related to the recovery of diastolic-systolic factors balance, such as up-regulated eNOS, NO production and repressed ET-1 protein expression and pro-inflammatory factors. Taken together, our results reveal a critical role of the rBMSCs/ITGA5B1 on inhibited inflammation, oxidative stress, and HPASMC synthetic phenotype evidenced by lowering HPASMC pro-inflammation factors, alleviating oxidative stress, reversing the synthetic phenotype transition, whereas elevating contractile gene transgelin, restoring the morphological changes of HPASMC. 
+
+Furthermore, rBMSCs/ITGA5B1 regulated the imbalance between vasoconstrictors and vasodilators induced by MCT. The focus on inflammation, oxidative stress, phenotypic transition, balance between vasoconstrictors and vasodilators in HPASMC, and the way to enhance the anoikis resistance to successful application of stem cell therapy as we mentioned previously (12), may lend itself to a whole new strategy for preventing and potentially reversing PAH progression in the future.
+
+## Acknowledgements
+
+ This work was supported by the Natural Science Foundation of Shandong Province of China (grant number ZR2016HP33); and the National Natural Science Foundation of China (grant number 81270104). We are grateful to Dr. Li Pan for technical assistance.
+
+## Potential Conflict Of Interest
+
+ The authors have no conflicting financial interest. 
+
+## References
+
+1. Tuder RM. Pulmonary vascular remodeling in pulmonary hypertension. Cell Tissue Res 2017;367:643-649 2. Coll-Bonfill N, de la Cruz-Thea B, Pisano MV, Musri MM. 
+
+Noncoding RNAs in smooth muscle cell homeostasis: implications in phenotypic switch and vascular disorders. 
+
+Pflugers Arch 2016;468:1071-1087 3. Chistiakov DA, Orekhov AN, Bobryshev YV. Vascular smooth muscle cell in atherosclerosis. Acta Physiol (Oxf) 
+2015;214:33-50 4. Crosswhite P, Sun Z. Nitric oxide, oxidative stress and inflammation in pulmonary arterial hypertension. J Hypertens 2010;28:201-212 5. Prudente A, Favaro WJ, Reis LO, Riccetto CL. Nitric oxide coating polypropylene mesh increases angiogenesis and reduces inflammatory response and apoptosis. Int Urol Nephrol 2017;49:597-605 6. Csiszar A, Labinskyy N, Olson S, Pinto JT, Gupte S, Wu JM, Hu F, Ballabh P, Podlutsky A, Losonczy G, de Cabo R, Mathew R, Wolin MS, Ungvari Z. Resveratrol prevents monocrotaline-induced pulmonary hypertension in rats. Hypertension 2009;54:668-675 7. Mónica FZ, Bian K, Murad F. The endothelium-dependent nitric oxide-cGMP pathway. Adv Pharmacol 2016;77:1-27 8. Nickel KF, Laux V, Heumann R, von Degenfeld G. 
+
+Thrombin has biphasic effects on the nitric oxide-cGMP 
+pathway in endothelial cells and contributes to experimental pulmonary hypertension. PLoS One 2013;8: 
+e63504 9. Goto J, Ishikawa K, Kawamura K, Watanabe Y, Matumoto H, Sugawara D, Maruyama Y. Heme oxygenase-1 reduces murine monocrotaline-induced pulmonary inflammatory responses and resultant right ventricular overload. Antioxid Redox Signal 2002;4:563-568 10. Fischer UM, Harting MT, Jimenez F, Monzon-Posadas WO, Xue H, Savitz SI, Laine GA, Cox CS Jr. Pulmonary passage is a major obstacle for intravenous stem cell delivery: the pulmonary first-pass effect. Stem Cells Dev 2009; 18:683-692 11. Nasri F, Mohtasebi MS, Hashemi E, Zarrabi M, Gholijani N, Sarvestani EK. Therapeutic efficacy of mesenchymal stem cells and mesenchymal stem cells-derived neural progenitors in experimental autoimmune encephalomyelitis. 
+
+Int J Stem Cells 2018;11:68-77 12. Chen HY, Pan L, Yang HL, Xia P, Yu WC, Tang WQ, 
+Zhang YX, Chen SF, Xue YZ, Wang LX. Integrin alpha5beta1 suppresses rBMSCs anoikis and promotes nitric oxide production. Biomed Pharmacother 2018;99:1-8 13. Chen H, Yang H, Yue H, Strappe PM, Xia P, Pan L, Zhang Y, Chai S, Chen S, Ma L, and Wang L. Mesenchymal Stem Cells Expressing eNOS and a Cav1 Mutant Inhibit Vascular Smooth Muscle Cell Proliferation in a Rat Model of Pulmonary Hypertension. Heart Lung Circ 2017;26: 509-518 14. Xia P, Chen HY, Chen SF, Wang L, Strappe PM, Yang HL, Zhou CH, Zhang X, Zhang YX, Ma LL, Wang L. The stimulatory effects of eNOS/F92A-Cav1 on NO production and angiogenesis in BMSCs. Biomed Pharmacother 2016; 77:7-13 15. Lee S, Choi E, Cha MJ, Hwang KC. Cell adhesion and long-term survival of transplanted mesenchymal stem cells: a prerequisite for cell therapy. Oxid Med Cell Longev 2015; 2015:632902 16. Hood ED, Greineder CF, Dodia C, Han J, Mesaros C, 
+Shuvaev VV, Blair IA, Fisher AB, Muzykantov VR. 
+
+Antioxidant protection by PECAM-targeted delivery of a novel NADPH-oxidase inhibitor to the endothelium in vitro and in vivo. J Control Release 2012;163:161-169 17. Lincoln TM, Wu X, Sellak H, Dey N, Choi CS. Regulation of vascular smooth muscle cell phenotype by cyclic GMP and cyclic GMP-dependent protein kinase. Front Biosci 2006;11:356-367 18. Ko CY, Chang WC, Wang JM. Biological roles of CCAAT/Enhancer-binding protein delta during inflammation. J Biomed Sci 2015;22:6 19. Feinberg MW, Cao Z, Wara AK, Lebedeva MA, Senbanerjee S, Jain MK. Kruppel-like factor 4 is a mediator of proinflammatory signaling in macrophages. J Biol Chem 2005; 280:38247-38258 20. Autieri MV. Kruppel-like factor 4: transcriptional regulator of proliferation, or inflammation, or differentiation, or all three? Circ Res 2008;102:1455-1457 21. Huang S, Chen P, Shui X, He Y, Wang H, Zheng J, Zhang L, Li J, Xue Y, Chen C, Lei W. Baicalin attenuates transforming growth factor-β1-induced human pulmonary artery smooth muscle cell proliferation and phenotypic switch by inhibiting hypoxia inducible factor-1α and aryl hydrocarbon receptor expression. J Pharm Pharmacol 2014; 66:1469-1477 22. Iwasaki Y, Suganami T, Hachiya R, Shirakawa I, Kim-Saijo M, Tanaka M, Hamaguchi M, Takai-Igarashi T, Nakai M, Miyamoto Y, Ogawa Y. Activating transcription factor 4 links metabolic stress to interleukin-6 expression in macrophages. Diabetes 2014;63:152-161 23. Belhaj A, Dewachter L, Kerbaul F, Brimioulle S, 
+Dewachter C, Naeije R, Rondelet B. Heme oxygenase-1 and inflammation in experimental right ventricular failure on prolonged overcirculation-induced pulmonary hypertension. PLoS One 2013;8:e69470 24. Tamosiuniene R, Manouvakhova O, Mesange P, Saito T, 
+Qian J, Sanyal M, Lin YC, Nguyen LP, Luria A, Tu AB, Sante JM, Rabinovitch M, Fitzgerald DJ, Graham BB, 
+Habtezion A, Voelkel NF, Aurelian L, Nicolls MR. 
+
+Dominant role for regulatory T cells in protecting females against pulmonary hypertension. Circ Res 2018;122:16891702 25. Hill MR, Papafili A, Booth H, Lawson P, Hubner M, 
+Beynon H, Read C, Lindahl G, Marshall RP, McAnulty RJ, 
+Laurent GJ. Functional prostaglandin-endoperoxide synthase 2 polymorphism predicts poor outcome in sarcoidosis. Am J Respir Crit Care Med 2006;174:915-922 26. Peroni JF, Borjesson DL. Anti-inflammatory and immunomodulatory activities of stem cells. Vet Clin North Am Equine Pract 2011;27:351-362 27. Lee H, Lee JC, Kwon JH, Kim KC, Cho MS, Yang YS, Oh W, Choi SJ, Seo ES, Lee SJ, Wang TJ, Hong YM. The effect of umbilical cord blood derived mesenchymal stem cells in monocrotaline-induced pulmonary artery hypertension rats. 
+
+J Korean Med Sci 2015;30:576-585 28. Vaillancourt M, Ruffenach G, Meloche J, Bonnet S. 
+
+Adaptation and remodelling of the pulmonary circulation in pulmonary hypertension. Can J Cardiol 2015;31:407-415 29. Kumar R, Mickael C, Kassa B, Gebreab L, Robinson JC, 
+Koyanagi DE, Sanders L, Barthel L, Meadows C, Fox D, 
+Irwin D, Li M, McKeon BA, Riddle S, Dale Brown R, 
+Morgan LE, Evans CM, Hernandez-Saavedra D, Bandeira A, Maloney JP, Bull TM, Janssen WJ, Stenmark KR, Tuder RM, Graham BB. TGF-β activation by bone marrow-derived thrombospondin-1 causes Schistosoma- and hypoxia-induced pulmonary hypertension. Nat Commun 2017;8: 
+15494 30. Takahashi M, Hayashi K, Yoshida K, Ohkawa Y, 
+Komurasaki T, Kitabatake A, Ogawa A, Nishida W, Yano M, Monden M, Sobue K. Epiregulin as a major autocrine/paracrine factor released from ERK- and p38MAPKactivated vascular smooth muscle cells. Circulation 2003; 108:2524-2529 31. Salmon M, Gomez D, Greene E, Shankman L, Owens GK. 
+
+Cooperative binding of KLF4, pELK-1, and HDAC2 to a G/C repressor element in the SM22α promoter mediates transcriptional silencing during SMC phenotypic switching in vivo. Circ Res 2012;111:685-696 32. Chen H. Role of thromboxane A2 signaling in endothelium-dependent contractions of arteries. Prostaglandins Other Lipid Mediat 2018;134:32-37 33. Diehl KJ, Stauffer BL, Dow CA, Bammert TD, Brunjes DL, Greiner JJ, DeSouza CA. Chronic nebivolol treatment suppresses endothelin-1-mediated vasoconstrictor tone in adults with elevated blood pressure. Hypertension 2016;67: 
+1196-1204

medical/md/PMC6446072.md

@@ -0,0 +1,425 @@
+
+
+![0_image_0.png](0_image_0.png)
+
+![0_image_5.png](0_image_5.png)
+
+journal homepage: www.elsevier.com/locate/conctc
+
+## Abstract 1. Introduction
+
+Cohort profile of the PRoteomic Evaluation and Discovery in an IBD Cohort
+
+![0_image_1.png](0_image_1.png)
+
+of Tri-service Subjects (PREDICTS) study: Rationale, organization, design, and baseline characteristics Chad K. Portera,∗,1, Mark S. Riddlea,∗∗,1, Ramiro L. Gutierreza, Fred Princenb, Rick Straussc, Shannon E. Telescoc, Joana Torresd, Rok Seon Chounge, Renee M. Lairda, Francisco Leonc, Jean-Frédéric Colombeld,2, Joseph A. Murraye,2, PREDICTS study team a Enteric Diseases Department, Naval Medical Research Center, Silver Spring, MD, USA
+b Prometheus Laboratories Inc, San Diego, CA, USA
+c Janssen Research & Development, Spring House, PA, USA d Department of Medicine, Division of Gastroenterology, Icahn School of Medicine, New York, USA e Division of Gastroenterology and Hepatology, Mayo Clinic, Rochester, MN, USA
+Purpose: The etiology of Inflammatory Bowel Disease (IBD) remains currently unknown but evidence would suggest that it results from a complex interplay between genetic susceptibility genes, the intestinal microbiome and the environment, resulting in an increased response towards microbial and self-antigens, followed by the development of pre-clinical intestinal inflammation as a precursor to overt clinical disease. Efforts are needed to provide insights into the characterization of the disease, the possible prediction of complications, and the detection of a preclinical disease state where, through early screening and intervention, disease course can be reversed, attenuated or even prevented. A consortium of academic, industry and governmental organization investigators initiated this study to enable an assessment of pre-disease biomarkers in patients newly diagnosed with Crohn's disease (CD) and ulcerative colitis (UC). Participants: A retrospective cohort of 1000 UC and 1000 CD cases with 500 matched controls was drawn from an active duty US military personnel population with relevant inclusion criteria with three associated pre-disease and a single disease-associated archived serum samples.
+
+Findings to date: The PREDICTS study has been established as a biorepository platform study to perform novel discovery and analysis efforts in the field of IBD and proteomic systems biology. Future plans: This study is poised to enable the assessment of novel biomarkers within the serum compartment to be analyzed with the goal of identifying pre-disease signals that ultimately predict disease risk, and further elucidate disease pathogenesis in the early stages of the disease process, and identify novel exposures that increase disease risk.
+
+chronic disease courses, variability in disease severity and diversity in clinical manifestations including abdominal pain, diarrhea, hematochezia, weight loss, profound fatigue and frequent occurrence of serious intestinal and systemic disease complications, often leading to surgery and irreversible bowel damage. Consequently, IBD has a major impact on quality of life [7,8]. Disability attributed to IBD further increases the economic burden associated with these diseases, especially when it leads to partial or total unemployment in young people [9].
+
+Inflammatory bowel diseases (IBD), including Crohn's disease (CD)
+and ulcerative colitis (UC), are chronic relapsing and remitting diseases, principally appearing in young adults, with peak onset between the ages of 15 and 30 years [1,2]. They are prominent in most developed countries, but it is becoming a global health problem as rising incidence is being observed in the developing world [3]. Incidence ranges in the United States (US) from approximately 2 to 15 cases per 100,000 person-years and rising for both forms with an estimated prevalence of 3.1 million [4–6]. Both types of IBD are clinically characterized by
+∗ Corresponding author. Naval Medical Research Center, Silver Spring, MD, 20910, USA.
+
+∗∗ Corresponding author. Naval Medical Research Center, Silver Spring, MD, 20910, USA.
+
+E-mail addresses: chad.k.porter2.civ@mail.mil (C.K. Porter), markriddlemd@gmail.com (M.S. Riddle). 1 First authors contributed equally to this work.
+
+2 Co-senior authors.
+
+https://doi.org/10.1016/j.conctc.2019.100345 Received 23 July 2018; Received in revised form 20 February 2019; Accepted 8 March 2019 Available online 26 March 2019 2451-8654/ Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
+
+Contents lists available at ScienceDirect
+
+![0_image_4.png](0_image_4.png)
+
+Contemporary Clinical Trials Communications
+
+![0_image_2.png](0_image_2.png)
+
+![0_image_3.png](0_image_3.png)
+
+## 2. Study Rationale
+
+Basic research in IBD during the last few years has made significant advances in unveiling genetic loci of susceptibility, [10,11] revealing fundamental insights into enteric microbiota structures and their interaction with the innate and adaptive immune systems, [12] as well as discovering novel functions for and the regulation of previously recognized innate immune cells [13]. Additional research efforts have been initiated to predict treatment outcome, [14,15] and define risk stratification for disease progression in addition to shedding light on potential environmental triggers and their role in initiating post-infectious functional gastrointestinal disorders such as irritable bowel syndrome and IBD [16–20].
+
+Despite such achievements in improving the understanding of IBD,
+and in part due to such advancements, several challenges and opportunities in IBD research remain [21]. These include: (1) identifying IBD
+patient subsets using 'omics' to predict aggressiveness of disease, complications, and response to treatment; understanding how environmental factors enhance the risk of IBD; (2) determining which environmental triggers initiate, perpetuate, and/or reactivate disease; and (3) exploration of the reciprocal interactions and functional pathways that lead to homeostasis versus inflammation with an ultimate goal of identifying novel disease interception strategies. The concept of disease interception from chronic immune-associated diseases is an emerging paradigm in chronic disease management where at-risk individuals are identified in a pre-disease state, or the window of time preceding clinical diagnosis and symptoms during which pathological molecular changes can be detected, and interventions can be targeted to prevent the overt irreversible damage that are associated with the disease process [22]. Overcoming these recognized challenges requires resources and unique settings whereby serial biospecimens can be obtained from incident IBD patients and in which data and biospecimens are available before disease onset and following treatment.
+
+US military personnel constitute a large cohort of young healthy people particularly affected by IBD [19,23]. Unique to this population is an integrated database which links medical, deployment, and other exposure data, in addition to a serum repository which includes predisease and interval serum samples that are collected as part of a longstanding and ongoing HIV surveillance program [24]. Such a setting provides an opportunity to implement a systems proteomic approach to address critical discovery and translational research gaps in a wellcharacterized population. Coupled with the availability of this unique population data and sample resource, scientific and technologic innovation in recent years has led to high-throughput methodologies exploring proteomic measurements in complex biological systems [25].
+
+As a consequence, primary discovery endeavors have been built upon and expanded beyond the reductionist approach to the "holistic" approach of comprehensively examining the globally interacting elements of biological systems [26]. The development of this systems approach has become an impetus for research by which large amounts of data are amassed, analyzed, and applied to complex questions of biology that were previously unsolvable. While another IBD pre-disease cohort study has initiated, [27] it is among genetically high risk individuals (firstdegree relatives), and the population in our study represents an opportunity to understand disease processes and biomarkers of risk in a broader, more general population. However, there are some potential limitations given the demographics of this study population.
+
+Thus, the alignment of emerging technologies and the unique data and specimen repository, led to a multinational, academic, industry and governmental partnership entitled "PRoteomic Evaluation and Discovery in an IBD Cohort of Tri-service Subjects (PREDICTS)" study to join resources and expertise on which novel discovery and translational research could be built. Furthermore, this partnership was built with the understanding that it represents a unique resource from which others, outside the founding partnership, could benefit and thus the study and opportunity is further described.
+
+ 
+
+## 3. Cohort Desciption 3.1. Study Design And Participants
+
+This is a nested case-control study of subjects with incident IBD (UC
+and CD). Two-thousand IBD cases (1000 each with CD or UC) and 500 healthy controls were identified from the Defense Medical Surveillance System (DMSS). This is the main data repository for all US armed forces and contains relevant data from just over 10 million members having served in the armed forces since 1990, documenting their military and medical experiences throughout their career [28,29]. Subjects included in this study were active duty US military personnel. Our data (extracted from the DMSS) are limited to the years 1998–2013 (limited to 1998–2011 for CD).
+
+## 3.2. Case Selection
+
+All selected cases had two or more medical encounters with an ICD9 code for CD [555.0, 555.1 and 555.9 (including all subgroup codes)]
+or UC [556 (including all subgroup codes)] and available serum from the time of IBD diagnosis ( ± 1 year) and from the preceding sampling points as per Fig. 1. Given that more than 1000 CD and UC cases were present in the database, we created an algorithm for case selection based on criteria as follows:
+
+1) ≥ 2 medical encounters with an ICD-9 code for IBD;
+
+![1_image_0.png](1_image_0.png)
+
+2) Available serum from the time of IBD diagnosis ( ± 1 year) and from the preceding sampling points for that subject, 2, 4 and 6 + years before; 3) ≥ 1 medical encounters with a CPT code (45330-4, 45338, 45378, 45379, 45382, 45384, 45385) for lower gastrointestinal endoscopic procedure preceding ≥ 1 medical encounter with an ICD-9 code for IBD; and 4) Lack of medical encounters with an ICD-9 code for alternative form of IBD (e.g. if UC case, minimizing CD code visits)
+a. No medical encounters with alternative IBD ICD-9 code b. ≤ 2 medical encounters with alternative IBD ICD-9 code
+ 
+At a minimum, all subjects met criteria 1 and 2 above; however, preferential inclusion was given to subjects meeting criteria 3 and 4.
+
+The following algorithm outlines the order in which subjects were selected: 1,2,3,4a > 1,2,3,4b > 1,2,3 > 1,2.
+
+## 3.3. Control Selection
+
+Controls were matched on age, gender, race and timing of Sample A
+( ± 1 year) to UC cases. Control subjects were required to have no medical encounter evidence of Crohn's Disease [ICD9-CM: 555.0, 555.1, 555.9 (including all subgroup codes)], ulcerative colitis [ICD9-CM: 556 (including all subgroup codes)], rheumatoid arthritis (ICD9-CM: 714.0),
+celiac disease (ICD9-CM: 579.0) or colorectal cancer (ICD9-CM:
+153.0–154.1).
+
+## 3.4. Clinical And Covariate Data
+
+Subjects for this study were identified from the DMSS from 1998 to 2013 (CD cases limited to 1998–2011). Medical encounter data were obtained from ambulatory and inpatient claims data for care obtained within the Military Health Services and the Tri-Service Reportable Events System data (Table 1). Demographic information including age, gender, race, education level, rank, marital status, and branch of service were obtained from personnel data records. Deployment data were derived from deployment rosters and deployment health assessments. All medical encounters with an IBD diagnosis at any diagnostic position were obtained from Armed Forces Health Surveillance Branch (AFHSB).
+
+Medical encounters associated with a procedural code for colonoscopy
+(CPT codes shown in Table 1) were also obtained. Infectious gastroenteritis (IGE), determined from ICD-9 codes for specific bacterial and viral pathogens, were also obtained (Table 1). All ICD-9 and CPT codes assigned in IBD-related medical encounters were also available, and allowed assessment of surgery rates, or other disease-associated complications. In an effort to assess exposures unique to this military population, deployment history was obtained to include the name of the operational deployment, duration of deployment and timing of
+
+## Table 1
+
+List of variables available for study.
+
+All IBD Visits [CD - ICD9-CM: 555.0, 555.1 and 555.9 (including all subgroup codes)
+or UC [ICD9-CM: 556 (including all subgroup codes)] medical encounters Date of medical encounter All ICD-9 codes affiliated with medical encounter Visit type (e.g., inpatient or outpatient)
+All IBS (ICD9-CM: 564.1), or IGE (ICD9-CM: 001 [all subgroups], 003.0, 003.9, 004
+[all subgroups], 008.0, 008.43, 008.44, 008.8, 005.4, 008.47, 008.49, 008.5, 009.0–3, 005.8, 005.9, 006.0, 006.1, 006.2, 006.9, 007 [all subgroups], 008.6
+[all subgroups]) medical encounters prior and subsequent to initial IBD diagnosis Date of medical encounter All ICD-9 codes affiliated with medical encounter Visit type (e.g., inpatient or outpatient)
+All medical encounters in which a procedural code for colonoscopy was utilized Date of medical encounter All ICD-9 and CPT codes affiliated with medical encounter Visit type (e.g., inpatient or outpatient)
+All operational deployments Date of deployment Duration of deployment Operation Demographic Variables Year of birth Gender Race Education level Military Rank Marital status Branch of service deployment relative to disease onset. No information on smoking status, family history, medications, pathological results, radiographic studies, and/or clinical laboratory results was available.
+
+## 3.5. Serum Sampling
+
+For each IBD case and healthy control (HC), up to four serum samples were obtained from the DoD serum repository. Sample A was the first sample available following the initial medical encounter in which an IBD diagnosis was made (Fig. 1). In the absence of this sample, the last sample prior to that medical encounter was selected.
+
+Samples B and C represent the serum samples stored from the three preceding biennial (e.g. every two years) HIV screening test. In the absence of available serum, efforts were made to approximate two year intervals between serum samples. Sample A from HC subjects (frequency matched on age, race, gender and time) were matched to Sample A from UC cases based on year of collection ( ± 1 year). Samples B and C represented samples obtained approximately two and four years prior to Sample A, respectively, without specific year-matching to the case samples. Sample D represented the earliest serum sample available in the repository. Serum samples were obtained in aliquots of 0.5 mL (from original 2.5 mL patient sample) for each subject and timepoint and labeled with a unique identifier which described both individual and sample timepoint. Serum at the DoD Serum Repository was archived at −30 °C, and upon transfer to the Naval Medical Research Center is held at −80 °C with continuous monitoring.
+
+## 3.6. Biorepository Description
+
+A centralized repository was established to collect, process, store, and distribute biospecimens and data to support scientific investigation.
+
+Accessions of samples were recorded as having arrived and maintained by unique sample ID. Upon thawing and sub-aliquoting a laboratory information management system is used to barcode each 'daughter' sample which links to the parent sample. Information on sample data and arrival are maintained. Parallel to the sample accession and archive system, data on subjects (e.g. demographics, diagnosis, deployments, and procedures) are received, curated and housed in a limited access central repository which maintains data integrity and links to specimen identification.
+
+Processing of samples (subaliquoting) was initially performed manually to minimize repetitive freeze-thaws and subsequently transitioned to an automated process to minimize variations in sample handling. For each serum testing request and analysis plan, the parent serum is thawed once and multiple daughter aliquots are made which meet the volume requirement of the planned testing as well as anticipating future testing of retained daughter aliquots. Daughter samples are either immediately shipped if testing is to commence upon first thaw, or refrozen and sent to partner laboratories. Daughter samples are contained in bar-code labeled cryovials with a desiccation proof seal. No additives are used in the aliquoting and storage processes.
+
+All samples are held at the Naval Medical Research Center prior to being requested via a distribution request. The inventory system is composed of sample holding boxes and the boxes are stored in monitored freezers at −80 °C. Accompanying data associated with samples are archived in a master database from which analytic subsets are generated. The process of requesting specimens and data from the repository are later described.
+
+## 3.7. Sample Size And Statistical Analysis
+
+This study was designed to evaluate up to 1000 cases each of UC and CD, and 500 controls [age-, gender-, race -and time-frequency matched to the UC cases] with considerations of power to detect a significant difference in a single serologic marker being predicated on the seroprevalence of that marker in cases and controls through utilization of a variety of statistical techniques including traditional bivariate and multivariate analysis, as well as cluster analysis, ordination methods, and machine learning techniques. Given the exploratory nature of this study, we estimated that the proposed sample size would have over an 80% power to identify a significant difference in the presence of a single marker in cases and controls if the biomarker is present in as few as 10% of the cases with a seropositivity rate twice as in the control subjects (2-group continuity-adjusted chi-square test with two-sided alpha = 0.05). Additionally, among IBD cases, a single group repeated measures analysis of variance (alpha = 0.05) would have an 80% power to detect a change in specific parameter characterized by an effect size
+(an index of the separation expected between the observed means based on mean variance within and across subjects) of 0.0027. It was further anticipated that adjustments for multiple comparisons will be needed to control the Type I error rate which may yield a lower overall statistical power. Given the utilization of network analyses to maximize the probability of identifying statistical data patterns, it is anticipated that this study is powered adequately to identify significant differences in serum profiles across the study populations assuming there are in fact differences in the studied groups. Precise statistical methods and models to be used will be unique for each research objective; however, a general strategy has been proposed to include testing and evaluation on parallel subsets with validation on an independent subset.
+
+## 3.8. Baseline Description Of The Cohort
+
+The demographics of the PREDICTS population are outlined in Table 2 and, in general, are reflective of the active duty US military population. Specifically, the majority of IBD subjects and healthy
+
+| Demographics of PREDICTS study population. Crohn's disease Ulcerative colitis   | Healthy controls   |       |     |       |     |       |
+|---------------------------------------------------------------------------------|--------------------|-------|-----|-------|-----|-------|
+| N                                                                               | %                  | N     | %   | N     | %   |       |
+| Gender Male                                                                     | 822                | 82.2% | 828 | 82.8% | 460 | 92.0% |
+| Female                                                                          | 178                | 17.8% | 172 | 17.2% | 40  | 8.0%  |
+| Age 20-29                                                                       | 445                | 44.5% | 427 | 42.7% | 210 | 42.0% |
+| 30-39                                                                           | 409                | 32.8% | 411 | 35.5% | 218 | 35.5% |
+| 40-49                                                                           | 135                | 14.5% | 147 | 16.7% | 71  | 15.8% |
+| > =50                                                                           | 11                 | 1.2%  | 15  | 1.6%  | 1   | 0.2%  |
+| Education High school (or                                                       | 691                | 69.1% | 586 | 58.6% | 324 | 64.8% |
+| equivalent) Some college                                                        | 92                 | 9.2%  | 134 | 13.4% | 52  | 10.4% |
+| College                                                                         | 120                | 12.0% | 181 | 18.1% | 77  | 15.4% |
+| Advanced degree                                                                 | 75                 | 7.5%  | 75  | 7.5%  | 36  | 7.2%  |
+| Unknown                                                                         | 22                 | 2.2%  | 24  | 2.4%  | 11  | 2.2%  |
+| Marital status Married                                                          | 77                 | na    | 713 | 71.3% | 369 | 73.8% |
+| Single/Other                                                                    | 23                 | na    | 287 | 28.7% | 131 | 26.2% |
+| Military Rank Jr. Enlisted                                                      | 185                | 18.5% | 140 | 14.0% | 70  | 14.0% |
+| Sr. Enlisted                                                                    | 636                | 63.6% | 614 | 61.4% | 318 | 63.6% |
+| Officer                                                                         | 179                | 17.9% | 246 | 24.6% | 112 | 22.4% |
+| Branch of Service Army                                                          | na                 | na    | 324 | 32.4% | 161 | 32.2% |
+| Air Force                                                                       | na                 | na    | 263 | 26.3% | 114 | 22.8% |
+| Marines                                                                         | na                 | na    | 109 | 10.9% | 52  | 10.4% |
+| Navy/Coast Guard                                                                | na                 | na    | 304 | 30.4% | 173 | 34.6% |
+| Race/Ethnicity White                                                            | 696                | 69.6% | 781 | 78.1% | 414 | 82.8% |
+| Black                                                                           | 156                | 15.6% | 171 | 17.1% | 71  | 14.2% |
+| Other                                                                           | 148                | 14.8% | 48  | 4.8%  | 15  | 3.0%  |
+| Deployments Deployed                                                            | 628                | 69.1% | 738 | 77.1% | 390 | 81.9% |
+| Not deployed                                                                    | 372                | 33.1% | 262 | 25.0% | 110 | 21.4% |
+| na = not available at time of publication.                                      |                    |       |     |       |     |       |
+
+ 
+controls are male (82.5% and 92.0%, respectively) with no significant differences in IBD pathotypes (p = 0.7); however, control subjects are more predominantly male (p < 0.001). There are no significant differences in the age distribution of subjects (p = 0.5) with 84.8% under the age of 40 across all groups. As expected, less than 25% of the subjects are officers with a slightly higher proportion of enlisted personnel in the CD (82.1%) compared to UC (75.4%; p < 0.001) or HC
+cohorts (77.6%; p = 0.04). Approximately 70% of the CD subjects are classified as white, which is lower than UC (78.1%; p < 0.001) or HC
+subjects (82.8%; p < 0.001). The majority of subjects across all disease states had at least one operational deployment prior to the initial disease diagnosis (CD or UC) or matching HC. As shown in Fig. 3, incident cases (and HCs) were identified across the entire study period.
+
+## 4. Findings To Date
+
+As shown in Fig. 4, disease-associated samples from CD and UC
+subjects were obtained a median of 145 (interquartile range (IQR): 16, 311) and 3 (IQR: −100, 230) days from the incident IBD diagnosis, respectively. All control samples were obtained at the time of censoring.
+
+Antecedent samples for CD were obtained at a median of 1.6 (IQR: 0.8, 2.0), 4.0, (3.6, 6.1) and 6.0 (5.6, 8.0) years prior to the initial medical encounter with the CD-associated ICD-CM encounter. Similar samples for the UC subjects were obtained at a median of 2.0 (IQR: 1.6, 2.3), 4.0, (IQR: 3.6, 4.4) and 9.5 (IQR: 6.7, 13.3) years prior to the incident diagnosis.
+
+As shown in Table 3, among the CD cases, just over 50% of the subjects had evidence within the DMSS of being seen in a gastroenterology clinic concurrent with any CD-associated medical encounter.
+
+Gastroenterologist associated visits obtained outside of the Military Health System, which occurs commonly in areas that do not have specialist availability, lacked visit specification in the database. This proportion was significantly higher in the UC cases (%,
+p < 0.001).73.4%). Depending on IBD subtype, 11–15% of subjects had at least one inpatient IBD-related medical encounter (CD: 36.0%, UC: 26.6%) with a median of one inpatient encounter for each admitted subject. Procedural and ICD-9-CM-based codes for endoscopy highlight a significant difference in the prevalence of these procedures being documented in the DMSS with a significantly higher proportion of UC
+subjects (68.1%, p < 0.001)) with at least one concurrent endoscopy compared to CD subjects (36.8%). Throughout the medical encounter history, CD and UC subjects often received multiple visit-associated sub-codes. While the most common CD sub-code was 'regional enteritis, unspecified site' documented in just over 85% of subjects, small and large intestine sub-codes were also documented in 42.5% and 41.8% of subjects, respectively. Additionally, a small proportion of CD subjects received UC co-diagnoses during their IBD workup. Similarly to CD, UC
+subjects received a spectrum of UC-specific sub-codes, the most common being 'ulcerative colitis, unspecified' documented in 87.3% of the UC cases and identified in a median of 7 (IQR: 3, 16) separate encounters for each subject with that sub-code. Other sub-codes such as
+'universal ulcerative colitis' (40.1%), 'ulcerative proctitis' (30.6%) and
+'left-sided ulcerative colitis' (24.6%) were also common. Additional data to assist in classification of standard phenotype of disease severity based on disease location and behavior, and history of surgery are also available in the repository (data not shown).
+
+In addition to the IBD-related medical encounters, subjects received ICD-9-CM codes associated with other diseases concurrent with all preand post-diagnosis IBD-related medical encounters (Table 4). The most common co-diagnoses were diseases of the digestive system (occurring in 58.9% of the CD cases and 63.0% of the UC cases) and symptoms, signs and ill-defined conditions (occurring in 53.9% of CD cases and 55.4% of the UC cases) with no significant difference in the proportion of cases (p = 0.5 and 0.06, respectively). ICD-9-CM codes for diseases of the digestive system were assigned on a total of over 2500 (CD: 2714; UC: 2555) separate IBD-related encounters for a median of three
+ 
+
+| Table 3 Additional information related to medical CD- or UC-associated medical encounters. N (%) with CD/UC-associated medical encounters   | Median (IQR) visits per subject   |            |           |           |
+|---------------------------------------------------------------------------------------------------------------------------------------------|-----------------------------------|------------|-----------|-----------|
+| CD                                                                                                                                          | UC                                | CD         | UC        |           |
+| Gastroenterology clinic                                                                                                                     | 555 (55.5)                        | 734 (73.4) | 4 (2, 9)  | 5 (2, 9)  |
+| Inpatient encounter                                                                                                                         | 360 (36.0)                        | 266 (26.6) | 1 (1, 2)  | 1 (1, 2)  |
+| Endoscopy                                                                                                                                   | 368 (36.8)                        | 681 (68.1) | 1 (1, 2)  | 2 (1, 2)  |
+| Regional enteritis, small intestine                                                                                                         | 425 (42.5)                        | 0 (0.0)    | 3 (1, 6)  | -         |
+| Regional enteritis, large intestine                                                                                                         | 418 (41.8)                        | 1 (0.1)    | 2 (1, 5)  | 1 (1, 1)  |
+| Regional enteritis, small/large intestine                                                                                                   | 218 (21.8)                        | 0 (0.0)    | 2 (1, 4)  | -         |
+| Regional enteritis, unspecified site                                                                                                        | 866 (86.6)                        | 2 (0.2)    | 6 (2, 14) | 1 (1, 1)  |
+| Ulcerative enterocolitis                                                                                                                    | 0 (0.0)                           | 0 (0.0)    | -         | -         |
+| Ulcerative ileocolitis                                                                                                                      | 2 (0.2)                           | 41 (4.1)   | 2 (1, 2)  | 1 (1, 2)  |
+| Ulcerative proctitis                                                                                                                        | 6 (0.6)                           | 306 (30.6) | 2 (1, 2)  | 3 (1, 6)  |
+| Ulcerative proctosigmoiditis                                                                                                                | 3 (0.3)                           | 165 (16.5) | 1 (1, 1)  | 2 (1, 4)  |
+| Pseudopolyposis colon                                                                                                                       | 14 (1.4)                          | 34 (3.4)   | 1 (1, 1)  | 1 (1, 2)  |
+| Left-sided ulcerative colitis                                                                                                               | 1 (0.1)                           | 246 (24.6) | 1 (1, 1)  | 2 (1, 4)  |
+| Universal ulcerative colitis                                                                                                                | 13 (1.3)                          | 401 (40.1) | 1 (1, 2)  | 3 (1, 7)  |
+| Other ulcerative colitis                                                                                                                    | 5 (0.5)                           | 281 (28.1) | 1 (1, 1)  | 2 (1, 3)  |
+| Ulcerative colitis, unspecified                                                                                                             | 33 (3.3)                          | 873 (87.3) | 1 (1, 1)  | 7 (3, 16) |
+| Intestinal resectiona                                                                                                                       | 70 (7.0)                          | 54 (5.4)   | 2 (1, 4)  | 3 (2, 9)  |
+| Infusion procedure (biological)b                                                                                                            | 25 (2.5)                          | 0 (0.0)    | 1 (1, 1)  | -         |
+
+encounters per CD case (IQR: 1, 6) and two for each UC case (IQR: 1, 5). Diseases of the musculoskeletal system and connective tissue were also common among cases (CD: 25.7%, UC: 30.5%) with a median of two visits per case. Diseases of the circulatory system were more common among UC cases (25.2%) than CD cases (17.6%), as were endocrine, nutritional and metabolic diseases and immunity (p < 0.001 and p = 0.002, respectively). Among the HC subjects, the most commonly identify medical encounters were similar to the co-diagnosed conditions among the IBD cases with symptoms, signs and ill-defined conditions being most common (44.2%) followed by mental disorders (28.4%) and diseases of the digestive system (17.6%). The median IBD related medical follow-up following incident diagnosis was 373 days (IQR: 151, 977) and 852 days (IQR: 350, 1967) for CD and UC, respectively.
+
+## 5. Discussion 5
+
+Herein we have described a large cohort of active duty US military personnel with incident Crohn's disease or ulcerative colitis along with matched healthy control subjects in which serum samples have been periodically collected prior to and immediately after IBD onset. This cohort study, called PREDICTS, is designed as a platform study that may revolutionize our understanding of IBD pathoetiology and facilitate movement toward individualized medicine and disease risk prediction and ultimately prevention [22,30,31]. Ongoing serologic assays include those focused on unique proteomic markers, serologic evidence of infectious exposures, cytokine profiles and responses to commensal intestinal microbiota will serve to generate new hypotheses for future in and ex vivo IBD research [16]. We recognize that other cohort studies
+
+| ICD-9-CM codes corresponding with IBD-related medical encounters and all HC-associated encounters. ICD-9-CM description ICD-9-CM code Number (%) of subjects with co-Diagnoses   | Total number, median (IQR) of separate medical encounters   |             |             |            |               |                |             |
+|----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|-------------------------------------------------------------|-------------|-------------|------------|---------------|----------------|-------------|
+| CD                                                                                                                                                                               | UC                                                          | HC          | CD          | UC         | HC            |                |             |
+| Infectious and parasitic diseases                                                                                                                                                | 001–139                                                     | 120 (12.0)  | 145 (14.5)  | 61 (12.2)  | 2451 (1,2)    | 3401 (1, 3)    | 881 (1, 2)  |
+| Neoplasms                                                                                                                                                                        | 140–239                                                     | 77 (7.7)    | 158 (15.8)  | 26 (5.2)   | 1231 (1, 2)   | 2961 (1, 2)    | 811 (1, 2)  |
+| Endocrine, nutritional and metabolic diseases and                                                                                                                                | 240–279                                                     | 202 (20.2)  | 263 (26.3)  | 55 (11.0)  | 4822 (1, 3)   | 8442 (1, 4)    | 991 (1, 2)  |
+| immunity disorders                                                                                                                                                               |                                                             |             |             |            |               |                |             |
+| Diseases of the blood and blood forming organs                                                                                                                                   | 280–289                                                     | 155 (15.5)  | 206 (20.6)  | 29 (5.8)   | 4822 (1, 4)   | 7452 (1, 4)    | 1202 (1, 4) |
+| Mental disorders                                                                                                                                                                 | 290–319                                                     | 207 (20.7)  | 199 (19.9)  | 142 (28.4) | 6192 (1, 4)   | 6542 (1, 3)    | 8133 (1, 6) |
+| Diseases of the nervous system                                                                                                                                                   | 320–359                                                     | 99 (9.9)    | 119 (11.9)  | 19 (3.8)   | 2231 (1, 2)   | 2871 (1, 3)    | 221 (1, 1)  |
+| Diseases of the sense organs                                                                                                                                                     | 360–389                                                     | 47 (4.7)    | 88 (8.8)    | 11 (2.2)   | 691 (1, 2)    | 1441 (1, 1)    | 141 (1, 2)  |
+| Diseases of the circulatory system                                                                                                                                               | 390–459                                                     | 176 (17.6)  | 252 (25.2)  | 40 (8.0)   | 3671 (1, 2)   | 7482 (1, 3)    | 651 (1, 2)  |
+| Diseases of the respiratory system                                                                                                                                               | 460–519                                                     | 117 (11.7)  | 154 (15.4)  | 55 (11.0)  | 2191 (1, 2)   | 3001 (1, 2)    | 1181 (1, 2) |
+| Diseases of the digestive system                                                                                                                                                 | 520–579                                                     | 589 (58.9)a | 630 (63.0)b | 88 (17.6)  | 2714a 3 (1,6) | 2555b 2 (1, 5) | 1981 (1, 2) |
+| Diseases of the genitourinary system                                                                                                                                             | 580–629                                                     | 97 (9.7)    | 96 (9.6)    | 39 (7.8)   | 2071 (1, 2)   | 1721 (1, 2)    | 691 (1, 2)  |
+| Complications of pregnancy, childbirth and the                                                                                                                                   | 630–679                                                     | 17 (1.7)    | 23 (2.3)    | 10 (2.0)   | 1256 (4, 10)  | 1633 (2, 6)    | 303 (2, 4)  |
+| puerperium                                                                                                                                                                       |                                                             |             |             |            |               |                |             |
+| Diseases of the skin and subcutaneous tissue                                                                                                                                     | 680–709                                                     | 136 (13.6)  | 155 (15.5)  | 19 (3.8)   | 2331 (1, 2)   | 2981 (1, 2)    | 281 (1, 2)  |
+| Diseases of the musculoskeletal system and connective                                                                                                                            | 710–739                                                     | 257 (25.7)  | 305 (30.5)  | 73 (14.6)  | 7002 (1, 3)   | 9932 (1, 4)    | 1881 (1, 3) |
+| tissue                                                                                                                                                                           |                                                             |             |             |            |               |                |             |
+| Congenital anomalies                                                                                                                                                             | 740–759                                                     | 30 (3.0)    | 13 (1.3)    | 5 (1.0)    | 451 (1, 2)    | 181 (1, 2)     | 81 (1, 2)   |
+| Certain conditions originating in the perinatal period                                                                                                                           | 760–779                                                     | 2 (0.2)     | 1 (0.1)     | 0 (0.0)    | 21 (1, 1)     | 8 (-, -)       | 0 (-, -)    |
+| Symptoms, signs and ill-defined conditions                                                                                                                                       | 780–799                                                     | 539 (53.9)  | 554 (55.4)  | 221 (44.2) | 22152 (1, 5)  | 22982 (1, 5)   | 8392 (1, 4) |
+| Injury and poisoning                                                                                                                                                             | 800–999                                                     | 119 (11.9)  | 110 (11.0)  | 51 (10.2)  | 2521 (1, 2)   | 2191 (1, 2)    | 1081 (1, 2) |
+| a Does not include CD diagnoses. b Does not include UC diagnoses.                                                                                                                |                                                             |             |             |            |               |                |             |
+
+exist including the Nurses Health Study I and II, and the GEM (Genetics, Environmental, Microbial) Project that promise to provide unique opportunities to address current research gaps. However, the PREDICTS study is unique given the availability of multiple samples in the preclinical period and the opportunity this affords in discerning factors that are associated with initial triggers and progression of subclinical immuno-inflammatory processes, before overt disease has been established [22,32].
+
+This cohort of IBD patients represents a well-characterized group of subjects whose initial sample collections were obtained during periods of time in which the subjects were sufficiently healthy to actively serve in the US military. While these outcomes have not been validated by chart review, a significant proportion of both UC and CD cases have
+'confirmatory' medical encounter data that provide confidence in the diagnoses, such as codes associated with gastroenterology specialists visits and endoscopic procedures. It is important to note that the absence of these data does not reduce the likelihood of these being actual IBD cases. The primary reasons for missing 'confirmatory' data are likely multifactorial, and may include the absence of an available Department of Defense specialty clinic at the duty site and subsequent civilian care (specialist and endoscopy procedures) received which are not recorded into the DMSS, or simply incomplete or inaccurate records.
+
+We also fully recognize that an ideal study of this type would involve multiple specimen types including genetic, tissue biopsy, fecal and whole blood specimens in a prospectively designed study where detailed diagnostic, treatment, and exposure data would be collected. Such studies are underway and promise to yield high quality data on which similar hypotheses could be tested [33]. The limitation of this study to serum is recognized but does not preclude important and rigorous research possibilities. While genetics clearly play an important role in IBD, it only explains a proportion of IBD risk [34]. Poor correlation between the regulation of transcripts and actual protein quantities may confound associations between genetic polymorphisms disease likely due to the fact that genomic analysis does not account for post-translational processes such as protein modifications and protein degradation or epigenetic changes. Therefore, methods employed in the disease biomarker process have expanded to include proteomics which has allowed for interrogation of these systems indirectly through the serum compartment [35]. In addition, the readily accessible sample type (e.g., blood draw) may have practical considerations in the future development of clinically applicable screening and evaluation tools. In addition to lack of complementary specimen types, this study is limited by available medical and demographic data which are obtainable in the DMSS as well as the inability to link with medical encounter data upon discharge from Active Duty. Clinical laboratory data, endoscopic and histological data, pharmacy data, as well as smoking status and other behavioral risk factor information are unavailable. While other prospective studies of active duty military populations have included postdischarge follow-up data, the de-identified nature of PREDICTS precludes linking with those ongoing studies, and does not allow for prospectively following participants who may be beneficiaries in the Veteran Affairs system.
+
+Despite these limitations, the number of clinical cases, accessible clinical and exposure data in the data archive, as well as serial serum time points provide a robust platform to inform relevant gaps in our knowledge and understanding of IBD. At present, one study has been published from the PREDICTS study in which antimicrobial biomarkers tested many years prior to disease diagnosis were found to predict complicated disease phenotype at clinical presentation [16]. Efforts are underway to expand these initial findings. In addition, a variety of protein and antibody panels are currently being evaluated to explore additional aims of biomarker prevalence at clinical onset, biomarker conversion associated with disease onset, enteric infection and disease/
+biomarker conversion, novel disease biomarkers and pathogenesis, biomarker results compared to historical populations, demographic and
+ 
+deployment factors and association with disease biomarkers, as well as biomarkers predicting disease progression after diagnosis. The potential value and utility of PREDICTS has yet to be fully revealed, and we hope that through future collaborations, advances in technology, and accumulation of a data set rich in multiple biomarker results, and promises of advances in our understanding of IBD that translate into new solutions and practice changes will be fulfilled. Finally, with this initiative we feel that we have provided a blueprint for the creation of publicprivate pre-competitive partnerships to investigate disease triggers and lay the foundation for disease interception and prevention.
+
+## Collaboration
+
+- Participating Institutions: This study was conceived, developed and funded through a partnership between the Naval Medical Research Center (Silver Spring, MD, US), the Mayo Clinic (Rochester, MN, US), Prometheus Laboratories, Inc. (San Diego, CA, US), the Icahn School of Medicine at Mount Sinai (New York, NY, US) and Janssen Pharmaceuticals (Springhouse, PA, US).
+
+## Author Contributions
+
+Study concept and design: Mark S. Riddle, Chad K. Porter, Francisco Leon, Joseph. A. Murray, Fred Princen and Jean Frederic Colombel; Acquisition of data: Chad K. Porter, Ramiro L. Gutierrez, and Mark S.
+
+Riddle; Analysis and data interpretation: Mark S. Riddle, Chad K. Porter, Ramiro L. Gutierrez.
+
+Sample repository archiving: Renee M. Laird, Chad K. Porter. Drafting of manuscript: Mark S. Riddle, Chad K. Porter.
+
+Critical revision of manuscript for important intellectual content: Chad K. Porter, Mark S. Riddle, Ramiro L. Gutierrez, Fred Princen, Rick Strauss, Shannon E. Telesco, Joana Torres, Rok Seon Choung, Renee M. Laird, Jean Fred Colombel, Joseph A. Murray.
+
+Administrative, technical, or material support: Chad K. Porter, Ramiro L. Gutierrez, and Mark S. Riddle, Renee M. Laird.
+
+Study supervision: Mark S. Riddle, Joseph. A. Murray, Fred Princen, Rick Straus, and Jean-Frederic Colombel.
+
+## Conflicts Of Interest
+
+Dr Murray has received grant funding from Alba Therapeutics and Alvine Pharmaceuticals, Inc., has served on an advisory board for Alvine Pharmaceuticals, Inc., and has served as a consultant for AMAG
+Pharmaceuticals, BioLineRx, Glenmark, UCB Pharma, Takeda, Celimmune and GlaxoSmithKline. J-F Colombel has served as consultant or advisory board member for Abbvie, ABScience, Amgen, Bristol-Myers Squibb, Celltrion, Danone, Ferring, Genentech, Giuliani SPA, Given Imaging, Janssen, Immune Pharmaceuticals, Eli Lilly, Medimmune, Merck & Co., Millenium Pharmaceuticals Inc., Neovacs, Nutrition Science Partners Ltd., Pfizer Inc. Prometheus Laboratories, Protagonist, Receptos, Sanofi, Schering Plough Corporation, Second Genome, Shire, Takeda, Teva Pharmaceuticals, Tigenix, UCB Pharma, Vertex, Dr. August Wolff GmbH & Co. J-F Colombel has served as a speaker for Abbvie, Ferring, Janssen, Merck & Co., Nutrition Science Partners Ltd., Takeda. Joana Torres received consulting fees from Takeda and support from Abbvie to travel to conferences. Fred Princen, Thomas P. Stockfisch, and Sharat Singh are employees of Prometheus Laboratories. Francisco Leon was employee of Janssen R&D. The remaining author discloses no conflicts.
+
+Chad K. Porter, Ramiro L. Gutierrez, Renee Laird, Mark Riddle - The views expressed in this article are those of the author and do not necessarily reflect the official policy or position of the Department of the Navy, Department of Defense, nor the U.S. Government.
+
+Human Subjects Research and Data Protections: The human subjects' research protocols (NMRC.2012.0007 and NMRC.2014.0019)
+
+![6_image_0.png](6_image_0.png)
+
+under which the data and samples were obtained were approved as
+'Exempt' research by the Naval Medical Research Center Institutional Review Board in compliance with all applicable Federal regulations governing the protection of human subjects. In addition, this study is conducted under a support agreement with the AFHSB. All data are were de-identified by personnel at AFHSB who removed the list of 18 identifiers outlined in 45 CFR 164.514(b)(2) and DOD 6025.18-R (DoD
+Health Information Privacy Regulation) prior to providing the data to the investigators.
+
+## Study Governance
+
+This study is coordinated and executed through a Steering
+
+![6_image_2.png](6_image_2.png)
+
+Committee (SC) and supported by project management, regulatory, biospecimen and data archival support functions under a Navy Cooperative Research and Development Agreement (CRADA\# NMR-113920, Antimicrobial Antibodies as Predictors of Inflammatory Bowel Diseases) (Fig. 2). The primary function of the SC is to oversee research efforts conducted under the PREDICTS protocols and CRADA. The SC
+and PREDICTS Study is governed by a written charter (Supplemental Files) which includes specific guidance, policies and procedures for
+
+![6_image_1.png](6_image_1.png)
+
+handling data and serum utilization requests, publication and presentation clearance, data sharing, as well as appeal processes to handle disputes. In addition to managing these procedural functions, the SC
+reviews and monitors all research efforts and provides guidance and direction for future research. The SC provides a stabilizing influence among vested stakeholders so organizational concepts and directions are established and maintained with a mission-oriented view. The SC
+provides insight on long-term strategies in support of research objectives. Members of the SC ensure objectives are adequately addressed and projects remain under appropriate control and oversight. The SC is also charged with the responsibility of advocating for the Study and identifying new partnerships and opportunities.
+
+## Procedure For Application And Use Of Study Data And Additional Testing
+
+The SC welcomes submissions requesting the utilization of existing data and serum resources. A concept submission process involves four steps: 1) an invitation to develop and submit a Data Analysis Proposal
+(Supplemental Files) by one or more members of the SC; 2) submission of the Data Analysis Proposal and review by the SC; 3) Decision by SC
+on project (or request for modifications; 4) Proposal execution. Once a concept is approved upon review, the SC provides ongoing oversight to ensure applicability to the PREDICTS objectives, as well as regulatory, data sharing, publication, and intellectual property requirements. All results and data interpretation are reported to the SC and, if applicable, published in the peer reviewed literature.
+
+## Copyright Statement
+
+This work was prepared as part of the official duties of US
+Government personnel and service members (CKP, MSR, RLG). Title 17 U.S C. §105 provides that 'Copyright protection under this title is not available for any work of the United States Government.' Title 17 U.S C.
+
+§101 defines a U.S. Government work as a work prepared by a military service member or employee of the U.S. Government as part of that person's official duties.
+
+## Funding
+
+Funding and support of the PREDICTS study platform was provided through a Cooperative and Research Development Agreement with direct contributions by Janssen Pharmaceuticals, Prometheus Laboratories and the Naval Medical Research Center (NCRADA number NMR-11-3920).
+
+## Acknowledgements
+
+The authors would like to thank the staff at the Armed Forces Health Surveillance Branch for their assistance in compiling and providing the data and sera utilized for this study. Additionally, the authors would like to thank all the men and women in uniform who have dedicated their service and lives to our country and through the simple act of providing blood allow the potential for discoveries to help millions.
+
+We are indebted to the PREDICTS study team of program coordinators, data managers, affiliated scientists, and administrative support personnel for their tireless hours to ensure the success of this project. The PREDICTS study team: Christina Hill, Vicky Chapman, Ashley Alcala, Alex Maue (Naval Medical Research Center); Takihiro Soto, Joseph Russell, Scott Plevy, Carrie Brodmerkel (Janssen Pharmaceuticals); Bénédicte De Vroey, Corinne Gower-Rousseau (Center Hospitalier Régional Universitaire, Lille, France); Sharat Singh, Tharak Rao, Xiaojun Li (Prometheus Laboratories Inc), Francesca Petralia (Mount Sinai).
+
+## Appendix A. Supplementary Data
+
+Supplementary data related to this article can be found at https://
+doi.org/10.1016/j.conctc.2019.100345.
+
+## References
+
+[1] E.V. Loftus Jr., M.D. Silverstein, W.J. Sandborn, et al., Ulcerative colitis in Olmsted County, Minnesota, 1940-1993: incidence, prevalence, and survival, Gut 46 (2000)
+336–343.
+
+[2] S. Vermeire, G. van Assche, P. Rutgeerts, Review article: altering the natural history of Crohn's disease–evidence for and against current therapies, Aliment Pharmacol. Ther. 25 (2007) 3–12.
+
+[3] A.E. M'Koma, Inflammatory bowel disease: an expanding global health problem, Clin. Med. Insights Gastroenterol. 6 (2013) 33–47.
+
+[4] C.G. Loftus, E.V. Loftus Jr., W.S. Harmsen, et al., Update on the incidence and prevalence of Crohn's disease and ulcerative colitis in Olmsted County, Minnesota, 1940-2000, Inflamm. Bowel Dis. 13 (2007) 254–261.
+
+[5] N.A. Molodecky, I.S. Soon, D.M. Rabi, et al., Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review,
+ 
+Gastroenterology 142 (2012) 46–54 e42; quiz e30.
+
+[6] J.M. Dahlhamer, E.P. Zammitti, B.W. Ward, et al., Prevalence of inflammatory bowel disease among adults aged > /=18 Years - United States, 2015, MMWR
+Morb. Mortal. Wkly. Rep. 65 (2016) 1166–1169.
+
+[7] A.S. Russell, W.P. Gulliver, E.J. Irvine, et al., Quality of life in patients with immune-mediated inflammatory diseases, J. Rheumatol. Suppl. 88 (2011) 7–19.
+
+[8] M. van der Have, K.S. van der Aalst, A.A. Kaptein, et al., Determinants of healthrelated quality of life in Crohn's disease: a systematic review and meta-analysis, J.
+
+Crohns. Colitis 8 (2014) 93–106.
+
+[9] D.N. Floyd, S. Langham, H.C. Severac, et al., The economic and quality-of-life burden of Crohn's disease in Europe and the United States, 2000 to 2013: a systematic review, Dig. Dis. Sci. 60 (2015) 299–312.
+
+[10] L. Jostins, S. Ripke, R.K. Weersma, et al., Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease, Nature 491 (2012) 119–124.
+
+[11] M. Parkes, The genetics universe of Crohn's disease and ulcerative colitis, Dig. Dis.
+
+30 (Suppl 1) (2012) 78–81.
+
+[12] T. Magrone, E. Jirillo, The interplay between the gut immune system and microbiota in health and disease: nutraceutical intervention for restoring intestinal homeostasis, Curr. Pharmaceut. Des. 19 (2013) 1329–1342.
+
+[13] M. Scharl, G. Rogler, Inflammatory bowel disease: dysfunction of autophagy? Dig.
+
+Dis. 30 (Suppl 3) (2012) 12–19.
+
+[14] E.L. Barnes, R. Burakoff, New biomarkers for diagnosing inflammatory bowel disease and assessing treatment outcomes, Inflamm. Bowel Dis. 22 (12) (2016)
+2956–2965.
+
+[15] C.R. Heier, A.A. Fiorillo, E. Chaisson, et al., Identification of pathway-specific serum biomarkers of response to glucocorticoid and infliximab treatment in children with inflammatory bowel disease, Clin. Transl. Gastroenterol. 7 (2016) e192.
+
+[16] R.S. Choung, F. Princen, T.P. Stockfisch, et al., Serologic microbial associated markers can predict Crohn's disease behaviour years before disease diagnosis, Aliment Pharmacol. Ther. 43 (2016) 1300–1310.
+
+[17] M.C. Dubinsky, Y.C. Lin, D. Dutridge, et al., Serum immune responses predict rapid disease progression among children with Crohn's disease: immune responses predict disease progression, Am. J. Gastroenterol. 101 (2006) 360–367.
+
+[18] A. Zholudev, D. Zurakowski, W. Young, et al., Serologic testing with ANCA, ASCA,
+and anti-OmpC in children and young adults with Crohn's disease and ulcerative colitis: diagnostic value and correlation with disease phenotype, Am. J.
+
+Gastroenterol. 99 (2004) 2235–2241.
+
+[19] C.K. Porter, B.D. Cash, M. Pimentel, et al., Risk of inflammatory bowel disease following a diagnosis of irritable bowel syndrome, BMC Gastroenterol. 12
+(2012) 55.
+
+[20] E.F. Verdu, M.S. Riddle, Chronic gastrointestinal consequences of acute infectious diarrhea: evolving concepts in epidemiology and pathogenesis, Am. J.
+
+Gastroenterol. 107 (2012) 981–989.
+
+[21] L.A. Denson, M.D. Long, D.P. McGovern, et al., Challenges in IBD research: update on progress and prioritization of the CCFA's research agenda, Inflamm. Bowel Dis.
+
+19 (2013) 677–682.
+
+[22] J. Torres, J. Burisch, M. Riddle, et al., Preclinical disease and preventive strategies in IBD: perspectives, challenges and opportunities, Gut 65 (2016) 1061–1069.
+
+[23] C.K. Porter, D.R. Tribble, P.A. Aliaga, et al., Infectious gastroenteritis and risk of developing inflammatory bowel disease, Gastroenterology 135 (2008) 781–786.
+
+[24] M. Moore, E. Eiseman, G. Fisher, et al., Harnessing Full Value from the DoD Serum Repository and the Defense Medical Surveillance System, The RAND Corporation, 2010.
+
+[25] T. Shi, E. Song, S. Nie, et al., Advances in targeted proteomics and applications to biomedical research, Proteomics 16 (2016) 2160–2182.
+
+[26] J.M. Fontana, E. Alexander, M. Salvatore, Translational research in infectious disease: current paradigms and challenges ahead, Transl. Res. 159 (2012) 430–453.
+
+[27] D. Kevans, M.S. Silverberg, K. Borowski, et al., IBD genetic risk profile in healthy first-degree relatives of crohn's disease patients, J. Crohns. Colitis 10 (2016)
+209–215.
+
+[28] M.V. Rubertone, J.F. Brundage, The Defense Medical Surveillance System and the Department of Defense serum repository: glimpses of the future of public health surveillance, Am. J. Public Health 92 (2002) 1900–1904.
+
+[29] Defense Medical Surveillance System, Armed Forces Health Surveillance Branch, last accessed 23 October 2016 https://health.mil/Military-Health-Topics/HealthReadiness/Armed-Forces-Health-Surveillance-Branch/Data-Management-andTechnical-Support/Defense-Medical-Surveillance-System: Defense Health Agency.
+
+[30] D.M. Cayer, K.L. Nazor, N.J. Schork, Mission critical: the need for proteomics in the era of next-generation sequencing and precision medicine, Hum. Mol. Genet. 25
+(2016) R182–r189.
+
+[31] K.K. Jain, Role of proteomics in the development of personalized medicine, Adv.
+
+Protein Chem. Struct. Biol. 102 (2016) 41–52.
+
+[32] J. Torres, J.F. Colombel, M.S. Riddle, Evidence for life before inflammatory bowel disease, Clin. Gastroenterol. Hepatol. 14 (2016) 825–828.
+
+[33] D. Kevans, W. Turpin, K. Madsen, et al., Determinants of intestinal permeability in healthy first-degree relatives of individuals with Crohn's disease, Inflamm. Bowel Dis. 21 (2015) 879–887.
+
+[34] C.O. Elson, Y. Cong, V.J. McCracken, et al., Experimental models of inflammatory bowel disease reveal innate, adaptive, and regulatory mechanisms of host dialogue with the microbiota, Immunol. Rev. 206 (2005) 260–276.
+
+[35] E.S. Okerberg, J. Wu, B. Zhang, et al., High-resolution functional proteomics by active-site peptide profiling, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 4996–5001.
+
+8

medical/md/PMC6561856.md

@@ -0,0 +1,284 @@
+# Impact Of Artistic Gymnastics On Bone Formation 
+
+![0_Image_0.Png](0_Image_0.Png)
+
+![0_Image_1.Png](0_Image_1.Png) Marker, Density And Geometry In Female Adolescents: Abcd-Growth Study
+
+Isabella Neto Exupério1,3, Ricardo Ribeiro Agostinete1,2, André Oliveira Werneck1,2, Santiago Maillane-Vanegas1,3, Rafael Luiz-de-Marco1,3, Eduardo D.L. Mesquita1, Han C.G. Kemper4**, Rômulo Araújo Fernandes1,2,3**
+1*Laboratory of Investigation in Exercise (LIVE), Department of Physical Education, São Paulo State University (UNESP), São Paulo;* 2*Post-Graduation Program in Movement Sciences, Institute of Biosciences, São Paulo State University (UNESP), São Paulo;* 3*Post-Graduation Program in Physical Therapy, São Paulo State University (UNESP), São Paulo, Brazil* 4Department of Occupational Health, EMGO+ Institute for Health and Care Research, VU University Medical Center, Amsterdam, The Netherlands
+
+| Laboratory of Investigation in Exercise (LIVE),  Department of Physical Education, São Paulo  State University (UNESP), 305 Roberto  Simonsen - Presidente Prudente, São Paulo  19060-900, Brazil Tel: +55-18-3229-5400 Fax: +55-18-3229-5730 E-mail: i.exuperio@unesp.br Received: January 30, 2019 Revised: March 24, 2019 Accepted: April 16, 2019   |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+
+Background: To compare bone density accrual and markers of bone geometry and formation between female adolescents engaged and not engaged in artistic gymnastics (AGs). **Methods:** This was a 12-month longitudinal study involving 20 female adolescents, including 10 controls and 10 gymnasts (AGs) aged 11 to 16 years. At baseline, the gymnasts had a minimum of 12 months of practice, and the controls reported no participation in any organized sport. Bone mineral density (BMD) was measured in the lower limbs, upper limbs, spine, and whole body. In addition, BMD and geometrical properties of the femur were assessed. As a bone formation marker, osteocalcin level was measured. **Results:** Femoral aspects were increased in the gymnasts by 19% (P=0.009), 14% 
+(P=0.047), and 10% (P=0.046) in the Ward's triangle, trochanter, and the overall bone, respectively, than in the control girls. Geometrical parameters, bone accrual, and osteocalcin levels were similar in both groups. The weekly training load explained 30.8% of all bone gains on the lower limbs and affected the density on parts of the femur. **Conclusions:** The gymnasts, after a 12-month follow-up, demonstrated a higher BMD in the Ward's triangle and whole femur than the controls, as well as an improvement in femur density. These changes were mainly due to the weekly training load. Lastly, the gymnasts had significant bone accrual (after 12 months) in the upper limbs, lower limbs, and whole body. Key Words: Adolescent · Bone and bones · Growth · Gymnastics · Sports
+
+## Introduction
+
+Sufficient physical activity is protective against cardiovascular/metabolic complications and lower bone mineral density (BMD) during adolescence.[1,2] Especially among girls, greater BMD is important due to high prevalence of osteoporosis among older women.[3] Osteoporosis is a public health problem that affects the bone density (degrading the bone structure), leading to a higher risk of fractures.[3,4] Previous studies have shown that higher physical activity during ado-
+Copyright © 2019 The Korean Society for Bone and 
+
+![0_image_2.png](0_image_2.png) Mineral Research This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
+
+lescence is associated with higher BMD during adulthood. [5,6]
+Sport is one of the main physical activities practiced by adolescents. In this sense, the participation in weight bearing sports during adolescence improve the BMD gains and prevent possible future adverse events associated with low BMD.[7] It is widely disseminated by literature that adolescents who participate on land or gravity sports as basketball, track and field or soccer, present relevant gains on total body BMD compared with other non-weight bearing or hypogravity sports.[8-12] A cross-sectional study proposed by Proctor et al.[13] showed that gymnasts presented higher BMD than their control pairs for total body, lumbar spine and right femur. 
+
+Moreover, BMD accrual seems an outcome dependent of the sport chosen to be engaged in [11,14] being both amount and bone sites where the accrual happens variables affected by sport particularities. Aspects such as running, jumping, changing direction and ball displacement can directly influence this. On the other hand, weekly training load, soil and biomechanics of acrobatic movements and strength of artistic gymnastics (AGs) may present significant differences in BMD.
+
+AGs promotes large mechanical impacts in the execution of its elements (e.g., jumps and acrobatics), specifically, AGs composed of 4 devices: floor, vault (jump on the table), balance beam, and uneven bars. Each device imposes specific mechanical stress requiring strength, balance, flexibility, agility, and muscular power, demonstrating great osteogenic potential.[13-17] In addition, biological maturation is an important factor that can impact on BMD as well as other tissues during adolescence,[18,19] but sometimes not accounted in studies assessing the impact of sports participation on bone outcomes.
+
+Brazil held the Olympic Games in 2016 and, since then, AGs has become more popular in the county, raising doubts of the population about its impact in different health aspects in early life, mainly growth. Although, sports science has advanced in many aspects trying to understand how physical exercise and bone health interact each other during childhood and adolescence, many aspects still unclear, such as the impact of AGs on markers of bone formation and geometrical properties (instead the widely used 2-dimensional BMD).
+
+Thus, our objective was to compare bone density accrual and markers of bone geometry formation, on female adolescents between AGs and control group. We hypothesize, that AG will present higher gains in BMD than its control pairs after the follow-up of 12 months.
+
+## Methods 1. Sample
+
+The Analysis of Behaviors of Children During Growth 
+(ABCD) Growth Study is a longitudinal study which began in 2017. The main aim of this cohort study includes identification of the impact of behavioral variables (e.g., diet, sports participation, sedentary behavior, and sleep quality) 
+on economic and health outcomes (health care costs, metabolic outcomes, intima-media thickness, and bone parameters) among Brazilian adolescents with ages ranging from 10 to 18 years. More details about sampling process are presented elsewhere.[20] Briefly, researchers contacted adolescents in eleven schools and sport clubs spread out in the metropolitan area of Presidente Prudente, a middlesized city in the west part of the São Paulo state. The sample size calculation was constructed considering a relation between muscle mass and bone mineral content of r=0.84 between adolescent gymnasts,[21] 80% power and 5% 
+error-α. The minimum sample size was estimated in 10 female adolescents in each group (n=20, considering AGs 
+[n=10] and control [n=10]).
+
+Initially, coaches and principals were contacted and they gave the authorization to talk with the students/athletes about the aims of the ABCD Growth Study. The following inclusion criteria were adopted: age ranging from 11 to 18 years, no previously diagnosed disease that could affect daily physical activity, no regular medicine use, having completed the consent form signed by parents/legal guardians and if athlete, at least one year of training experience; if schoolchildren, at least 1 year without practicing any organized sport. All the procedures were previously approved by the ethical committee of São Paulo State University, Campus of Presidente Prudente, State of Sao Paulo, Brazil (Approval no. CAAE: 57585416.4.0000.5402).
+
+## 2. Inclusion Criteria
+
+The inclusion criteria adopted were as follow: (1) The chronologic age between 11 and 17 years old; (2) at least previous 12 months sports participation (gymnastics); (3) 
+non-engagement in organized sports during the last 12 months (non-sports group); (4) no medicine use that may affect the bone metabolism) signed the consent form by parents or tutors.
+
+## 3. Ags And Control Group
+
+The baseline measures of the ABCD Growth Study accounted 285 adolescents. In this specific manuscript, only female adolescents engaged in AGs (n=10; age range, 11.8-15.6 years) and controls (n=10) were considered and matched by chronological age P=0.462 and age high peak velocity P=0.473. Gymnasts were involved in championships at state level. After 12 months of follow-up, nine girls in AG group maintained the sports participation, while one dropped the sport after 3 months of baseline measures. In the follow-up measures, researchers successfully contacted this dropout girl and thus this girl has been maintained in all statistical analysis. Among controls, during 12 months follow-up none of those adolescents started any organized sport.
+
+Coaches provided data about gymnasts. At baseline, the previous time of engagement was 58.9 months (95% confidence interval [CI], 34.9-82.8; with minimum 15 months), 
+number of days/week training of 3 days (95% CI, 2.4-3.5; range, 2-5 days), daily training time of 207 min (95% CI, 179.3-234.6; minimum of 150 min) and training volume of 615 min (95% CI, 500.4-729.5; minimum 360 min).
+
+## 4. Weekly Training Load
+
+The athletes reported the intensity (according to the rating of perceived exertion) and volume of evert practice session during a week of training (considering the days trained).[22] The training load of each day was calculated multiplying the rating (reported after 30 min of the end of the training) [23] by the volume (total of the day). The weekly training was estimated by the sum of every day.
+
+## 5. Bone Parameters
+
+BMD (expressed as g/cm2) was estimated using a dual energy X-ray absorptiometry (DXA) device (Lunar DPX-NT; GE Healthcare, Little Chalfont, Buckinghamshire, UK) with GE Medical System Lunar software (version 4.7). Every morning before the measurements, following the manufacturer's recommendations, a previously trained researcher assessed the calibration scores of the DXA device. The coefficient of variation of the equipment is 0.66%. A whole-body scan was performed with the adolescents in a supine position, wearing light clothing, barefoot, and without any metal object on the body. In terms of bone outcomes, BMD 
+was measured in the lower limbs, upper limbs, spine, and whole body in both moments of the study (baseline and 12-months follow-up). Additionally, just in the follow-up moment of the study, the participants were positioned to also measure the BMD (neck, trochanter, ward's triangle, shaft, and whole femur) and geometrical parameters (crosssectional area and cross-sectional moment of inertia) of the femur. In terms of bone formation marker, just in the follow-up moment of the study, osteocalcin levels (expressed in ng/mL) were estimated by a private clinical laboratory (in the morning after 12 hr fasting).
+
+The values of lean soft tissue (LST; expressed as kg) and fat mass (expressed as kg) were also estimated using DXA.
+
+## 6. Somatic Maturation
+
+Body weight was measured on a digital reading scale 
+(Filizola PL 200; Filizzola Ltd., São Paulo, Brazil), with a precision of 0.1 kg, while stature and setting-height were determined using a stadiometer (Sanny, Professional model; Sanny®, São Paulo, Brazil) with a precision of 0.1 cm, according to procedures described in the literature.[24] Age at peak of height velocity were calculated using these anthropometric data.[25]
+
+## 7. Statistical Analyses
+
+Descriptive statistics was composed of mean, standard deviation and 95% CIs. The Student t-test for independent samples compared mean values between the gymnasts and control girls, while analysis of covariance (ANCOVA) compared the same mean values between gymnasts and control girls, adjusted by confounders. For comparisons of variables with non-parametric distribution, was used the Mann-Whitney's test. Pearson's correlation (r) was used to analyze the relationship between numerical variables. All statistical procedures were processed in the statistical software BioStat 5.0 (Instituto Mamirauá, Tefé, Brazil) and statistical significance (P-value) was set at <0.05.
+
+## Results
+
+Baseline characteristics of the sample are presented in 
+
+## Isabella Neto Exupério, Et Al.
+
+Table 1. General characteristics of the adolescents stratified by engagement in artistic gymnastics at baseline (n=20; Analysis of Behaviors of Children During Growth Study)
+
+| Variables                                     | Control group           | Gymnastics   | Pvalue       |
+|-----------------------------------------------|-------------------------|--------------|-------|
+| (n=10)                                        | (n=10)                  |              |       |
+| Chronological age (year)                      | 14.6±2.7                | 13.8±1.3     | 0.462 |
+| Weight (kg)                                   | 52.6±15.6               | 45.3±6.4     | 0.190 |
+| Stature (cm)                                  | 156.1±9.5               | 159.4±5.6    | 0.352 |
+| Fat mass (%)                                  | 34.7±10.3               | 19.1±5.0     | 0.001 |
+| Lean soft tissue (kg)                         | 32.1±6.6                | 34.0±4.4     | 0.473 |
+| APHV (year)                                   | 12.8±1.2                | 12.5±0.4     | 0.473 |
+| Artistic gymnastic  Engagement time (month)   | -                       | 54.5±23.2    | -     |
+| Training per week (day)                       | -                       | 3.0±0.8      | -     |
+| Volume of training/day (min)                  | -                       | 207.0±38.6   | -     |
+| Weekly training (min/week)                    | -                       | 615.0±160.2  | -     |
+| Weekly training loada)                        | -                       | 3.2±0.1      | -     |
+| Bone mineral density (g/cm²)  DXA-upper limbs | 0.777±0.136 0.819±0.068 | 0.394        |       |
+| DXA-lower limbs                               | 1.162±0.110 1.216±0.098 | 0.242        |       |
+| DXA-spine                                     | 1.073±0.171 1.078±0.149 | 0.949        |       |
+| DXA-whole body                                | 1.101±0.116 1.117±0.081 | 0.714        |       |
+
+Table 1, in which gymnastics athletes presented significantly lower body fatness compared to their control peers (P=
+0.001). All other variables were similar between both groups.
+
+In terms of bone parameters, femur aspects were improved in the group composed of gymnasts, in this case 19% (P=0.009) higher on wards' triangle, 14% (P=0.047) on trochanter and 10% in the overall bone (P=0.046) than 
+
+![3_image_0.png](3_image_0.png)
+
+Fig. 1. Bone density accrual in female adolescents engaged and not engaged in gymnastics (n=20; Analysis of Behaviors of Children During Growth Study). Bar signify the 95% confidence interval (CI).
+
+| of Behaviors of Children During Growth Study) Bone variables                                                                                                                                                                                                   | Control group (n=10)     | Gymnastics (n=10)        | P-value   |
+|----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|--------------------------|--------------------------|-----------|
+| Femur (g/cm2 )  Neck                                                                                                                                                                                                                                           | 1.083±0.114              | 1.127±0.100              | 0.382     |
+| Wards' triangle                                                                                                                                                                                                                                                | 0.940±0.112              | 1.119±0.157              | 0.009     |
+| Trochanter                                                                                                                                                                                                                                                     | 0.801±0.117              | 0.914±0.118              | 0.047     |
+| Shaft                                                                                                                                                                                                                                                          | 1.161±0.138              | 1.277±0.134              | 0.074     |
+| Whole femur                                                                                                                                                                                                                                                    | 1.006±0.116              | 1.116±0.112              | 0.046     |
+| Hip structural analysis  CSA (mm2 )                                                                                                                                                                                                                            | 130.6±28.1               | 141.3±17.1               | 0.356     |
+| CSMI (mm4 )                                                                                                                                                                                                                                                    | 6,798.5±3,350.9          | 6,815.7±1,412.7          | 0.988     |
+| Metabolism marker  Osteocalcin (ng/mL)a)                                                                                                                                                                                                                       | 35.6±23.5                | 52.5±33.7                | 0.206     |
+| Bone accrual BMD (g/cm2 )  DXA-upper limbs                                                                                                                                                                                                                     | 0.007 (-0.047 to 0.063)  | 0.043 (0.029 to 0.057)   | 0.181     |
+| DXA-lower limbs                                                                                                                                                                                                                                                | 0.021 (-0.006 to 0.049)  | 0.045 (0.012 to 0.079)   | 0.219     |
+| DXA-spine                                                                                                                                                                                                                                                      | -0.022 (-0.069 to 0.024) | -0.009 (-0.038 to 0.020) | 0.596     |
+| DXA-whole body                                                                                                                                                                                                                                                 | 0.010 (-0.019 to 0.040)  | 0.035 (0.021 to 0.048)   | 0.105     |
+| The data is presented as mean±standard deviation or mean (95% confidence interval). Significant difference (P<0.05) in bold. a)Due to non-parametric distribution, variable expressed as median and interquartile range and compared with Mann-Whitney's test. |                          |                          |           |
+
+control girls. Geometrical parameters and osteocalcin levels were similar in both groups. For bone density, AG group showed significant increase in upper limbs, lower limbs and whole body while control group showed insignificant increase. In the case of spine, the bone density of both groups were decreased but not statistically significant (Fig. 1). There was no significant difference in direct comparison of the change amount between 2 groups (Table 2).
+
+In this sample composed of female adolescents, osteo-
+
+| Study) Bone variables                      | Weekly training loadc) Osteocalcin (ng/mL)d)   |         |
+|--------------------------------------------|------------------------------------------------|---------|
+| Femur (g/cm2 )  Neck                       | 0.365                                          | 0.155   |
+| Wards' triangle                            | 0.671b)                                        | 0.021   |
+| Trochanter                                 | 0.661b)                                        | 0.014   |
+| Shaft                                      | 0.552a)                                        | -0.124  |
+| Whole femur                                | 0.622b)                                        | -0.037  |
+| Hip structural analysis  CSA (mm2 )        | 0.415                                          | 0.145   |
+| CSMI (mm4 )                                | 0.134                                          | 0.194   |
+| Bone accrual BMD (g/cm2 )  DXA-upper limbs | 0.199                                          | 0.444b) |
+| DXA-lower limbs                            | 0.555a)                                        | 0.537b) |
+| DXA-spine                                  | 0.207                                          | -0.104  |
+| DXA-whole body                             | 0.419                                          | 0.201   |
+| The data is presented as correlation (r) and it adjusted by age and somatic maturation. Significant difference (P<0.05) in bold. a)P<0.05. b)P<0.01. c)The weekly training loading were considered on                                            |                                                |         |
+
+calcin levels were positively related to bone gains over 12months follow-up in upper and lower limbs, in which osteocalcin explained 19.7% (r=0.444, r-squared=0.197) 
+and 28.8% (r=0.537, r-squared=0.288) of the bone gains on upper and lower limbs, respectively (Table 3). Similarly, weekly training load (n=10) explained 30.8% (r=0.555, rsquared=0.308) of all bone gains on lower limbs, while weekly training load also was related to higher density on parts of femur (Wards' triangle, trochanter, shaft, and the entire femur). Osteocalcin level and training load positively related to each other (r=0.511, P=0.021).
+
+In terms of femur parameters, in the multivariate models, there was significant difference between controls and gymnasts in wards' triangle (P=0.045) and whole femur (P=0.047) (Table 4). Besides that, the magnitude of the variance explained by gymnastics on all variables was high (neck [15.9%], Wards' triangle [22.8%], trochanter [18.6%], shaft [17.7%], and whole femur [22.5%]). In all models, LST on lower limb constituted the most relevant covariate.
+
+## Discussion
+
+The present study aimed to investigate the impact of the engagement in AG on bone parameters in female adolescents after 12 months follow-up. In the past, many fears were raised about negative impacts on human growth attributed to gymnastics, but the current literature offers support to the promotion of gymnastics as a sports linked to health benefits.[26] In fact, gymnasts present a well characteristic shape which reinforces ideas of natural selection into the modality, in which individuals with a genetic predisposition, such as short stature, tend to stand out in the sport.[27,28] Considering 
+
+| Table 4. Comparisons of femur density between girls engaged and not engaged in artistic gymnastics (n=20) Follow-up measures Control group  Gymnastics  ANCOVAa) parameters (n=10) (n=10) P-value Eta-squared Qualitative   | Levene's test (P-value)   |                        |       |       |      |       |
+|-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|---------------------------|------------------------|-------|-------|------|-------|
+| Femur (g/cm2 )  Neck                                                                                                                                                                                                        | 1.051 (0.968 to 1.134)    | 1.164 (1.075 to 1.253) | 0.113 | 0.159 | High | 0.968 |
+| Wards' triangle                                                                                                                                                                                                             | 0.925 (0.802 to 1.047)    | 1.135 (1.012 to 1.258) | 0.045 | 0.228 | High | 0.345 |
+| Trochanter                                                                                                                                                                                                                  | 0.778 (0.673 to 0.884)    | 0.937 (0.832 to 1.042) | 0.074 | 0.186 | High | 0.461 |
+| Shaft                                                                                                                                                                                                                       | 1.138 (1.027 to 1.250)    | 1.301 (1.190 to 1.413) | 0.082 | 0.177 | High | 0.780 |
+| Whole femur                                                                                                                                                                                                                 | 0.981 (0.886 to 1.076)    | 1.142 (1.047 to 1.237) | 0.047 | 0.225 | High | 0.531 |
+| The data is presented as mean (95% confidence interval). a)Adjusted by lean soft tissue and fat mass (%).                                                                                                                   |                           |                        |       |       |      |       |
+
+the biomechanics and rich variability of movements, individuals with a small stature and lower body mass present advantages over taller and heavier individuals. Therefore, physical characteristics observed in gymnasts seem affected by natural selection, instead harmful impacts on physical growth.[29]
+In this longitudinal study, the gymnasts presented higher BMD after 12 months in the ward's triangle and whole femur, as well as, adolescents engaged in AG have significant bone accrual at upper limbs, lower limbs and whole body, while control group have no significant bone improvement. Female AG involves 4 different apparatus (the vault, uneven bars, balance beam, and floor exercise) [30] and the movements performed during practice may explain our results for BMD among gymnasts. With the exception of the floor exercise, the majority of movements and exercises in the AG are performed by the upper limbs, which at many moments are required to support the athlete's entire body weight. In general, AG movements generate compression, tension, and torsional stress in the bones and thus, elevate recruitment of bone formation cells (osteoblasts) at these specific sites.[31,32]
+The dynamics of acrobatic movements seems relevant to improve bone density on femur on gymnasts, mainly due to the high ground reaction force generated by these movements. For example, plié is a common movement in AG, which exerts great force on lower limbs. Moreover, after plié, gymnasts usually run in the floor in order to increase force and impulse to perform pre-acrobatic plié, in which gymnasts impose maximum strength on quadriceps to assist her in the subsequent jumps, consisting of predetermined movements (e.g., rolling+flip flac+mortal; minichelli 
++flic flac+extension back with a twist, jump away+cat). [33] In terms of technic, gymnasts also finish the sequence of movements with a reception plié (spiked), showing that movement was finished generating great impact on the skeleton, mainly on the neck of the femur. All these dynamic of movements generate a musculoskeletal tension, which causes micro bone damages, affecting bone remodeling and subsequent bone strength in the segments directly affected by it, especially femur. On the other hand, even considering all those osteogenic elements observed in AG, it is necessary to recognize that its impacts on bone parameters of pediatric groups still under investigation. [15,34,35]
+Among female adolescents, the importance of these findings refers to the fact that femur is widely affected by osteoporosis, accounting for largest number of osteoporotic fractures among elderly people.[34,36] Therefore, improvements in femur BMD during adolescence might be crucial to prevent osteoporosis in the future.
+
+Osteocalcin level marker of bone formation was slightly higher among gymnasts when compared to controls and positively related to bone density accrual in our sample. Osteocalcin is related to the synthesis and storage of the mineral matrix [37] and its relationship with bone parameters was not a surprise.[34] The impact of sports participation on osteocalcin and the effect of this relationship on bone formation still under investigation, mainly because sports participation might improve bone aspects through other pathways (e.g., bone compression) than just improvements in osteocalcin levels.
+
+Although this study furthers the knowledge of BMD, it also has limitations, being a reduced the sample one of them, which does not allow us to perform more robust analyses or even adjust it by a greater number of potential confounders (the absence of some relevant covariates also is a limitation). Therefore, our findings should be analyzed with caution and every single inference of them made wisely by coaches and health professionals. The small sample size might be responsible by the absence of significant results, but the use of measures of effect-size gives us a new perspective in terms of how interpret our findings and its implications to the real world.[36] Therefore, our findings should be analyzed with caution and every single inference of them made wisely by coaches and health professionals. The lack of evaluation of other bone health parameters such as intake of calcium and vitamin D prevented further deepening of the subject as well as the analysis of osteocalcin and femur at both moments. Despite the limitations already mentioned, this is one of the first studies to analyze BMD gain during 12 months of follow-up, as well as, to relate osteocalcin levels and training with variables, BMD gains of sitios of the body, hip structure and femur sitios.
+
+## Conclusions
+
+In summary, female gymnasts after 12 months followup present higher BMD in wards' triangle and whole femur than control group, besides that, femur density was improved in these gymnasts, mainly due to the weekly training load. Lastly, the female gymnasts have a significant bone accrual (after 12 months) in upper limbs, lower limbs and whole body. However, we emphasize the importance in-depth studies that consider other parameters of bone health and with a larger sample size to obtain more structured results. 
+
+## Declarations
+
+Acknowledgments The authors gratefully acknowledge São Paulo Research Foundation (FAPESP) and the effort of the participants and their parents and coaches. 
+
+## Funding
+
+This study was supported by the São Paulo Research Foundation-FAPESP (Process 2017/14183-0 and 2015/19710-3). 
+
+RRA received a Grant from the FAPESP (2017/09182-5), AOW received a Grant from the FAPESP (2017/27234-2), SMJ received a Grant from the FAPESP (2016/20354-0), RLM received a Grant from the FAPESP (2017/13003-9), and KRL received a Grant from the FAPESP (2016/20377-0). 
+
+This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance Code 001.
+
+## Authors' Contributions
+
+Conceptualization: INE, RRA, AOW, RAF. Data curation: 
+INE, RRA, AOW, SMV, RLM, EDLM, RAF. Formal analysis: INE, RRA, AOW, RAF. Funding acquisition: INE, RRA, AOW, SMV, RLM, EDLM, RAF. Investigation: INE, RRA, AOW, SMV, RLM, EDLM, RAF. Methodology: INE, RRA, AOW, SMV, RLM, EDLM, RAF. Project administration: INE, RRA, RAF. Resources: INE, RRA, AOW, SMV, RLM, EDLM, HCGK, RAF. Validation: INE, RRA, AOW, SMV, RLM, EDLM, HCGK, RAF. Visualization: INE, 
+RRA, AOW, SMV, RLM, EDLM, HCGK, RAF. Writing±original draft: INE, RRA, AOW, SMV, RLM, EDLM, HCGK, RAF. Writing±review & editing: INE, RRA, AOW, SMV, RLM, EDLM, 
+HCGK, RAF.
+
+## Conflict Of Interest
+
+No potential conflict of interest relevant to this article was reported.
+
+ORCID
+André Oliveira Werneck https://orcid.org/0000-0002-91664376 Santiago Maillane-Vanegas *https://orcid.org/0000-0002-*
+4780-6541 Rafael Luiz-de-Marco *https://orcid.org/0000-0002-4920-*
+5758 Eduardo D.L Mesquita *https://orcid.org/0000-0003-0760-4141* Han C.G Kemper *https://orcid.org/0000-0002-8330-9227* Romulo Araújo Fernandes https://orcid.org/0000-00031576-8090
+
+## References
+
+1. Silva DR, Werneck AO, Collings PJ, et al. Physical activity maintenance and metabolic risk in adolescents. J Public Health (Oxf) 2018;40:493-500.
+
+2. Stamatakis E, Coombs N, Tiling K, et al. Sedentary time in late childhood and cardiometabolic risk in adolescence. Pediatrics 2015;135:e1432-41.
+
+3. Wright NC, Looker AC, Saag KG, et al. The recent prevalence of osteoporosis and low bone mass in the United States based on bone mineral density at the femoral neck or lumbar spine. J Bone Miner Res 2014;29:2520-6.
+
+4. Kanis JA. Diagnosis of osteoporosis and assessment of fracture risk. Lancet 2002;359:1929-36.
+
+5. Bielemann RM, Domingues MR, Horta BL, et al. Physical activity throughout adolescence and bone mineral density in early adulthood: the 1993 Pelotas (Brazil) Birth Cohort Study. Osteoporos Int 2014;25:2007-15.
+
+6. Boreham CA, McKay HA. Physical activity in childhood and bone health. Br J Sports Med 2011;45:877-9.
+
+7. Maillane-Vanegas S, Agostinete RR, Lynch KR, et al. Bone mineral density and sports participation. J Clin Densitom 2018. http://dx.doi.org/10.1016/j.jocd.2018.05.041.
+
+8. Ubago-Guisado E, Gómez-Cabello A, Sánchez-Sánchez J, 
+et al. Influence of different sports on bone mass in growing girls. J Sports Sci 2015;33:1710-8.
+
+9. Lynch KR, Kemper HCG, Turi-Lynch B, et al. Impact sports and bone fractures among adolescents. J Sports Sci 2017; 35:2421-6.
+
+10. Vlachopoulos D, Barker AR, Ubago-Guisado E, et al. The effect of 12-month participation in osteogenic and nonosteogenic sports on bone development in adolescent male athletes. The PRO-BONE study. J Sci Med Sport 2018; 
+
+## 21:404-9.
+
+11. Madsen KL, Adams WC, Van Loan MD. Effects of physical activity, body weight and composition, and muscular strength on bone density in young women. Med Sci Sports Exerc 1998;30:114-20.
+
+12. Faustino-da-Silva Y, Agostinete RR, Werneck AO, et al. Track and field practice and bone outcomes among adolescents: a pilot study (ABCD-Growth Study). J Bone Metab 2018; 25:35-42.
+
+13. Proctor KL, Adams WC, Shaffrath JD, et al. Upper-limb bone mineral density of female collegiate gymnasts versus controls. Med Sci Sports Exerc 2002;34:1830-5.
+
+14. Fehling PC, Alekel L, Clasey J, et al. A comparison of bone mineral densities among female athletes in impact loading and active loading sports. Bone 1995;17:205-10.
+
+15. da Silva CC, Teixeira AS, Goldberg TBL. Sport and its implications on the bone health of adolescent athletes. Rev Bras Med Esporte 2003;9:433-8.
+
+16. Nichols DL, Sanborn CF, Bonnick SL, et al. The effects of gymnastics training on bone mineral density. Med Sci Sports Exerc 1994;26:1220-5.
+
+17. Dowthwaite JN, Rosenbaum PF, Scerpella TA. Mechanical loading during growth is associated with plane-specific differences in vertebral geometry: a cross-sectional analysis comparing artistic gymnasts vs. non-gymnasts. Bone 2011;49:1046-54.
+
+18. Erlandson MC, Kontulainen SA, Chilibeck PD, et al. Former premenarcheal gymnasts exhibit site-specific skeletal benefits in adulthood after long-term retirement. J Bone Miner Res 2012;27:2298-305.
+
+19. Malina RM, Bouchard C, Bar-Or O. Growth, maturation, and physical activity. 2nd ed. Champaign, IL: Human kinetics; 2004.
+
+20. Jackowski SA, Erlandson MC, Mirwald RL, et al. Effect of maturational timing on bone mineral content accrual from childhood to adulthood: evidence from 15 years of longitudinal data. Bone 2011;48:1178-85.
+
+21. Vicente-Rodriguez G, Dorado C, Ara I, et al. Artistic versus rhythmic gymnastics: effects on bone and muscle mass in young girls. Int J Sports Med 2007;28:386-93.
+
+22. McGuigan MR, Al Dayel A, Tod D, et al. Use of session rating of perceived exertion for monitoring resistance exercise in children who are overweight or obese. Pediatr Exerc Sci 2008;20:333-41.
+
+23. Foster C, Florhaug JA, Franklin J, et al. A new approach to monitoring exercise training. J Strength Cond Res 2001; 15:109-15.
+
+24. Werneck AO, Agostinete RR, Cayres SU, et al. Association between cluster of lifestyle behaviors and HOMA-IR among adolescents: ABCD growth study. Medicina (Kaunas) 2018;54.
+
+25. Moore SA, McKay HA, Macdonald H, et al. Enhancing a somatic maturity prediction model. Med Sci Sports Exerc 2015;47:1755-64.
+
+26. Mirwald RL, Baxter-Jones AD, Bailey DA, et al. An assessment of maturity from anthropometric measurements. 
+
+Med Sci Sports Exerc 2002;34:689-94.
+
+27. Malina RM, Baxter-Jones AD, Armstrong N, et al. Role of intensive training in the growth and maturation of artistic gymnasts. Sports Med 2013;43:783-802.
+
+28. Tsukamoto MHC, Nunomura M. Maturational features in female olimpic gymnasts. Motriz 2003;9:119-26.
+
+29. Alves C, Lima RVB. Linear growth and puberty in children and adolescents: effects of physical activity and sports. Rev Paul Pediatr 2008;26:383-91.
+
+30. Burt LA, Greene DA, Naughton GA. Bone health of young male gymnasts: A systematic review. Pediatr Exerc Sci 2017; 29:456-64.
+
+31. FIG Executive Committee. 2017- 2020 Code of points women's artistic gymnastics. 2017 [cited by 2018 Dec 1]. Available from: https://www.gymogturn.no/wp-content/uploads/2015/10/CoP-2017-2020-1.pdf 32. Tenforde AS, Fredericson M. Influence of sports participation on bone health in the young athlete: a review of the literature. PM R 2011;3:861-7.
+
+33. Yang PF, Brüggemann GP, Rittweger J. What do we currently know from in vivo bone strain measurements in humans? J Musculoskelet Neuronal Interact 2011;11:8-20.
+
+34. Haering D, Huchez A, Barbier F, et al. Identification of the contribution of contact and aerial biomechanical parameters in acrobatic performance. PLoS One 2017;12:e0172083.
+
+35. Jaffré C, Courteix D, Dine G, et al. Physical exercise and bone turnover: a study in young girl gymnasts. Sci Sports 2001;16:321-2.
+
+36. Zanatta LC, Boguszewski CL, Borba VZ, et al. Osteocalcin, energy and glucose metabolism. Arq Bras Endocrinol Metabol 2014;58:444-51.
+
+37. Zanatta LCB, Boguszewski CL, Borba VZC, et al. Association between undercarboxylated osteocalcin, bone mineral density, and metabolic parameters in postmenopausal women. Arch Endocrinol Metab 2018;62:446-51.

medical/md/PMC6662152.md

@@ -0,0 +1,87 @@
+
+
+![0_image_1.png](0_image_1.png)
+
+![0_image_2.png](0_image_2.png)
+
+# Myocardial Infarction With Nonobstructive Coronary Arteries: A Call
+
+![0_Image_3.Png](0_Image_3.Png) For Individualized Treatment
+
+Debabrata Mukherjee, MD, MS
+Myocardial infarction with nonobstructive coronary arteries (MINOCA) is a heterogeneous clinical entity, characterized by clinical evidence of myocardial infarction (MI)
+with nonobstructive coronary arteries on angiography (≤50%
+stenosis) and without an overt cause for the MI, such as cardiac trauma or injury.1 MINOCA is not uncommon and has been reported in 5% to 15% of individuals presenting with MI,
+depending on the population studied.2,3 There are a variety of causes that can cause MINOCA, and it is important that patients are diagnosed with the correct underlying pathological condition so that specific therapies to treat the underlying cause can be prescribed. The most common causes of MINOCA appear to be coronary plaque disruption, coronary dissection, coronary artery spasm, microvascular disease, coronary thromboembolism, and, finally, MINOCA of uncertain cause.3 Coronary plaque disruption, which includes plaque rupture, plaque erosion, and calcific nodules, is common among patients with MINOCA and can trigger thrombus formation that leads to MI via distal embolization, superimposed vasospasm, and transient complete thrombosis with spontaneous thrombolysis. Coronary artery vasospasm, another potential cause of MINOCA, defined as marked (ie,
+>90%) constriction of an epicardial coronary artery with diminished myocardial blood flow, may occur either in response to drugs or toxins or spontaneously caused by abnormal coronary vasomotor tone. Although coronary microvascular dysfunction typically presents as stable ischemic heart disease,4 it is also considered a potential
+
+![0_image_0.png](0_image_0.png)
+
+cause of MINOCA.2 Microvascular dysfunction can be a cause of ischemia but can also be an effect of myocardial injury of either ischemic or nonischemic origin.5 The precise contribution of coronary microvascular dysfunction in MINOCA
+requires additional study, assessing the roles of microvascular angina, microvascular spasm, or the coronary slow flow phenomenon in patients with MINOCA. Coronary embolism may cause MINOCA if it lodges in the microcirculation or if lysed partially in the epicardial coronary artery with resultant nonobstructive or <50% angiographic disease. Finally, some patients with spontaneous coronary artery dissection may appear to have nonobstructive coronary artery disease on angiography because of gradual tapering of the vessel; and this can, therefore, be a potential cause of MINOCA. The diagnosis of a type 2 MI or supply demand mismatch is made in patients with MINOCA when a potential cause exists, such as tachycardia, severe anemia, or hypotension, without evidence of any other pathological condition that would identify another cause.6 Although the treatment of MI with obstructive coronary artery disease is well established, there is a paucity of randomized data on the effectiveness of preventative therapies for individuals with MINOCA. In this issue of the Journal of the American Heart Association (JAHA), Choo et al7 analyzed factors related to all-cause death in MINOCA using a nationwide, multicenter, and prospective registry. They report that patients with MINOCA and those with MI related to obstructive coronary artery disease had comparable clinical outcomes.
+
+They also report that the use of renin-angiotensin system blockers and statins was associated with lower mortality in patients with MINOCA. These results appear concordant with the stratified propensity analysis of 9138 patients with MINOCA enrolled in the SWEDEHEART (Swedish Web System for Enhancement and Development of Evidence-Based Care in Heart Disease Evaluated According to Recommended Therapy) registry, which reported that after a mean follow-up of 4.1 years, there was a significantly lower rate of all-cause mortality, hospitalization for MI, ischemic stroke, and heart failure associated with the use of statins (hazard ratio, 0.77
+[95% CI, 0.68–0.87]) and angiotensin-converting enzyme inhibitors (ACEIs)/angiotensin receptor blockers (ARBs) (hazard ratio, 0.82 [95% CI, 0.73–0.93]) and a trend for a lower event rate with the use of b-blockers (hazard ratio, 0.86 [95%
+CI, 0.74–1.01]).8 However, the use of dual-antiplatelet agents was not associated with a lower event rate (hazard ratio, 0.90
+[95% CI, 0.74–1.08]). The ongoing MINOCA BAT (Randomized Evaluation of b-Blocker and ACEI/ARB Treatment in MINOCA
+Patients; ClinicalTrials.gov Identifier: NCT03686696) study will randomize 3500 patients with MINOCA to treatment with ACEIs/ARBs and b-blockers or matching placebo. The primary end point of the study is time to death of any cause or readmission because of MI, ischemic stroke, or heart failure and should provide us with valuable information on the benefits or risks of routine cardioprotective therapies in patients with MINOCA. One modest-sized randomized study, the BHF
+CorMicA (British Heart Foundation Coronary Microvascular Angina) study, tested stratified medical therapy for patients with MINOCA, guided by an interventional diagnostic procedure,9 and reported that this strategy of vasoreactivity testing to guide treatment is feasible and improves angina in patients with nonobstructive coronary artery disease. This study had several limitations, including using binary cutoffs for the vasoreactivity study, potential bias in symptom ascertainment because the patient and cardiologist were not blinded to group allocation, and potential selection bias in patient enrollment because a considerable proportion of patients undergoing invasive coronary angiography were not enrolled, primarily because of patient preference. Given these limitations, additional studies are indicated to validate these results and the role of vasoreactivity testing among those presenting with MINOCA.
+
+While we await the results of MINOCA BAT and other randomized studies, on the basis of available data and the scientific statement from the American Heart Association on MINOCA,2 we suggest an individualized approach to the management of patients with MINOCA on the basis of the underlying cause (Figure). The central principle in the management of MINOCA is to elucidate or identify the underlying mechanism for targeted therapies and optimize outcomes. In general, ACEI or ARB and statins should be considered for most patients with MINOCA.
+
+The prognosis of patients with MINOCA depends on the underlying cause, but overall it is not a benign condition, as
+
+![1_image_0.png](1_image_0.png)
+
+reported in the current study by Choo et al7 and other studies, such as the VIRGO (Variation in Recovery: Role of Gender on Outcomes of Young AMI [Acute MI] Patients) study, with patients with MINOCA having similar mortality rates and comparable quality-of-life measures as patients with obstructive coronary artery disease.10 Additional studies are indicated to assess the optimal therapies for patients presenting with MINOCA, focusing on hard clinical end points, such as mortality and reinfarction. In addition to the hard cardiovascular end points, the impact of MINOCA on quality of health also needs to be evaluated on parameters such as persistent angina, activities of daily living, and depression.11 For now, on the basis of limited data, it seems reasonable to administer ACEIs/ARBs, statins, and antiplatelet agents to most patients presenting with MINOCA while we await more robust prospective randomized data.
+
+## Disclosures None. References
+
+1. Pasupathy S, Tavella R, McRae S, Beltrame JF. Myocardial infarction with nonobstructive coronary arteries: diagnosis and management. Eur Cardiol.
+
+2015;10:79–82.
+
+2. Tamis-Holland JE, Jneid H, Reynolds HR, Agewall S, Brilakis ES, Brown TM,
+Lerman A, Cushman M, Kumbhani DJ, Arslanian-Engoren C, Bolger AF, Beltrame JF; American Heart Association Interventional Cardiovascular Care Committee of the Council on Clinical Cardiology; Council on Cardiovascular and Stroke Nursing; Council on Epidemiology and Prevention; Council on Quality of Care and Outcomes Research. Contemporary diagnosis and management of patients with myocardial infarction in the absence of obstructive coronary artery disease: a scientific statement from the American Heart Association. Circulation. 2019;139:e891–e908.
+
+3. Scalone G, Niccoli G, Crea F. Editor's choice: pathophysiology, diagnosis and management of MINOCA: an update. Eur Heart J Acute Cardiovasc Care.
+
+2019;8:54–62.
+
+4. Bairey Merz CN, Pepine CJ, Walsh MN, Fleg JL. Ischemia and no obstructive coronary artery disease (INOCA): developing evidence-based therapies and research agenda for the next decade. Circulation. 2017;135:1075–1092.
+
+5. Mauricio R, Srichai MB, Axel L, Hochman JS, Reynolds HR. Stress cardiac MRI
+in women with myocardial infarction and nonobstructive coronary artery disease. Clin Cardiol. 2016;39:596–602.
+
+6. Neumann JT, Sorensen NA, Rubsamen N, Ojeda F, Renne T, Qaderi V, Teltrop E,
+Kramer S, Quantius L, Zeller T, Karakas M, Blankenberg S, Westermann D.
+
+Discrimination of patients with type 2 myocardial infarction. Eur Heart J.
+
+2017;38:3514–3520.
+
+7. Choo EH, Chang K, Lee KY, Lee D, Kim JG, Ahn Y, Kim YJ, Chae SC, Cho MC,
+Kim CJ, Kim H-S, Jeong MH; KAMIR-NIH Investigators. Prognosis and predictors of mortality in patients suffering myocardial infarction with nonobstructive coronary arteries. J Am Heart Assoc. 2019;8:e011990. DOI: 10.
+
+1161/JAHA.119.011990.
+
+8. Lindahl B, Baron T, Erlinge D, Hadziosmanovic N, Nordenskjold A, Gard A,
+Jernberg T. Medical therapy for secondary prevention and long-term outcome in patients with myocardial infarction with nonobstructive coronary artery disease. Circulation. 2017;135:1481–1489.
+
+9. Ford TJ, Stanley B, Good R, Rocchiccioli P, McEntegart M, Watkins S, Eteiba H,
+Shaukat A, Lindsay M, Robertson K, Hood S, McGeoch R, McDade R, Yii E,
+Sidik N, McCartney P, Corcoran D, Collison D, Rush C, McConnachie A, Touyz RM, Oldroyd KG, Berry C. Stratified medical therapy using invasive coronary function testing in angina: the CorMicA trial. J Am Coll Cardiol. 2018;72:2841–2855.
+
+10. Safdar B, Spatz ES, Dreyer RP, Beltrame JF, Lichtman JH, Spertus JA,
+Reynolds HR, Geda M, Bueno H, Dziura JD, Krumholz HM, D'Onofrio G.
+
+Presentation, clinical profile, and prognosis of young patients with myocardial infarction with nonobstructive coronary arteries (MINOCA): results from the VIRGO study. J Am Heart Assoc. 2018;7:e009174. DOI: 10.1161/JAHA.118.
+
+009174.
+
+11. Agewall S, Beltrame JF, Reynolds HR, Niessner A, Rosano G, Caforio AL, De Caterina R, Zimarino M, Roffi M, Kjeldsen K, Atar D, Kaski JC, Sechtem U,
+Tornvall P; WG on Cardiovascular Pharmacotherapy. ESC working group position paper on myocardial infarction with non-obstructive coronary arteries.
+
+Eur Heart J. 2017;38:143–153.
+
+Key Words: Editorials - acute coronary syndrome - acute myocardial infarction - coronary angiography - coronary artery

medical/md/PMC6683915.md

@@ -0,0 +1,251 @@
+# Value Of Immune Factors For Monitoring Risk Of Lung Cancer In Patients With Interstitial Lung Disease
+
+Journal of International Medical Research
+
+![0_image_0.png](0_image_0.png)
+
+2019, Vol. 47(7) 3344–3353
+! The Author(s) 2019 Article reuse guidelines:
+sagepub.com/journals-permissions DOI: 10.1177/0300060519847403 journals.sagepub.com/home/imr Ning Li*, Haisheng Hu*, Ge Wu* and Baoqing Sun Abstract Objective: Patients with interstitial lung disease (ILD) are at increased risk of developing lung cancer. We aimed to investigate the clinical significance of serum immune factors in this progression. Methods: We retrospectively screened a hospital database from January 2012 to December 2016 for patients with lung cancer and ILD. We measured serum levels of C3, C4, IgA, IgG, IgM, C-reactive protein (CRP), ceruloplasmin (CER), and rheumatoid factor in these patients and in healthy controls. Results: We analyzed data for 262 patients with lung cancer, 220 with ILD, and 57 healthy controls. CER levels were significantly higher in patients with lung cancer (0.35  0.10 g/L) compared with both ILD patients (0.31  0.25 g/L) and healthy individuals (0.25  0.04 g/L). C3 and C4 levels were both significantly higher in healthy individuals compared with patients with lung cancer (C3: 1.70  0.29 vs 1.04  0.26 g/L, C4: 0.27  0.24 vs 0.24  0.09 g/L) and ILD
+(C3: 1.70  0.29 vs 0.97  0.25 g/L, C4: 0.27  0.24 vs 0.21  0.09 g/L). Optimal scaling analysis demonstrated that lung cancer was closely associated with CRP, CER, C3, and C4. Conclusions: Increased levels of CRP and CER and decreased levels of C3 and C4 may identify patients with ILD at high risk of developing lung cancer.
+
+Department of Allergy and Clinical Immunology, Guangzhou Institute of Respiratory Health, State Key Laboratory of Respiratory Disease, National Clinical Research Center for Respiratory Disease, First Affiliated Hospital of Guangzhou Medical University, Guangzhou 510120, Guangdong, China Corresponding author: Baoqing Sun, State Key Laboratory of Respiratory Disease, First Affiliated Hospital of Guangzhou Medical University, 151 Yanjiangxi Road, Guangzhou 510120, Guangdong, China. Email: sunbaoqing@vip.163.com Creative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (http://www.creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).
+
+## Keywords Lung Cancer, Interstitial Lung Disease, Immune Factor, Risk Factor, C-Reactive Protein, Ceruloplasmin, C3, C4
+
+Date received: 18 September 2018; accepted: 5 April 2019 Lung cancer is the leading cause of cancerrelated death and accounted for an estimated 1.59 million cases worldwide in 2012.1,2 Mortality rates due to lung cancer are still increasing in China, with a large proportion of patients diagnosed at an advanced stage, resulting in delayed treatment.1,3 Similar pathological mechanisms have been shown to underlie the occurrence of lung cancer and interstitial lung diseases (ILDs), including the inflammatory response, abnormal coagulation, dysregulated apoptosis, and the accumulation of myofibroblasts and extracellular matrix.4,5 In addition, patients with ILD have an increased risk and incidence of progression to lung cancer. One study found that >30% of patients with ILD developed lung cancer,6,7 while a multicenter study showed that patients with ILD had a 7–14-fold risk of developing lung cancer compared with the general population.8 Furthermore, the mortality of patients with lung cancer developed from ILD is higher than that of patients diagnosed with lung cancer alone, with shorter survival and poorer quality of life.9 This can adversely affect the diagnosis and treatment of the diseases and result in long-term economic burdens to the patient's family in low-income countries. It is therefore necessary to understand the difference and association between ILD and lung cancer. However, clinical information regarding the comparison between ILD and lung cancer is currently limited, including in relation to levels of serum immune factors in patients with these respective diseases.
+
+A retrospective study found that rheumatoid factor (RF) positivity was closely correlated with ILD,10 and complement has been reported to play a role in the diagnosis or prognosis of lung cancer;11,12 however, current studies of complement in patients with ILD are lacking.
+
+This study therefore examined levels of serum immune factors in patients with ILD and patients with lung cancer, as well as in healthy individuals, and compared the results among these three populations. The results will provide support for the diagnosis and treatment for ILD and for evaluating the risk of progression to lung cancer.
+
+Methods
+
+## Ethical Statement
+
+This study was approved by the Institutional Review Board of the First Affiliated Hospital (GYFYY-2008-02-23) of Guangzhou Medical University. The use of human serum samples was carried out in accordance with Chinese legislation and with written informed consent from the donors, their legal guardians, or next of kin, where applicable, for use of the serum samples for future unspecified research purposes.
+
+Study subjects This study was a retrospective analysis of the database generated by the Clinical Laboratory of the First Affiliated Hospital of Guangzhou Medical University, from January 2012 to December 2016.
+
+We screened the database for patients clinically diagnosed with lung cancer or ILD
+(including connective tissue diseaseassociated ILD, idiopathic interstitial pneumonia, and sarcoidosis) who had also undergone detection of complement component 3 (C3), complement component 4
+(C4), immunoglobulin A (IgA), immunoglobulin G (IgG), immunoglobulin M
+(IgM), ceruloplasmin (CER), C-reactive protein (CRP), and rheumatoid factor
+(RF). Healthy age- and sex-matched volunteers were recruited from the First Affiliated Hospital of Guangzhou Medical University.
+
+Diagnosis of lung cancer and ILD
+A diagnosis of lung cancer was made based on clinical records, including information on clinical symptoms established by respiratory clinicians, and the results of physical examinations such as chest X-ray and computed tomography scanning.13 Patients who met at least three of the following criteria were clinically diagnosed with ILD:14,15 1)
+polypnea after physical activity or at rest; 2)
+cough or Velcro rales; 3) interstitial pulmonary lesions consistent with imaging results
+(chest X-ray or high-resolution computed tomography), such as honeycombing, ground-glass opacity, lobular interval thickening of peripheral lung; 4) restrictive ventilatory disorder and/or pulmonary exchange dysfunction according to pulmonary function tests (% forced vital capacity,
+% forced expiratory volume in 1 second, % total lung capacity, % inspiratory capacity, % diffusing capacity of the lungs for carbon monoxide); and 5) pulmonary pathology meeting the 2002 European Society Diagnostic Criteria.
+
+Blood sample testing
+
+## Concentrations Of Serum Immune Factors Including C3, C4, Iga, Igg,
+
+IgM, and CER were measured by immunoturbidimetry using an IMMAGE 800
+(Beckman Coulter, Brea, CA, USA). CRP and RF concentrations were measured by immunonephelometry using an AU5800 Clinical Chemistry Analyzer (Beckman Coulter). On the basis of the clinical laboratory system used by the First Affiliated Hospital of Guangzhou Medical University, concentrations of CER 0.42 g/L, CRP
+0.6 mg/L, and RF 20 IU/mL were considered to be abnormally high.
+
+Statistical analysis Statistical analysis was performed using IBM SPSS Statistics for Windows, Version 22.0 (IBM Corp., Armonk, NY, USA).
+
+Numerical data were expressed as percentages, and parametric quantitative data for age and serum C3, C4, CER, CRP, RF, IgA, IgG, and IgM were presented as mean  standard deviation. Differences among the three groups were analyzed using the non-parametric Kruskal–Wallis test. Optimal scaling was carried out by categorical principal component analysis.
+
+Briefly, optimal scaling quantifies categorical data by assigning numerical values to the categories, resulting in an optimal linear regression equation for the transformed variables. When the calculated data are plotted on a two-dimensional graph, the distance between two points represents the strength of the correlation between the two factors (i.e., a shorter distance between two points indicates a higher correlation). A value of P < 0.05 was considered to be statistically significant.
+
+Results
+
+## Patients
+
+A total of 539 subjects (271 men, 268 women, age 25–72 years) were included in this study, comprising 262 patients with lung cancer, 220 with ILD, and 57 healthy controls. Detailed patient information is presented in Table 1.
+
+Abnormal levels of CER, CRP, and RF in patients with lung cancer and ILD
+
+## Within The Lung Cancer And Ild Groups,
+
+more patients had increased levels of CRP (160/262, [61.1%] and 97/220 [45.5%], respectively) compared with increased levels of either CER or RF. Similarly, the numbers of patients with increased CRP levels alone were highest in both patient groups (80/262 [30.5%] and 56/220 [25.5%], respectively). A significantly higher proportion of patients with lung cancer had increased levels of CER compared with patients with ILD (24.1% vs 2.3%, respectively; (v2 ¼ 4.16, P ¼ 0.041).
+
+In terms of multiple abnormal factors, more patients with lung cancer had increased levels of both CRP and CER
+(n ¼ 42, 16.03%), while more patients with ILD had elevated levels of both CRP and RF (n ¼ 56, 17.27%), however, these differences were not significant (Figure 1).
+
+## Comparisons Of Immune Factor Among Patients With Lung Cancer Or Ild And Healthy Individuals Levels Of Immune Factors Are Presented In Table 2. Crp And Cer Levels Were
+
+Table 1. Characteristics of patients with lung cancer, patients with interstitial lung disease, and healthy individuals. Characteristic LC ILD Normal
+
+| Total (n)                                                                                           | 262     | 220    | 57    |
+|-----------------------------------------------------------------------------------------------------|---------|--------|-------|
+| Age (y)                                                                                             | 58.63  13.46         | 57.74  11.74        | 56.53  12.62       |
+| Sex (male/female)                                                                                   | 154/108 | 89/131 | 28/29 |
+| BMI (kg/m2 )                                                                                        | 22.08  1.2         | 24.7  2.9        | 24.5  3.2       |
+| Cough (%)                                                                                           | 43.9%   | 68.1%  | 0.0%  |
+| Hospitalization (%)                                                                                 | 100.0%  | 87.4%  | 0.0%  |
+| Combined with rheumatoid arthritis (%)                                                              | 32.1%   | 42.7%  | 0.0%  |
+| LC: lung cancer, ILD: interstitial lung disease, Normal: healthy individuals, BMI: body mass index. |         |        |       |
+
+![3_image_0.png](3_image_0.png)
+
+20 IU/mL were considered to be abnormally increased. CER: ceruloplasmin, CRP: C-reactive protein, RF:
+rheumatoid factor.
+
+| CRP (mg/L)   | 3.34  5.07   | 1.83  3.14   | 0.23  0.34   | <0.001   |
+|--------------|---|---|---|----------|
+| CER (g/L)    | 0.35  0.10   | 0.31  0.25   | 0.25  0.04   | <0.001   |
+| RF (IU/mL)   | 18.58  43.47   | 55.46  83.80   | 6.23  2.03   | <0.001   |
+| C3 (g/L)     | 0.97  0.25   | 1.04  0.26   | 1.70  0.29   | <0.001   |
+| C4 (g/L)     | 0.21  0.09   | 0.24  0.09g   | 0.27  0.24   | <0.001   |
+| IgG (g/L)    | 13.42  7.56   | 14.38  5.98   | 8.63  1.55   | <0.001   |
+| IgA (g/L)    | 2.81  1.57   | 2.78  1.53   | 2.58  1.00   | 0.96     |
+| IgM (g/L)    | 1.22  0.72   | 1.32  0.96   | 1.17  0.59   | 0.77     |
+| Data expressed as mean  standard deviation and differences between groups analyzed by Kruskal–Wallis test. P < 0.05 was considered significant. LC: lung cancer, ILD: interstitial lung disease, Normal: healthy individuals, CRP: C-reactive protein, CER: ceruloplasmin, RF: rheumatoid factor.              |   |   |   |          |
+
+significantly higher in patients with lung cancer compared with ILD patients and healthy individuals (Kruskal–
+Wallis ¼ 72.92 and 74.59, respectively, both P < 0.001) (Figure 2a, 2b). In contrast, RF levels were significantly higher in patients with ILD compared with lung cancer patients and healthy individuals
+(Kruskal–Wallis ¼ 39.08, P < 0.001)
+(Figure 2c). Furthermore, C3 levels were significantly higher in healthy individuals compared with ILD and lung cancer patients (Kruskal–Wallis ¼ 137.0, P < 0.001) (Figure 2d), and a similar trend was observed for levels of C4 (Kruskal–
+Wallis ¼ 74.59, P < 0.001), but there was no significant difference between ILD patients and healthy individuals for C4 (Figure 2e). Additionally, both lung cancer and ILD patients had significantly higher IgG concentrations than healthy individuals (Kruskal–Wallis ¼ 99.33, P < 0.001)
+(Figure 2f), but there were no differences among the three groups in levels of IgA or IgM (Figure 2g, 2h).
+
+Optimal scaling of immune factors in lung cancer and ILD
+
+## Optimal Scaling Demonstrated That The Immune Factors Rf And Igm Were Closely Associated With The Occurrence Of Ild,
+
+while CRP, CER, C3, and C4 were closely associated with the occurrence of lung cancer (Cronbach's alpha ¼ 84.7%)
+(Figure 3). Simultaneous abnormalities in serum levels of CRP, CER, C3, and C4 may thus be associated with the risk of developing lung cancer.
+
+Discussion ILD, first reported in 1975, comprises several disorders with varying clinical presentations. The incidence of ILD continues to increase year on year. ILD is associated not only with a high risk of progression to lung cancer, but is also a significant predictor of a poor prognosis of lung cancer.16,17 Immune factors can reflect the association between lung cancer and ILD.8 We therefore detected levels of the immune factors C3, C4, IgA, IgG, IgM, CER, CRP, and RF in patients with lung cancer or ILD and in healthy controls, and found that lung cancer and ILD patients were most likely to have elevated levels of CRP, as an important indicator of the inflammatory response (61.1% and 45.5% of patients, respectively). Following an inflammatory response, repeated cell injury and repair can increase the risk of abnormal proliferation of epithelial cells in the airway in ILD, ultimately resulting in their
+
+![5_image_0.png](5_image_0.png)
+
+LC: lung cancer (n ¼ 262), ILD: interstitial lung disease (n ¼ 220), normal: healthy individuals (n ¼ 57), CER:
+ceruloplasmin, CRP: C-reactive protein, RF: rheumatoid factor.
+transformation into invasive and metastatic cancer cells.18 IgG is also an inflammatory indicator, and our results showed that IgG levels were significantly elevated in both lung cancer and ILD patients compared with healthy individuals. Jiang et al.19 reported that lung cancer-produced IgG is likely to play an important role in cancer growth and metastasis. However, the role of IgG in ILD is still not clear. The increased levels of IgG in ILD patients detected in the current study indicated that IgG may contribute to the progression of ILD to lung cancer, and suggest that CRP and IgG levels should be monitored in patients with ILD.
+
+Levels of complement components were lower in patients with lung cancer or ILD compared with healthy individuals in the present study. C3 and C4 are important components of the complement activation process, and the similar defects in these complement components in both lung cancer and ILD patients may reflect the mechanisms underlying the progress of the diseases. A previous study demonstrated that levels of C3 declined during disease progression in patients with non-small cell
+
+Figure 3. Optimal scaling analysis of immune factors in patients with lung cancer and patients with ILD. Shorter distance between dots indicates a stronger correlation between the disease and the corresponding factor (Cronbach's alpha ¼ 84.7%). LC: lung cancer (n ¼ 262), ILD: interstitial lung disease (n ¼ 220), CER:
+ceruloplasmin, CRP: C-reactive protein, RF: rheumatoid factor
+
+![6_image_0.png](6_image_0.png)
+
+lung cancer, suggesting that C3 may have anti-tumor and anti-cancer activities.20,21 Monitoring complement components in patients with ILD may help to assess the risk of disease progression to lung cancer.
+
+Other physiological indicators differ between patients with lung cancer and patients with ILD. For example, plasma CER levels were 4.6-times higher in patients with lung cancer compared with patients with other lung diseases.22 Ninety-five percent of the plasma copper is present in CER.23 As the main oxidase, it is involved in a series of oxidation reactions, including iron and amine metabolism, which mainly occur in the blood.24,25 Activity of the CER
+oxidase and serum copper concentrations were significantly higher in patients with various types of cancer compared with normal individuals.25 We accordingly found that CER levels were significantly higher in patients with lung cancer compared with ILD patients (P < 0.001).
+
+Copper overload in lung cancer patients leads to increased production of CER to participate in a series of oxidation reactions, which can generate abundant reactive oxygen species that can in turn induce cell apoptosis via activation of the calpain and caspase-3 pathway, ultimately leading to tissue damage.26 Damage induced by copper overload is an underlying pathology in many diseases, including cancer and cirrhosis. Oxidative stress has been shown to be significantly increased in patients with advanced lung cancer, while levels of antioxidant molecules were decreased.27 In addition, copper is a basic component in cancer metastasis, and many studies of tumor latency have shown that copper consumption can reduce the proliferation, growth, metastasis, and blood supply to cancer cells.28 Relevant animal studies demonstrated that CER protein and mRNA
+levels were increased in GPrc5a (an antioncogene) knockout compared with normal mice, and CER expression was also increased in lung neoplasms.29 The level of CER may thus reflect the growth status and metastasis of lung cancer, suggesting that monitoring CER levels may aid the diagnosis and clinical observation of lung cancer patients.
+
+The current results also revealed that RF
+levels were significantly higher in ILD compared with lung cancer patients, which was in turn significantly higher than in healthy individuals (P < 0.05). RF is an IgM autoantibody with a high detection rate in patients with rheumatoid arthritis.5 A UK
+cohort study showed that, among 1460 patients with rheumatoid arthritis, 25% had ILD and a further 25% developed ILD within 3 years following the diagnosis of rheumatoid arthritis.14 We therefore hypothesized that rheumatoid arthritis–
+ILD–lung cancer may represent a novel disease process.
+
+Finally, optimal scaling showed that ILD was closely associated with RF and IgM while lung cancer was closely associated with CRP, CER, C3, and C4. This was similar to the findings of Aref and Refaat, who indicated that the increases in CRP and CER and decreases in C3 and C4 in lung cancer patients were possibly due to the continuous inflammatory response, decreased complement component function, and increased blood plasma copper in these patients.30 Elevated CRP reflects the inflammatory response, while decreased levels of C3 and C4 reflect defects in complement component functions.18,20 Given that IgM plays a vital role in autoimmune diseases, we speculate that the development of ILD may be closely related to autoimmune diseases.
+
+The major limitation of this study was the lack of follow-up data for the patients, which therefore prevented us from investigating dynamic changes in the immune factors during the transition from ILD to lung cancer. Furthermore, we had no data on exposure to other risk factors for lung cancer (e.g., smoking, toxins, family history) and were therefore unable to account for these factors in this study. Further studies involving long-term observations of immune factors together with detailed information on exposure to lung cancer risk factors are therefore required.
+
+Conclusions Patients with lung cancer or ILD have lower levels of C3 and C4 and higher levels of CRP compared with healthy individuals. In addition, ILD was associated with elevated levels of RF while lung cancer was associated with increased CER compared with healthy individuals. Clinical monitoring of CER may thus support the diagnosis and monitoring of patients with lung cancer. CRP, CER, C3, and C4 were also closely associated with the development of lung cancer, suggesting that patients with ILD with simultaneously elevated levels of CRP and CER and decreased levels of C3 and C4 should be considered to be at potentially increased risk of progression to lung cancer. Declaration of conflicting interest
+
+## The Authors Declare That There Is No Conflict Of Interest.
+
+Funding This study was funded by the National Natural Science Foundation of China (Project No.: 81871736), Bureau of Traditional Chinese Medicine Scientific Research Project of Guangdong (Project No.: 20192048), Science and Technology Innovation Committee Project of Guangzhou (Project No.: 201831802), and Open Project of State Key Laboratory of Respiratory Disease (Project No.: SKLRD-OP-
+ORCID iD
+References 1. He Y, Li D, Song G, et al. Lung cancer burden has increased during the last 40 years in Hebei Province, China. Thoracic Cancer 2016; 7: 323–332.
+
+2. Suh WN, Kong KA, Han Y, et al. Risk factors associated with treatment refusal in lung cancer. Thoracic Cancer 2017; 8: 443–450.
+
+3. Chen W, Zheng R, Baade PD, et al. Cancer statistics in China, 2015. CA Cancer J Clin 2016; 66: 115–132.
+
+4. Archontogeorgis K, Steiropoulos P,
+Tzouvelekis A, et al. Lung cancer and interstitial lung diseases: a systematic review.
+
+Pulmonary Medicine 2012; 2012: 315918.
+
+5. Richards TJ, Eggebeen A, Gibson K, et al.
+
+Characterization and peripheral blood biomarker assessment of anti-Jo-1 antibodypositive interstitial lung disease. Arthritis Rheum 2009; 60: 2183–2192.
+
+6. Sato T, Watanabe A, Kondo H, et al. Longterm results and predictors of survival after surgical resection of patients with lung cancer and interstitial lung diseases.
+
+J Thorac Cardiovasc Surg 2015; 149: 64–69, 70.e1-2.
+
+7. Miyazaki K, Satoh H, Kurishima K, et al.
+
+Interstitial lung disease in patients with small cell lung cancer. Med Oncol 2010; 27: 763–767.
+
+8. Bouros D, Hatzakis K, Labrakis H, et al.
+
+Association of malignancy with diseases causing interstitial pulmonary changes.
+
+Chest 2002; 121: 1278–1289.
+
+9. Enomoto Y, Inui N, Yoshimura K, et al.
+
+Lung cancer development in patients with connective tissue disease–related interstitial lung disease: a retrospective observational study. Medicine 2016; 95: e5716.
+
+10. Zhang Y, Li H, Wu N, et al. Retrospective study of the clinical characteristics and risk factors of rheumatoid arthritis-associated interstitial lung disease. Clin Rheumatol 2017; 36: 817–823.
+
+11. Ajona D and Razquin C, Elevated levels of the complement activation product C4d in bronchial fluids for the diagnosis of lung cancer. PLoS One 2015; 10: e0119878.
+
+12. Lin K, He S, He L, et al. Complement component 3 is a prognostic factor of non‑small cell lung cancer. Mol Med Rep 2014; 10: 811–817.
+
+13. Wender R, Fontham ETH, Barrera E, et al.
+
+American Cancer Society lung cancer screening guidelines. CA Cancer J Clin 2013; 63: 107–117.
+
+14. Cavagna L, Monti S, Grosso V, et al. The multifaceted aspects of interstitial lung disease in rheumatoid arthritis. Biomed Res Int 2013; 2013: 759760.
+
+15. Demedts M and Costabel U. ATS/ERS
+international multidisciplinary consensus classification of the idiopathic interstitial pneumonias. Eur Respir J 2002; 19: 794–796.
+
+16. Lee SJ, Lee J, Park YS, et al. Impact of smoking on mortality of patients with nonsmall cell lung cancer. Thoracic Cancer 2014; 5: 43–49.
+
+17. Lopez-Campos JL and Rodr  ıguez-Becerra E.
+
+Incidence of interstitial lung diseases in the south of Spain 1998-2000: the RENIA study. Eur J Epidemiol 2004; 19: 155–161.
+
+18. Bestaev DV, Karateev DE and Nasonov EL.
+
+Diagnosis and problems in therapy of interstitial lung disease associated with rheumatoid arthritis. TerArkh 2013; 85: 84–91.
+
+19. Jiang C, Huang T, Wang Y, et al.
+
+Immunoglobulin G expression in lung cancer and its effects on metastasis. PLoS
+One 2014; 9: e97359.
+
+20. Tomeczko J, Napora P, Dlubek D, et al.
+
+Adjuvant spleen ultrafiltrate immunotherapy in unresectable advanced non-small cell lung cancer. Arzneimittel-Forschung 1997; 47: 1411–1416.
+
+21. Merle NS, Church SE, Fremeauxbacchi V,
+et al. Complement system part I - molecular mechanisms of activation and regulation. Front Immunol 2015; 6: 262.
+
+22. Ahn YH, Ji ES, Oh NR, et al. Differential proteomic approach for identification and verification of aberrantly glycosylated proteins in adenocarcinoma lung cancer Baoqing Sun https://orcid.org/0000-00021671-0723
+(ADLC) plasmas by lectin-capturing and targeted mass spectrometry. J Proteomics 2014; 106: 221–229.
+
+23. Chan N, Willis A, Kornhauser N, et al.
+
+Influencing the tumor microenvironment: a phase II study of copper depletion using tetrathiomolybdate in patients with breast cancer at high risk for recurrence and in preclinical models of lung metastases. Clin Cancer Res 2017; 23: 666–676.
+
+24. Cortes L, Roberts BR, Wedd AG, et al.
+
+Molecular aspects of a robust assay for ferroxidase function of ceruloplasmin. Inorg Chem 2017; 56: 5275–5284.
+
+25. Zowczak M, Iskra M, Paszkowski J, et al.
+
+Oxidase activity of ceruloplasmin and concentrations of copper and zinc in serum of cancer patients. J Trace Elem Med Biol 2001; 15: 193–196.
+
+26. Arnal N, de Alaniz MJ and Marra CA.
+
+Cytotoxic effects of copper overload on human-derived lung and liver cells in culture. Biochim Biophys Acta 2012; 1820: 931–939.
+
+27. Esme H, Cemek M, Sezer M, et al. High levels of oxidative stress in patients with advanced lung cancer. Respirology 2008; 13: 112–116.
+
+28. Fouani L, Menezes SV, Paulson M, et al.
+
+Metals and metastasis: exploiting the role of metals in cancer metastasis to develop novel anti-metastatic agents. Pharmacol Res 2017; 115: 275–287.
+
+29. Sun B, Guo W, Hu S, et al. Gprc5a-knockout mouse lung epithelial cells predicts ceruloplasmin, lipocalin 2 and periostin as potential biomarkers at early stages of lung tumorigenesis. Oncotarget 2017; 8: 13532–13544.
+
+30. Aref H and Refaat S. CRP evaluation in non-small cell lung cancer. Egypt J Chest Dis Tuberc 2014; 63: 717–722.

medical/md/PMC6787764.md

@@ -0,0 +1,421 @@
+Cephalalgia
+
+![0_image_0.png](0_image_0.png)
+
+![0_image_1.png](0_image_1.png)
+
+2019, Vol. 39(8) 957–966
+! International Headache Society 2019 Article reuse guidelines:
+sagepub.com/journals-permissions DOI: 10.1177/0333102419855080 journals.sagepub.com/home/cep
+
+# Safety Findings From Phase 3 Lasmiditan Studies For Acute Treatment Of Migraine: Results From Samurai And Spartan
+
+John H Krege1, Paul B Rizzoli2, Emily Liffick1, Erin G Doty1, Sherie A Dowsett1, Jianing Wang1 and Andrew S Buchanan1
+
+## Abstract
+
+Background: We assessed the safety profile of lasmiditan, a selective 5-HT1F receptor agonist without vasoconstrictive activity being developed as an acute therapy for migraine.
+
+Methods: SAMURAI and SPARTAN were Phase 3 double-blind studies of patients with migraine, randomized to oral lasmiditan 50 mg (SPARTAN only), 100 mg, 200 mg, or placebo to be taken within 4 hours of onset of migraine pain.
+
+Safety data from the studies were integrated. Treatment-emergent adverse events (occurring within 48 hours of first dose) were considered in the analyses. Results: The safety population comprised 1262 patients assigned placebo, and 654, 1265, and 1258 assigned lasmiditan 50 mg, 100 mg, and 200 mg, respectively. There were no deaths; serious adverse events were reported for seven patients
+(placebo, n ¼ 2 [0.2%]; lasmiditan 50 mg, n ¼ 1 [0.2%]; lasmiditan 100 mg, n ¼ 1 [0.2%]; lasmiditan 200 mg, n ¼ 3 [0.2%]).
+
+Patients reporting - 1 treatment-emergent adverse events were: Placebo, n ¼ 174 (13.5%); lasmiditan 50 mg, n ¼ 166
+(25.4%); lasmiditan 100 mg, n ¼ 458 (36.2%); and lasmiditan 200 mg, n ¼ 510 (40.6%). Treatment-emergent adverse events were generally mild or moderate in severity. The most common treatment-emergent adverse events with lasmiditan were dizziness, paresthesia, somnolence, fatigue, nausea, muscular weakness and hypoesthesia. There were no ischemic events.
+
+Conclusions: As a centrally-penetrant drug, lasmiditan use was associated with neurologic treatment-emergent adverse events; most were mild or moderate in severity and self-limiting. Trial registration at clinicaltrials.gov: SAMURAI (NCT02439320) and SPARTAN (NCT02605174).
+
+## Keywords
+
+Lasmiditan, safety, phase 3 Date received: 26 March 2019; revised: 22 April 2019; 6 May 2019; accepted: 14 May 2019
+
+## Introduction
+
+Lasmiditan is a centrally-penetrant, highly selective, 5-HT1F receptor agonist being developed as an acute therapy for migraine (1).
+
+Two Phase 3 single migraine attack studies of lasmiditan, SAMURAI and SPARTAN, have been completed (2,3). In these studies, treatment with oral lasmiditan at all doses resulted in a significant increase in the proportion of patients who were headache painfree (primary endpoint) and most bothersome symptom
+(MBS)-free (key secondary endpoint) at 2 hours.
+
+In both studies, the overall incidence of adverse events was higher with lasmiditan versus placebo and increased with increasing lasmiditan dose.
+
+Adverse events (AEs) were generally mild or moderate in severity. The most frequently reported adverse events with lasmiditan were dizziness, fatigue, lethargy, nausea, paresthesia, and somnolence; the incidence of cardiovascular-related treatment-emergent adverse events (TEAEs) was low.
+
+1Eli Lilly and Company, Indianapolis, IN, USA
+2Brigham and Women's Faulkner Hospital, Boston, MA, USA
+Corresponding author:
+John H Krege, Eli Lilly and Company, Indianapolis, IN 46220, USA. Email: krege_john_henry@lilly.com SAMURAI and SPARTAN were nearly identical in design and provide data from 4439 patients with migraine. The purpose of this paper is to describe the safety profile of lasmiditan using pooled data from SAMURAI and SPARTAN.
+
+## Methods Study Designs
+
+SAMURAI (2) and SPARTAN (3) were randomized, double-blind, placebo-controlled Phase 3 trials for acute treatment of migraine, conducted in the United States, and, in the case of SPARTAN, the UK and Germany also. The studies were almost identical in design; SAMURAI, but not SPARTAN, excluded individuals with known coronary artery disease, clinically significant arrhythmia, and uncontrolled hypertension.
+
+Key inclusion criteria were a Migraine Disability Assessment score -11 (moderate or severe disability),
+a history of migraine -1 year, 3–8 migraine attacks/
+month, and migraine onset at <50 years of age. There was no upper age limit for study inclusion.
+
+Patients were randomized equally to receive the first dose of lasmiditan 50 mg (SPARTAN only), 100 mg, 200 mg, or placebo. Patients were instructed to take the study drug on an outpatient basis within 4 hours of onset of a migraine pain of at least moderate severity and not improving. If needed for rescue or recurrence, a second dose was taken 2 to 24 hours after first dose. For the second dose, patients initially assigned lasmiditan were randomized to the same active dose or placebo (2:1 ratio), and patients originally assigned placebo received placebo.
+
+Since somnolence, dizziness and fatigue have been documented with lasmiditan, study participants were advised not to drive or operate machinery for 12 hours after treatment.
+
+The primary and key secondary endpoints in SAMURAI and SPARTAN were, respectively, the proportion of patients who were headache pain-free and the proportion who were MBS-free at 2 hours post-first dose.
+
+The studies were conducted in accordance with the International Conference on Harmonization Good Clinical Practice guidelines, and local regulatory requirements. The study protocols were approved by an independent ethics committee or institutional review board at each study site. All patients provided written informed consent for study participation prior to the start of the study. This paper conforms to the extended CONSORT guidelines.
+
+## Safety Data Collection And Adverse Event Coding
+
+At 0.5, 1, 1.5, 2, 3, 4, 24, and 48 hours after the first dose (and again, if taken, at the same intervals after a second dose of the study drug), an electronic diary asked: ''Do you feel anything unusual since taking the study medication that you have not felt with a migraine before?'' If the patient answered ''yes'', they were to receive a call from the site within 48 hours to determine if an AE had been experienced. AEs that occurred or worsened within 48 hours of dosing were considered treatment-emergent. Severity of an AE was recorded by the site, based on patient reporting, with the following severity definitions provided to guide the reporting:
+Mild - usually transient, does not interfere with the subject's daily activities; Moderate - low level of inconvenience or concern to the subject and may interfere with daily activities; Severe - interrupts the subject's daily activities; Life-threatening.
+
+The Columbia Suicide Severity Rating Scale
+(C-SSRS), a suicidal ideation and behavior rating scale, was administered at baseline and endpoint.
+
+Vital sign assessment, clinical laboratory tests, and 12-lead ECG assessment were also performed at baseline and at the end of the study. The end of study visit was scheduled by the patient for one week after a migraine attack had been treated.
+
+Because lasmiditan is an agonist at the serotonin 1F
+receptor, medical review was performed to assess for possible cases of serotonin syndrome in patients assigned lasmiditan. Potential cases of serotonin syndrome were identified through a search for TEAEs within the Standardised MedDRA Queries (SMQ) of Neuroleptic Malignant Syndrome (SMQ 20000044; v21.0) and the additional terms of orthostatic hypotension, urinary incontinence, urinary retention, oesophageal dysmotility, gastroparesis, diarrhoea, faecal incontinence, constipation, muscle twitching, muscle stiffness, and muscle spasm. Cases for which one or more of these events were reported were medically reviewed by three physicians at Eli Lilly and Company to determine whether they met Hunter Criteria, considering associated AEs, timing of AEs, severity, seriousness, concomitant medications, and medical history.
+
+## Outcome Measures
+
+At baseline, 0.5, 1, 2, 3, 4, 24, and 48 hours after dosing, patients were asked to rate their headache pain as none, mild, moderate, or severe. Additionally, they were asked whether they were experiencing nausea, phonophobia, photophobia, or vomiting. If they had nausea, phonophobia, or photophobia, at baseline they were asked to identify which of these was their most bothersome migraine associated symptom. Patients were asked the following questions: a) At all time points, ''How much is your migraine interfering with your usual activities?'' (responded using a four-point numeric rating); and b) at 2 hours, the Patient Global Impression of Change (PGIC) question (4), ''How do you feel after taking study medication?'' (responded using a seven-point Likert scale from ''very much better'' to ''very much worse''). The PGIC is an integrated measure of drug tolerability and efficacy.
+
+## Statistical Analysis
+
+The safety population was defined as all patients who were randomized and received at least one dose of study medication. A TEAE was defined as an AE
+that first occurred or worsened in severity from baseline within 48 hours of the first dose of study drug, regardless of whether a second dose was taken.
+
+The number and percentage of patients who reported TEAEs, coded using MedDRA- Preferred Term, were summarized by randomized lasmiditan treatment groups (lasmiditan 50 mg, 100 mg, 200 mg, placebo), for all lasmiditan dose groups combined (lasmiditan pooled dose group), and for the placebo group.
+
+Statistical comparisons were made between the all lasmiditan doses combined and placebo. The CochranMantel-Haenszel test stratified by study was used for treatment comparisons of percentages.
+
+The time to onset and duration of individual common TEAEs ( - 2% incidence in any lasmiditan dose group) were summarized. Only events for which the relevant information was available (start and stop times/dates, and dosing start times/dates) were considered in these analyses. For patients with multiple events falling under the same Preferred Term, the time to onset and duration for all treatment-emergent occurrences of that term were averaged.
+
+To determine whether there was a relationship between reporting of individual common TEAEs and outcomes, the percentages of those assigned lasmiditan who reported a) being pain free; b) being MBS free; c) no interference with normal activities or d) feeling ''very much better'' and ''much better'' on PGIC at 2 hours after dosing were calculated for those who reported the common TEAE and those who did not.
+
+## Results Patient Disposition, Baseline Demographics And Study Drug Exposure
+
+The integrated safety database included a total of 4439 patients who received at least one dose of study drug
+(placebo, n ¼ 1262; lasmiditan, n ¼ 3177). Of those who received a study dose, 97% assigned either placebo or to a lasmiditan dose group completed the study (i.e. all required follow-ups).
+
+Baseline demographics are summarized in Table 1.
+
+Medical history or pre-existing conditions occurring in- 10% in at least one treatment group were seasonal allergy, depression, drug hypersensitivity, headache, hypertension, anxiety, gastroesophageal reflux disease, hysterectomy, female sterilization, asthma, back pain, insomnia, obesity, and postmenopause.
+
+A summary of drug exposure (one or two doses) is shown in Table 2. A higher percentage of patients assigned placebo took a second dose compared to those in any of the lasmiditan treatment groups. The majority of second doses (about 94%) were taken for rescue.
+
+## Adverse Event Summary
+
+Adverse event findings are summarized by dose group in Table 3. There were no deaths reported and treatment-emergent serious adverse events were reported for
+
+| Table 1. Baseline demographics.                                         | Lasmiditan pooled doses (n ¼ 3177)   |             |
+|-------------------------------------------------------------------------|--------------------------------------|-------------|
+| Placebo (n ¼ 1262)                                                      |                                      |             |
+| Age, years, mean (SD)                                                   | 42.4 (12.5)                          | 42.2 (12.3) |
+| Female (%)                                                              | 85                                   | 84          |
+| BMI  30 kg/m2 (%)                                                                         | 46                                   | 43          |
+| Race (%) Black/African-American                                         | 18                                   | 18          |
+| Caucasian                                                               | 79                                   | 78          |
+| Hispanic or Latino ethnicity                                            | 17                                   | 18          |
+| Region (%) Europe                                                       | 8                                    | 10          |
+| North America                                                           | 92                                   | 90          |
+| Duration migraine history, years, mean (SD)                             | 18.7 (12.7)                          | 18.9 (13.0) |
+| Migraine attacks/                                                       | 5.2 (2.2)                            | 5.1 (2.0)   |
+| month, mean (SD)                                                        |                                      |             |
+| Pre-existing CVDa (%)                                                   | 21                                   | 20          |
+| Baseline CVD risk                                                       | 80                                   | 79          |
+| factor(s)b (%)                                                          |                                      |             |
+| a Presence of one or more of the following: Cardiac arrhythmia, cardiac |                                      |             |
+
+aPresence of one or more of the following: Cardiac arrhythmia, cardiac failure, cardiomyopathy, CNS vascular disorder, embolic or thrombotic event, hypertension, ischemic heart disease, pulmonary hypertension, Torsade de pointes/QT prolongation.
+
+bIdentified based on the American College of Cardiology and American Heart Association Task Force on Practice Guidelines. Risk factors considered were age >40 years, current smoker, systolic blood pressure -140 mm Hg and/or a medical history of hypertension at baseline, total cholesterol -240 mg/dL, HDL cholesterol <40 mg/dL for men and < 50 mg/dL for women, and diabetes mellitus (5,6).
+
+BMI: body mass index; CVD: cardiovascular disease; CNS: central nervous system; HDL: high-density lipoprotein; SD: standard deviation.
+
+| Table 2. Exposure to study drug (received doses). Placebo (n ¼ 1262)   |
+|------------------------------------------------------------------------|
+
+| Lasmiditan 50 mg (n ¼ 654)   |
+|------------------------------|
+
+| Lasmiditan 100 mg (n ¼ 1265)   |
+|--------------------------------|
+
+| Lasmiditan 200 mg (n ¼ 1258)   | Lasmiditan pooled doses (n ¼ 3177)   |
+|--------------------------------|--------------------------------------|
+
+One dose only, n, (%) 500 (40) 352 (54) 716 (57) 802 (64) 1870 (59)
+Two dosesa, n, (%) 762 (60) 302 (46) 549 (43) 456 (36) 1307 (41)
+Placebo 762 96 169 153 Active - 206 380 303 aSecond dose taken for rescue (patient did not achieve headache pain-free status at 2 hours, completed the 2-hour assessments, and took a second dose of study drug between 2 and 24 hours post-first dose) or recurrence (patient achieved headache pain-free status at 2 hours but then experienced recurrence of mild, moderate, or severe migraine pain and took a second dose of study drug up to 24 hours after the first dose).
+
+## Table 3. Overview Of Ae Findings.
+
+| Table 3. Overview of AE findings.   | Lasmiditan 50 mg (n ¼ 654)   | Lasmiditan 100 mg (n ¼ 1265)   | Lasmiditan 200 mg (n ¼ 1258)   | Lasmiditan pooled doses (n ¼ 3177)   |              |
+|-------------------------------------|------------------------------|--------------------------------|--------------------------------|--------------------------------------|--------------|
+| Placebo                             |                              |                                |                                |                                      |              |
+| Number of patients experiencing:    | (n ¼ 1262)                   |                                |                                |                                      |              |
+| Death                               | 0                            | 0                              | 0                              | 0                                    | 0            |
+| 1 treatment emergent SAE                                     | 2 (0.2)                      | 1 (0.2)                        | 1 (0.1)                        | 3 (0.2)                              | 5 (0.2)      |
+| 1 SAE                                     | 3 (0.2)                      | 1 (0.2)                        | 2 (0.2)                        | 5 (0.4)                              | 8 (0.3)      |
+| 1 TEAE                                     | 174 (13.8)                   | 166 (25.4)                     | 458 (36.2)                     | 510 (40.5)                           | 1134 (35.9)* |
+| Discontinuation due to TEAE         | 0                            | 0                              | 0                              | 1 (0.1)a                             | 1 (0)        |
+| Number of patients (%) reported.    |                              |                                |                                |                                      |              |
+
+Number of patients (%) reported.
+
+*p < 0.001 vs. placebo. Formal comparisons for pooled lasmiditan doses (not individual doses) vs placebo only. aPatient discontinued due to fatigue and dizziness (both of mild severity).
+
+SAE: serious adverse event; TEAE: treatment-emergent adverse event; vs: versus.
+
+two (0.2%) patients assigned placebo and five (0.2%)
+assigned to one of the lasmiditan dose groups. Treatment-emergent SAEs were as follows: Placebo –
+cholelithiasis, non-cardiac chest pain; Lasmiditan –
+hypertension, hypotension, pituitary tumor benign, presyncope, surgery. Additional SAEs that were not treatment-emergent were as follows: Placebo - intestinal obstruction; Lasmiditan - asthma, deep vein thrombosis, somatic symptom disorder.
+
+TEAEs overall were reported more frequently in patients assigned lasmiditan versus placebo, and, in general, the frequency of TEAEs increased with increasing lasmiditan dose. The difference in TEAE frequency between the lasmiditan and placebo groups was primarily driven by nervous system TEAEs occurring at a higher incidence in all lasmiditan dose groups compared to placebo; nervous system TEAEs included dizziness, paresthesia, somnolence, hypoesthesia, lethargy, balance disorder, tremor, and sedation. Of the TEAEs reported, most TEAEs were mild (placebo, 70%; lasmiditan pooled 57%) or moderate (placebo, 24%; lasmiditan pooled 36%) in severity.
+
+The most frequently reported severe TEAEs in patients assigned lasmiditan were dizziness, somnolence, fatigue and nausea (see Common TEAEs section). The only SAE with incidence >1% in any group was dizziness in the lasmiditan 200 mg group. There were no lifethreatening events.
+
+The incidence of TEAEs reported was numerically higher in those who took one versus two doses of study drug (Table 4). Among patients who took lasmiditan for their first dose and then took a second dose of study drug, the incidence of TEAEs reported after the second dose was similar regardless of whether the second dose was lasmiditan or placebo (Table 4).
+
+## Common Teaes
+
+Common TEAEs are summarized in Table 5. Dizziness was the most common TEAE reported with lasmiditan
+(14.7%). Most events were mild or moderate in severity (Table 6).
+
+Generally, the onset of common TEAEs with lasmiditan occurred approximately 30–50 minutes after dosing. The median durations (interquartile range) of common TEAEs with lasmiditan were, in hours, 2.0 (0.8–4) for dizziness, 1.0 (0.5–3) for paresthesia, 3.9 (2–8.2) for somnolence, 4.8 (2–10.5) for fatigue, 3.0 (1.5–6.3) for nausea, 1.3 (0.8–4.0) for muscular weakness, and 1.5 (0.6–4.8) for hypoesthesia.
+
+Krege et al. 961
+
+| Table 4. Incidence of TEAEs by dosing regimen. First dose: Placebo   | Lasmiditan 50 mg   | Lasmiditan 100 mg           | Lasmiditan 200 mg   |          |         |         |         |
+|----------------------------------------------------------------------|--------------------|-----------------------------|---------------------|----------|---------|---------|---------|
+| 1 TEAE after first dose, n (%) Took only one dosea , n (%)                                                                      | 76 (15)            | 93 (26)                     | 287 (40)            | 354 (44) |         |         |         |
+| Took two dosesb , n (%)                                              | 59 (7.7)           | 56 (19)                     | 127 (23)            | 123 (27) |         |         |         |
+| Lasmiditan 50 mg                                                     | Placebo            |                             |                     |          |         |         |         |
+| (n ¼ 206)                                                            | (n ¼ 169)          | Lasmiditan 100 mg           | Placebo             |          |         |         |         |
+| (n ¼ 380)                                                            | (n ¼ 153)          | Lasmiditan 200 mg (n ¼ 303) |                     |          |         |         |         |
+| Placebo                                                              | Placebo            |                             |                     |          |         |         |         |
+| Second dose:                                                         | (n ¼ 762)          | (n ¼ 96)                    |                     |          |         |         |         |
+| 1 TEAE after second dose, n (%)                                                                      | 64 (8.4)           | 13 (14)                     | 35 (17)             | 31 (18)  | 65 (17) | 33 (22) | 55 (18) |
+| a Denominator for % is number of patients who took only one dose.    |                    |                             |                     |          |         |         |         |
+
+aDenominator for % is number of patients who took only one dose. bTEAEs occurring from time of first dose to time of second dose. Denominator for % is number of patients who took two doses.
+
+Table 5. Summary of TEAEs that occurred in 2% or more of patients in any lasmiditan dose group and more frequently with
+
+lasmiditan than placebo (p < 0.05).
+
+| lasmiditan than placebo (p < 0.05).                                                             | Lasmiditan 50 mg (n ¼ 654)   | Lasmiditan 100 mg (n ¼ 1265)   | Lasmiditan 200 mg (n ¼ 1258)   |               |             |
+|-------------------------------------------------------------------------------------------------|------------------------------|--------------------------------|--------------------------------|---------------|-------------|
+| Placebo (n ¼ 1262)                                                                              |                              |                                |                                |               |             |
+| Dizziness                                                                                       | 37 (2.9)                     | 56 (8.6)a                      | 194 (15.3)a,b                  | 216 (17.2)a,b | 466 (14.7)a |
+| OR vs. placebo                                                                                  | 3.7                          | 6.0                            | 6.9                            | 5.7           |             |
+| Paresthesia                                                                                     | 19 (1.5)                     | 16 (2.4)a                      | 73 (5.8)a,b                    | 91 (7.2)a,b   | 180 (5.7)a  |
+| OR vs. placebo                                                                                  | 2.7                          | 4.0                            | 5.1                            | 4.1           |             |
+| Somnolence                                                                                      | 27 (2.1)                     | 35 (5.4)a                      | 65 (5.1)a                      | 75 (6.0)a     | 175 (5.5)a  |
+| OR vs. placebo                                                                                  | 2.7                          | 2.5                            | 2.9                            | 2.7           |             |
+| Fatigue                                                                                         | 8 (0.6)                      | 18 (2.8)a                      | 52 (4.1)a                      | 50 (4.0)a     | 120 (3.8)a  |
+| OR vs. placebo                                                                                  | 3.0                          | 6.7                            | 6.5                            | 6.0           |             |
+| Nausea                                                                                          | 20 (1.6)                     | 18 (2.8)                       | 52 (4.1)a                      | 50 (4.0)a     | 107 (3.4)a  |
+| OR vs. placebo                                                                                  | 2.3 (ns)                     | 2.0                            | 2.5                            | 2.3           |             |
+| Muscular weakness                                                                               | 0                            | 7 (1.1)a                       | 16 (1.3)a                      | 19 (1.5)a     | 42 (1.3)a   |
+| OR vs. placebo                                                                                  | na                           | na                             | na                             | na            |             |
+| Hypoesthesia                                                                                    | 3 (0.2)                      | 2 (0.3)                        | 17 (1.3)a,b                    | 20 (1.6)a     | 39 (1.2)a   |
+| OR vs. placebo                                                                                  | 1.0 (ns)                     | 5.7                            | 6.8                            | 5.3           |             |
+| Number of patients (%) reported. OR: odds ratio point estimate; vs: versus; na: not applicable. |                              |                                |                                |               |             |
+
+Number of patients (%) reported. OR: odds ratio point estimate; vs: versus; na: not applicable.
+
+aSignificant difference vs. placebo (p < 0.05). bSignificant difference vs. lasmiditan 50 mg (p < 0.05).
+
+No significant differences between lasmiditan 100 mg vs. 200 mg.
+
+| Lasmiditan pooled doses (n ¼ 3177)   |
+|--------------------------------------|
+
+The presence of dizziness, paresthesia, somnolence, or fatigue did not appear to have a negative influence on freedom from pain or MBS, daily activity or PGIC
+at 2 hours post dosing (Figure 1). The presence of nausea did appear to have a potentially negative influence on these parameters. No formal comparisons were made due to the small sample sizes.
+
+## Evaluation Of Other Potential Harms
+
+Suicide ideation and behavior. The C-SSRS reporting of affirmative response(s) was low and similar across treatment groups. Of patients who had no suicidal ideation or behavior at baseline, one of 1188 patients assigned placebo and one of 2976 assigned lasmiditan (pooled doses) had a post-baseline affirmative response. There were no instances of suicidal behavior in either group.
+
+One TEAE of suicidal ideation (''wanting to die feeling,'') was reported in a lasmiditan group; this event was not captured on the C-SSRS.
+
+Injury and accident. Neurologic TEAEs were the most frequently observed events with lasmiditan. An analysis was performed to assess for potential relationship between these TEAEs and injuries or accidents. The numbers of patients who had both at least one
+
+962 Cephalalgia 39(8)
+
+![5_image_0.png](5_image_0.png)
+
+neurologic TEAE and at least one injury and/or accident AE (irrespective of temporal association) were similar between placebo (n ¼ 1, 0.1%) and pooled lasmiditan (n ¼ 9, 0.3%) groups (p ¼ 0.17). Medical review of each AE of any injury, poisoning, and procedural complication was also undertaken to determine whether neurologic TEAEs preceded any of these events. In the lasmiditan treatment groups, there were no cases of an injury or accident being temporally associated with a neurologic TEAE.
+
+Cardiovascular safety. TEAEs: No ischemic cardiovascular events potentially attributable to vasoconstriction such as myocardial infarction, transient ischemic attack, ischemic stroke, or angina were reported in any treatment group. TEAEs determined by medical review to be cardiovascular in nature were reported for five (0.4%) in the placebo group and 30 (0.9%) in the pooled lasmiditan group (p ¼ 0.057). This difference was driven by three cardiovascular events - palpitations
+(placebo, n ¼ 1 [0.1%]; lasmiditan, n ¼ 12 [0.4%]);
+tachycardia (placebo, n ¼ 0; lasmiditan, n ¼ 6 [0.2%]);
+and increased heart rate (placebo, n ¼ 1 [0.1%]; lasmiditan, n ¼ 5 [0.2%]).
+
+Vital signs: Systolic and diastolic blood pressure and pulse were similar across treatment groups, with no statistically or clinically significant differences between groups at baseline and post-baseline. Mean change from baseline was small in both treatment groups.
+
+Overall, the number of patients with low, high or potentially clinically significant elevations in blood pressure
+(either systolic or diastolic) either at baseline or postbaseline was low and similar across treatment groups.
+
+ECG findings: Mean changes in quantitative ECG
+parameters from baseline to last post-baseline assessment were minimal. There were no statistically significant differences in the least square mean changes for any parameter (heart rate, PR interval, QRS interval, QT interval, corrected QT interval by Fridericia
+[QTcF]). A similar proportion of the placebo and lasmiditan pooled treatment groups had categorical (low or high) ECG changes in heart rate, PR interval, Krege et al. 963
+
+| Table 6. Summary of TEAEs by severity.              | Lasmiditan 50 mg (n ¼ 654)   | Lasmiditan 100 mg (n ¼ 1265)   |           |           |           |
+|-----------------------------------------------------|------------------------------|--------------------------------|-----------|-----------|-----------|
+| Placebo (n ¼ 1262)                                  |                              |                                |           |           |           |
+| Dizziness Mild                                      | 29 (2.3)a                    | 40 (6.1)                       | 118 (9.3) | 121 (9.6) | 279 (8.8) |
+| Moderate                                            | 7 (0.6)                      | 14 (2.1)                       | 66 (5.2)  | 78 (6.2)  | 158 (5.0) |
+| Severe                                              | 1 (0.1)                      | 2 (0.3)                        | 10 (0.8)  | 17 (1.4)  | 29 (0.9)  |
+| Paresthesia Mild                                    | 18 (1.4)                     | 11 (1.7)                       | 47 (3.7)  | 60 (4.8)  | 118 (3.7) |
+| Moderate                                            | 1 (0.1)                      | 5 (0.8)                        | 26 (2.1)  | 31 (2.5)  | 62 (2.0)  |
+| Severe                                              | 1 (0.1)                      | 1 (0.2)                        | 4 (0.3)   | 3 (0.2)   | 8 (0.3)   |
+| Somnolence Mild                                     | 20 (1.6)                     | 24 (3.7)                       | 38 (3.0)  | 48 (3.8)  | 110 (3.5) |
+| Moderate                                            | 6 (0.5)                      | 10 (1.5)                       | 23 (1.8)  | 24 (1.9)  | 57 (1.8)  |
+| Severe                                              | 1 (0.1)                      | 1 (0.2)                        | 4 (0.3)   | 3 (0.2)   | 8 (0.3)   |
+| Fatigue Mild                                        | 3 (0.2)                      | 8 (1.2)                        | 22 (1.7)  | 25 (2.0)  | 55 (1.7)  |
+| Moderate                                            | 4 (0.3)                      | 8 (1.2)                        | 26 (2.1)  | 22 (1.7)  | 56 (1.8)  |
+| Severe                                              | 1 (0.1)                      | 2 (0.3)                        | 4 (0.3)   | 3 (0.2)   | 9 (0.3)   |
+| Nausea Mild                                         | 13 (1.0)                     | 10 (1.5)                       | 22 (1.7)  | 34 (2.7)  | 66 (2.1)  |
+| Moderate                                            | 6 (0.5)                      | 7 (1.1)                        | 16 (1.3)  | 10 (0.8)  | 33 (1.0)  |
+| Severe                                              | 1 (0.1)                      | 1 (0.2)                        | 2 (0.2)   | 5 (0.4)   | 8 (0.3)   |
+| Muscular weakness Mild                              | 0                            | 2 (0.3)                        | 11 (0.9)  | 11 (0.9)  | 24 (0.8)  |
+| Moderate                                            | 0                            | 5 (0.8)                        | 5 (0.4)   | 8 (0.6)   | 18 (0.6)  |
+| Severe                                              | 0                            | 0                              | 0         | 0         | 0         |
+| Hypoesthesia Mild                                   | 3 (0.2)                      | 1 (0.2)                        | 10 (0.8)  | 8 (0.6)   | 19 (0.6)  |
+| Moderate                                            | 0                            | 1 (0.2)                        | 6 (0.5)   | 10 (0.8)  | 17 (0.5)  |
+| Severe                                              | 0                            | 0                              | 1 (0.1)   | 2 (0.2)   | 3 (0.1)   |
+| a Number of participants experiencing an event (%). |                              |                                |           |           |           |
+
+| Lasmiditan 200 mg (n ¼ 1258)   | Lasmiditan pooled doses (n ¼ 3177)   |
+|--------------------------------|--------------------------------------|
+
+QRS interval, QT interval uncorrected, and QTcF, with no statistically significant differences between the two groups for any categorical change. One patient assigned lasmiditan had an ECG change reported as a likely cardiovascular TEAE. This patient had an event of abnormal ECG reported (right bundle branch block and left axis deviation) on study completion. No patient experienced a QTcF value >500 msec in either treatment group.
+
+Hepatic safety. There were no significant differences between lasmiditan and placebo groups in the frequency of abnormal hepatic laboratory results (alanine transaminase or aspartate transaminase 3, 5, 10 the upper limit of normal (ULN); ALP - 2  ULN;
+total bilirubin - 2  ULN) during the treatment period.
+
+Serotonin syndrome. Since lasmiditan is an agonist at the serotonin 1F receptor, medical review was performed to assess for possible cases of serotonin syndrome in patients assigned lasmiditan. Five cases were identified via the search strategy described. Medical review of these cases revealed that none of the TEAEs were severe or serious, and no cases met Hunter Criteria (7).
+
+Hypersensitivity. Medical review of cases revealed seven patients with a total of nine suspected events of immediate hypersensitivity, including rashes, all in patients who received lasmiditan. The events were all mild or moderate in severity and none were serious. There were no cases of suspected non-immediate hypersensitivity or anaphylaxis.
+
+## Discussion
+
+We present the pooled safety findings from two Phase 3 studies of lasmiditan for acute treatment of migraine.
+
+There were no deaths, and SAEs were reported for 0.2% of patients in the placebo and pooled lasmiditan groups.
+
+TEAEs were more frequently reported with lasmiditan (placebo 13.5% versus lasmiditan pooled groups 35.9%) and there was a numerical increase in the incidence of TEAEs with increasing lasmiditan dose. For those who received lasmiditan as first dose and then took a second dose, the incidence of TEAEs was similar whether the second dose was placebo or lasmiditan, supporting the idea that a second dose of lasmiditan for migraine pain does not confer an additional risk of TEAEs.
+
+The most frequent TEAEs associated with lasmiditan use were generally neurologic events, most frequently dizziness, which included patient reports of dizziness, lightheadedness, lightheaded, dizzy, woozy, lightheaded feeling, giddiness, feeling drunk and feeling of faintness. Dizziness with lasmiditan use has been previously explored.8 Other common TEAEs were paresthesia, somnolence, fatigue, nausea, muscular weakness, and hypoesthesia. The odds ratios for these events for the pooled lasmiditan versus placebo group ranged from 2.3 to 6.0. Most events were mild or moderate in severity. The onset of common TEAEs with lasmiditan was rapid, generally less than one hour after dosing, and generally lasted 1.0 to 4.8 hours (median values),
+depending on event; this time course generally coincides with the maximum plasma concentration of lasmiditan (9). Since the most frequent TEAEs were neurologic, we assessed whether there was any increased risk of injury with lasmiditan use. We found no increased risk of injury associated with neurologic TEAEs and there were no treatment-emergent road traffic accidents, impaired ability to use machinery, or accidents reported.
+
+The common TEAEs reported in SAMURAI and SPARTAN could, theoretically, be expected to be associated with tolerability concerns; for example, interference with daily activity and PGIC. Although nausea was associated with a numerically greater interference with daily activity and worsened PGIC, the proportion of patients assigned lasmiditan with no interference with daily activity, and very much/much better on PGIC at 2 hours appeared, in general, to be numerically higher in those reporting dizziness, paresthesia, somnolence or fatigue versus not, though no formal analysis was performed.
+
+The finding that the reporting of dizziness, paresthesia, somnolence and fatigue, but not nausea, appeared to be associated with numerically greater freedom from pain and MBS raises the possibility that these TEAEs could be mediated through a similar mechanism of action as the efficacy.
+
+While triptans have affinity for 5-HT1B, located on vascular smooth muscle receptors and mediating vasoconstrictor effect, lasmiditan has a high affinity for the 5-HT1F receptor and is not a vasoconstrictor (10–12).
+
+Due to the increased risk of cardiovascular disease in patients with migraine (13,14), the vasoconstrictive effects of triptans as well as ergotamines (12,15–17),
+and warnings concerning rare serious cardiovascular events with triptans, ergotamines, and NSAIDS
+(17–19), we evaluated the cardiovascular safety of lasmiditan. No TEAEs related to vasoconstriction, including angina pectoris, cerebral infarction, hypertensive crisis, and ischemic stroke, were reported in either SAMURAI
+or SPARTAN. In addition, available information suggests that lasmiditan use is not associated with increased risks of serious gastrointestinal events (as reported with NSAIDs (19)), hepatotoxicity (as reported with high dose acetaminophen), or respiratory depression (as reported with opiates). Lasmiditan may be a new option for the acute treatment of migraine, including for patients in whom currently available options are not desirable because of safety concerns.
+
+Comparisons of the TEAE findings observed with lasmiditan versus those observed in trials of other migraine agents have limitations due to differences in AE collection methodologies. Importantly, the lasmiditan Phase 3 trials used an electronic diary and included a question to solicit AE information at 0.5, 1, 1.5, 2, 3, 4, 24, and 48 hours after the first dose (and again, if taken, at the same intervals after a second dose of study drug); a positive response to this question triggered phone contact from the site. This questioning likely resulted in relatively high ascertainment of TEAEs.
+
+Notwithstanding this difference, we compared the common TEAEs (those reaching 2% in a group and higher with active drug than placebo) with lasmiditan to those reported with a triptan with relatively low
+(naratriptan (20)), medium (sumatriptan (18)), and high (rizatriptan (21)) efficacy, based on findings from a meta-analysis (22). The number of individual TEAEs meeting this criterion of ''common'' were six for naratriptan, eight for sumatriptan, 11 for rizatriptan, and seven for lasmiditan. Consistent with high specificity for 5-HT1F and central penetrance, lasmiditan appears to have a distinct adverse event profile from that of triptans, with common TEAEs being CNS-related and without the TEAEs related to chest/throat/neck/jaw pain, tightness, pressure, or heaviness that have been reported with triptan use (18). The most common TEAE reported with naratriptan was nausea (4–5%
+of patients); with sumatriptan, paresthesia (3–5%); with rizatriptan, dizziness (4–9%); and with lasmiditan, dizziness (9–17%).
+
+Based on findings from these Phase 3 studies, there is no indication that lasmiditan is associated with an increase in suicidal ideation or behavior. In addition, there was no significant effect of lasmiditan on hepatic safety, ECG findings or vital signs, though these parameters were not assessed in temporal proximity to dosing. Additionally, a medical review did not reveal any probable cases of serotonin syndrome. There were cases of immediate hypersensitivity ( < 1%), including rashes, with lasmiditan; all were mild or moderate in severity.
+
+There are limitations to this analysis. These placebocontrolled studies included assessment of lasmiditan during a single attack and data pertaining to long-term adherence and compliance are not available; additional safety data from a long-term safety study of lasmiditan for the acute treatment of migraine are needed and studies are under way. C-SSRS, laboratory measures, ECG findings and vital signs were collected during scheduled visits and not necessarily collected in close temporal proximity to dosing since, per protocol, the endpoint visit could have occurred up to 7 days after dosing. Apart from the PGIC, the outcomes evaluated for their association with presence or absence of common TEAEs are migraine specific and do not reflect the overall patient status. In addition, we evaluated TEAEs occurring at or prior to 2 hours in relation to outcomes occurring at 2 hours and did not consider a more complex temporal association between TEAE and outcome that may have existed.
+
+In conclusion, TEAEs were reported for 36% of those assigned lasmiditan; they were mostly neurologic, of mild or moderate severity, with early onset and selflimiting with short duration. There were no deaths, and the incidence of SAEs, suicidal ideation or injuries and accidents were similar in the lasmiditan and placebo groups. The most common TEAEs were not associated with worse outcomes relating to pain, most bothersome migraine symptoms, daily activity, and overall treatment experience (measured using PGIC). There were no ischemic events suggesting vasoconstriction.
+
+Lasmiditan may represent a useful acute treatment option for patients with migraine, including those in whom vasoconstriction is not desirable.
+
+Key findings
+. Lasmiditan, a centrally-penetrant selective 5-HT1F receptor agonist, was associated with neurologic treatment-emergent adverse events, which were mostly mild or moderate in severity and self-limiting, and of short duration.
+
+. The most common adverse events with lasmiditan were dizziness, paresthesia, somnolence, fatigue, nausea, muscular weakness and hypoesthesia.
+
+. There were no ischemic events reported.
+
+## Declaration Of Conflicting Interests
+
+The authors declared the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: JHK, EL, EGD, SAD, JW and ASB are full-time employees and minor stockholders at Eli Lilly and Company. PBR serves on advisory boards for Biohaven Pharmaceuticals and Xoc Pharmaceuticals.
+
+## Funding
+
+The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The SPARTAN and SAMURAI studies were sponsored by CoLucid Pharmaceuticals, a wholly owned subsidiary of Eli Lilly and Company.
+
+References 1. Vila-Pueyo M. Targeted 5-HT1F therapies for migraine.
+
+Neurotherapeutics 2018; 15: 291–303.
+
+2. Kuca B, Silberstein SD, Wietecha L, et al. Lasmiditan is an effective acute treatment for migraine: A phase 3 randomized study. Neurology 2018; 91: e2222–e2232.
+3. Goadsby PJ LL, Dennehy EB, Kuca B, et al. Phase 3 randomized, placebo-controlled, double-blind study of lasmiditan for acute treatment of migraine. Brain. Epub ahead of print 27 May 2019. DOI: 10.1093/brain/awz134.
+
+4. Guy W. Clinical global impression. In: ECDEU assessment manual for psychopharmacology - revised. Rockville, MD: US
+Department of Health, Education and Welfare, pp.218–222.
+
+https://archive.org/details/ecdeuassessmentm1933guyw
+(1976, accessed 28 May 2019).
+
+5. Goff DC, Lloyd-Jones DM, Bennett G, et al. 2013 ACC/
+AHA guideline on the assessment of cardiovascular risk: A report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines. Circulation 2014; 129: S49–S73.
+
+6. American Heart Association resource page.
+
+Understanding blood pressure readings: Know your numbers, https://www.heart.org/HEARTORG/Conditions/
+HighBloodPressure/KnowYourNumbers/Und%20erstand ing-Blood-Pressure-Readings_UCM_301764_Article.jsp (2017, accessed 1 May 2019).
+
+7. Dunkley E, Isbister G, Sibbritt D, et al. The Hunter Serotonin Toxicity Criteria: Simple and accurate diagnostic decision rules for serotonin toxicity. QJM 2003; 96: 635–642.
+
+8. Tepper SK, Krege J, Lombard L, et al. Characterization of dizziness after lasmiditan: Findings from the SAMURAI and SPARTAN acute migraine treatment randomized trials. Headache (in press).
+
+9. Pilgrim A, Dussault B, Rupniak NM, et al. col-144, an orally bioavailable selective 5-HT1F receptor agonist for acute migraine therapy: Po34. Cephalalgia 2009; 29:
+24–25.
+
+10. Nilsson T, Longmore J, Shaw D, et al. Contractile 5-HT1B receptors in human cerebral arteries: Pharmacological characterization and localization with immunocytochemistry. Brit J Pharmacol 1999; 128: 1133–1140.
+
+11. Neeb L, Meents J and Reuter U. 5-HT 1F receptor agonists: A new treatment option for migraine attacks?
+
+Neurotherapeutics 2010; 7: 176–182.
+
+12. Rubio-Beltra´n E, Labastida-Ramı´rez A, Villalon CM,
+et al. Is selective 5-HT1F receptor agonism an entity apart from that of the triptans in antimigraine therapy?
+
+Pharmacol Ther 2018; 186: 88–97.
+
+13. Hippisley-Cox J, Coupland C and Brindle P. Development and validation of QRISK3 risk prediction algorithms to estimate future risk of cardiovascular disease:
+Prospective cohort study. BMJ 2017; 357: j2099.
+
+14. Mahmoud AN, Mentias A, Elgendy AY, et al. Migraine and the risk of cardiovascular and cerebrovascular events: A meta-analysis of 16 cohort studies including 1 152 407 subjects. BMJ Open 2018; 8: e020498.
+
+15. Humphrey P, Feniuk W, Perren MJ, et al. Serotonin and migraine. Ann NY Acad Sci 1990; 600: 587–598.
+
+16. Mitsikostas D and Tfelt-Hansen P. Targeting to 5-HT1F
+receptor subtype for migraine treatment: Lessons from the past, implications for the future. Cent Nerv Syst Agents Med Chem 2012; 12: 241–249.
+
+17. Valeant Pharmaceuticals North America. D.H.E. 45-
+(dihydroergotamine mesylate) injection, USP, https://
+www.accessdata.fda.gov/drugsatfda_docs/label/2009/005 929s044lbl.pdf (2008, accessed 1 May 2019).
+
+18. GlaxoSmithKline. IMITREX (sumatriptan succinate)
+tablets, for oral use. Highlights of prescribing information, https://www.accessdata.fda.gov/drugsatfda_docs/
+label/2017/020132s029lbl.pdf (2017, accessed 1 May 2019).
+
+19. Depomed Inc. CAMBIA- (diclofenac potassium), for oral solution. Highlights of prescribing information, https://www.accessdata.fda.gov/drugsatfda_docs/label/ 2017/022165s012lbl.pdf (2017, accessed 1 May 2019).
+
+20. GlaxoSmithKline. AMERGE- (naratriptan hydrochloride) tablets, for oral use, https://www.accessdata.fda.gov/
+drugsatfda_docs/label/2016/020763s011lbl.pdf (2016, accessed 1 May 2019).
+
+21. Merck & Co, Inc. MAXALT (rizatriptan benzoate) tablets, for oral use, https://www.accessdata.fda.gov/drugsatfda_docs/label/2011/020864s011s016s017s018s019,020 865s012s016s018s020s021lbl.pdf (2011, accessed 1 May 2019).
+
+22. Ferrari MD, Roon KI, Lipton RB, et al. Oral triptans
+(serotonin 5-HT(1B/1D) agonists) in acute migraine treatment: A meta-analysis of 53 trials. Lancet 2001; 358: 1668–1675.

medical/md/PMC7065880.md

@@ -0,0 +1,507 @@
+CELL BIOLOGY
+
+# Platelet P-Selectin Initiates Cross-Presentation And Dendritic Cell Differentiation In **Blood Monocytes**
+
+Patrick Han1*, Douglas Hanlon2*, Najla Arshad3, Jung Seok Lee4, Kazuki Tatsuno2, Eve Robinson2, Renata Filler2, Olga Sobolev2, Christine Cote5, Felix Rivera-Molina6, Derek **Toomre6**, Tarek Fahmy1,2,3,4†, Richard **Edelson2†**
+Dendritic cells (DCs) are adept at cross-presentation and initiation of antigen-specific immunity. Clinically, however, DCs produced by in **vitro differentiation of monocytes in the presence of exogenous cytokines have been met** with limited success. We hypothesized that DCs produced in a physiological manner may be more effective and found that platelets activate a cross-presentation program in peripheral blood monocytes with rapid (18 **hours)** maturation into physiological DCs (phDCs). Differentiation of monocytes into phDCs was concomitant with the formation of an "adhesion synapse," a biophysical junction enriched with platelet P-selectin and monocyte P-selectin glycoprotein ligand 1, followed by intracellular calcium fluxing and nuclear localization of nuclear factor B. phDCs were more efficient than cytokine-derived DCs in generating tumor-specific T cell immunity. Our findings demonstrate that platelets mediate a cytokine-independent, physiologic maturation of DC and suggest a novel strategy for DC-based immunotherapies.
+
+Copyright © 2020 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S.Government Works. Distributed under a Creative Commons Attribution NonCommercial License 4.0 (CC BY-NC).
+
+## Introduction
+
+Dendritic cells (DCs), termed "professional" antigen-presenting cells (APCs) for their capacity to process and cross-present antigens for induction of potent antigen-specific T cell responses, are principal regulators of adaptive immunity (1). However, naturally occurring DC populations in the blood, i.e., "BDCA+ classical DC" (cDC), are rare, composing <1% of circulating leukocytes (2). Therefore, acquisition of large numbers of DCs for research and immunotherapeutic purposes typically involves ex vivo conversion of blood monocytes via cultivation with supraphysiologic concentrations of cytokines, including granulocyte-macrophage colony-stimulating factor (GMCSF) and interleukin-4 (IL-4) (3) for up to 7 days.
+
+While ex vivo–generated cytokine-derived DCs have offered enormous insights into the function of these cells, their relationship to DC populations arising in vivo is still poorly understood (4). Cytokine-derived DC and cDC share key genetic profiles for antigen processing and costimulation (5) but have been shown to be functionally distinct, especially in their induction of effector responses in vitro (6) and in vivo (7). Notably, as immunotherapies using cytokine-derived DCs have been met with disappointing clinical outcomes (8), the biologic integrity of ex vivo cytokine maturation has been questioned even by the originators of this methodology (9). Current hypotheses attribute these therapeutic dysfunctions to a combination of factors, namely, restricted life cycle and migration to the draining lymph nodes (8), loss of responsiveness and "exhaustion" against in vivo cytokine cues (10), and limited capacity for effector activation (11), implicating the production method of cytokinederived DCs for shortcomings concerning physiologic performance in vivo.
+
+In contrast to long-term, high-concentration cytokine cultures, rapid acquisition of DC-like features has been demonstrated in blood monocytes in the presence of inflammatory stimuli (12) through GM-CSF–independent (13) mechanisms in vivo, indicating the potentials for more "physiological" pathways of DC biogenesis. The case for using noncytokine cues to drive DC differentiation is bolstered when considering work that demonstrates inflammatory events such as extravasation at platelet-marked sites of vascular injury and endothelial translocation as physiologic regulators of monocyte conversion to "inflammatory DC" capable of potent T cell stimulation in vivo (14, 15). Deciphering pathways for a more physiologically relevant induction of monocyte-to-DC conversion will invite radical adjustments to the central paradigm of DC immunity and informed development of more effective DC-based therapies.
+
+A clue toward physiologic DC production may be gleaned from an existing clinical treatment, extracorporeal photochemotherapy 
+(ECP) (16, 17), which uses an ex vivo modality to induce monocyteto-DC conversion. This cellular immunotherapy, currently in wide therapeutic use for cutaneous T cell lymphoma (CTCL), is understood to facilitate rapid DC generation from blood monocytes in the absence of exogenous cytokines, solely through interaction of monocytes with peripheral blood components, including plasma proteins and activated platelets. The exact roles and mechanistic contributions of these blood constituents, often implicated in injury and inflammation, clotting, leukocyte extravasation, and wound healing, remain unresolved in literature. Recent studies of experimental ECP in murine models confirmed in vivo efficacy against melanoma, colon carcinoma (16), and ovarian cancer, although through unelucidated mechanisms of DC differentiation from blood monocytes (18). However, these studies identified platelets as a requisite constituent for therapeutic success.
+
+Platelets are essential mediators of vascular homeostasis (19), 
+hemostasis and thrombosis (20), and more recently, immunoregulation (21, 22). Although activated platelets and platelet-borne molecules (e.g., P-selectin, CD40, secreted granules, etc.) have been shown to direct leukocyte migration (15, 23) and inflammatory stimulation (24), especially during infection or injury, the precise platelet-driven effects on monocyte function, particularly with regard to antigen processing and presentation, remain unexplored. Given accruing evidence of immunologically relevant cross-talk between platelets and monocytes (19), we investigated the role of platelets in initiating physiologic induction of DC. Here, we report that platelet-monocyte interaction, driven principally by engagement of platelet P-selectin with monocyte P-selectin glycoprotein ligand (PSGL1), culminates in the formation of a synaptic junction that directs the transformation of monocytes into cross-presenting APCs. Since this is a physiological strategy for DC production, we hence refer to these platelet-matured cells as physiological DC (phDC).
+
+## Results Peripheral Blood Mononuclear Cells Stimulate Antigen-Specific T Cell Responses In Platelet-Dependent Manner The Impact Of Platelets On Promoting Peripheral Blood Mononuclear
+
+cell (PBMC)–mediated antigen-specific T cell stimulation was investigated as depicted in Fig. 1A. Platelet-containing (PBMC+pl+) or platelet-depleted (PBMC+pl−) PBMCs pulsed with endotoxin-free soluble ovalbumin (sOVA) model antigen were used to stimulate the clonal OVA–specific CD8+ T cells derived from OT1 transgenic mice expressing T cell receptors (TCRs) specific for OVA peptide (SIINFEKL) presented within the context of major histocompatibility complex class I (MHC I). Platelets were routinely monitored in PBMCs collected from healthy mice (fig. S1A), and extent and specificity of platelet depletion were further confirmed by flow cytometry (fig. S1, C and D). PBMCs prepared with or without platelets were cultured overnight with sOVA, followed by a 3-day coculture with OT1 T cells (Fig. 1A).
+
+Prominent differences in antigen-specific CD8 T cell responses were immediately observed between antigen-pulsed PBMC+pl+ and PBMC+pl−. Platelet-exposed PBMCs drove proliferative division of OT1 T cells, while platelet-depleted PBMCs demonstrated minimal proliferation (Fig. 1B). Titrated amounts of antigen pulsed to PBMC+pl+ and PBMC+pl− confirmed the antigen specificity and platelet dependence of the T cell response (fig. S2A). A mock platelet depletion protocol using immunoglobulin isotype control was tested on PBMC+pl+ to demonstrate the T cell proliferation response as exclusively platelet dependent (fig. S2B).
+
+Cytokine secretion and activation markers were also investigated. 
+
+Consistent with robust proliferation, T cell incubation with PBMC+pl+
+led to secretion of IL-2 and interferon- (IFNg) (Fig. 1C) at levels 
+~40-fold higher compared to naïve OT1 and generated antigenexperienced effector CD25+CD44hi phenotypes (Fig. 1D), in stark contrast to PBMC+pl−. In the presence of platelets, activated T cells also expressed marginally increased levels of CD69, suggesting that these T cells are at later stages of activation (25), yet without loss of effector function as shown by production of granzyme B and lack of exhaustion marker PD1 expression (Fig. 1E and fig. S2C). T cell proliferation did not result in significant memory phenotype (fig. S2D). Despite reported immunomodulatory functions of platelet-expressed MHC I (26), isolated platelets pulsed with sOVA could not activate OT1 T cells, demonstrating insufficiency of platelets in direct priming of T cells and necessity for antigen processing and presentation mediated by PBMCs (fig. S2E). Together, these findings suggest that platelets specifically modify APCs in PBMCs to initiate robust antigendependent cytotoxic T lymphocyte (CTL) activation.
+
+## Monocytes In Pbmcs Are Central To Platelet-Dependent T Cell Cross-Priming
+
+Given that PBMCs in the presence of platelets lead to robust T cell activation accompanied by expression of canonical cytokines and surface markers, we examined which components in the PBMCs are responsible for this platelet-dependent activation program. Although commonly associated with innate immunity and host defense, blood monocytes represent a sizable and readily available precursor population for generation of professional APCs in vitro and in vivo (27, 28). We hypothesized that monocytes are both a necessary and sufficient PBMC subset for platelet-dependent immunogenic stimulation of T cells due to the following: (i) Antigen processing and presentation are required for antigen-specific T cell responses; (ii) circulating monocytes are capable of maturing into professional APCs, such as DCs; and (iii) platelets have been shown to aggregate with monocytes during inflammatory conditions (15, 23).
+
+To test monocyte involvement in T cell activation, we purified platelet-containing (mono+pl+) and platelet-depleted (mono+pl−) 
+monocytes from PBMCs by negative selection (fig. S3A). Taking into consideration that monocytes make up to <10% of PBMCs, we found that mono+pl+ fully retained the T cell proliferation–stimulating function of PBMC+pl+, whereas mono+pl− were as ineffective as PBMC+pl− (Fig. 2A and fig. S3B). mono+pl+ and mono+pl− obtained by fluorescence-activated cell sorting (FACS) further confirmed the monocyte requirement of the observed platelet-dependent effect (fig. S3, C and D). Consistent with previous results with unfractionated PBMCs, activation cytokines IL-2 and IFNg were significantly up-regulated exclusively during OT1 coculture with antigen-pulsed mono+pl+ (Fig. 2B). To further confirm T cell activation by monocytes, we checked the activation status of cocultured T cells and found similar induction of CTL phenotypes, CD25, CD44, and CD69 expression and granzyme B production, exclusively in plateletexposed monocytes (fig. S4, A to C). In contrast, nonmonocytic portions of PBMCs failed to initiate immune activation regardless of platelet presence, establishing that the observed platelet-dependent effect is specific and limited to the monocyte subpopulation of PBMCs (fig. S4D). These observations are consistent with previous reports, indicating that monocytes can activate and proliferate T cells (28) yet, to our knowledge, represent the first example of platelet-driven activation of cross-presentation program in monocytes.
+
+## Maturation Of Immunogenic Dcs Is A Direct Effect Of Platelet-Monocyte Interactions
+
+Cross-presentation is a mechanism by which exogenous antigen is processed and presented on MHC I, a characteristic requirement for the induction of antigen-specific effector CD8+ T cell responses 
+(29). Monocytes in circulation act as a precursor population to cell types such as myeloid-derived suppressor cells, macrophages, and DCs (30). While intrinsically able to take up, process, and present antigen, blood monocytes have been shown to primarily contribute to host defense and innate immunity, requiring additional phenotypic and functional differentiation to generate adaptive effector responses, especially through cross-presentation (27, 31).
+
+The observation that monocytes are principal participants in platelet-dependent activation of adaptive immunity prompted the search for a cross-presentation–competent population. We identified a CD11b+ myeloid cell population exclusively present in plateletexposed PBMCs up-regulating cross-presented sOVA peptide–loaded MHC I (SIINFEKL-H2Kb) (Fig. 2C). Consistent with characterizations 
+
+![2_image_0.png](2_image_0.png)
+
+Han ., 6 
+
+![3_image_0.png](3_image_0.png)
+
+of monocyte-derived DCs (32), we found that platelet presence in PBMCs (PBMC+pl+) yielded emergence of CD11c+ subset of CD11b+ population enriched with high levels of cross-presented antigen. In contrast, negligible generation of a CD11c+ population or expression of SIINFEKL-H2Kb was observed from plateletdeficient PBMCs (PBMC+pl−) (Fig. 2D). Although cross-presentation has been demonstrated in monocyte-derived cells, particularly monocyte DCs (28), platelet association has not been implicated to influence antigen-presentation function. CD80 and CD86, two costimulatory markers indicative of APC maturation, were upregulated only in presence of platelets, although CD83 did not show significant induction (Fig. 2E and fig. S4E). The increase in monocyte Han ., 6 MHC I–associated antigen, in combination with acquisition of cDC markers, suggests that monocytes are driven toward functional and phenotypic maturation into professional APCs via interaction with platelet components.
+
+Conventional cultivation of bone marrow–derived DCs (BMDCs) 
+requires differentiation cytokines IL-4/GM-CSF, followed by lipopolysaccharide (LPS) stimulation for maturation (1). Cytokinederived BMDCs were compared against platelet-activated PBMCs and monocytes for their capacity for OT1 stimulation. We found that both PBMCs and monocytes performed at comparable levels as immature BMDCs, although PBMCs and monocytes were differentiated solely by platelets in the absence of cytokines and in one-sixth of the time (fig. S5A). CD14, the LPS receptor implicated in innate immune activation and a characteristic monocyte marker (33), also showed increased expression on monocytes in the presence of platelets (fig. S4F). However, no up-regulation of CD16 was observed (fig. S4G), 
+although this marker had previously been associated with plateletassociated leukocyte inflammation (34). In their progressive phenotypic maturation, these platelet-interacting cells continue to exhibit a limited number of features with monocytes while transitioning into DC-like APCs characterized by rapid acquisition of functional capacity to cross-present antigen and cross-prime T cells.
+
+Platelets showcased a capacity to rapidly differentiate circulating blood monocytes into APCs capable of robust adaptive immune stimulation, specifically through activation of cross-presentation programming. Platelet association resulted in another phenomenon prototypic of DC maturation (14, 16), as CD11b+CD11c+ monocytes were also observed to up-regulate MHC II expression (Fig. 2F), further supporting that platelets may supplant inflammatory signals or maturation cocktails in generating DC-like APCs. To investigate the extent of platelet influence on APC functions of monocytes, particularly on MHC II–based antigen presentation, we examined OVA antigen–specific stimulation using CD4+ OT2 transgenic T cells. 
+
+Unexpectedly, OT2 coculture assays revealed little platelet dependence in leveraging antigen-specific OT2 proliferation, demonstrating a slight enhancement of OT2 stimulation by platelet-depleted PBMCs (fig. S5, B and C). This discrepant impact of platelets on OT1 and OT2 responses indicates that platelet interaction preferentially biases monocyte antigen processing toward MHC I loading. Previous work has shown platelet involvement in inflammatory processes central to innate host defense by monocytes in vivo (24, 35) as well as assisting in cytokine-driven DC maturation in vitro (36, 37); however, demonstration of platelets as sole initiators of adaptive immune functions in monocytes, especially cross-presentation in conjunction with DC maturation in absence of exogenous stimuli, has no precedence. Together, parallels between features of platelet-matured monocytes and canonical hallmarks of DCs suggest that platelets mediate differentiation of blood monocytes by invoking physiologic programs linking innate and adaptive immunity (38). We will, thus, refer to these platelet-matured monocytes as phDC.
+
+To further understand how platelets mediate monocyte maturation, we monitored the platelet-monocyte interactions formed during the initial culture of platelet-containing PBMCs. Platelets exert precisely controlled physiologic functions in vivo, from effecting whole-body "life and death" reactions in hemostasis and thrombosis (20, 39, 40) to forming cellular microaggregates during inflammation (41), primarily relying on contact-based physical interactions not only among platelets but also with leukocytes. We used Amnis imaging to observe cell-cell contact between platelets and monocytes and Han ., 6 found that platelets adhered to virtually all monocytes after overnight culture, with platelet-expressed CD62p (P-selectin) colocalized at platelet-monocyte interfaces, suggesting a role for a physical axis of interaction in the functional maturation of monocytes (Fig. 2G).
+
+## Platelet-Derived P-Selectin Initiates Monocyte Activation And Cross-Presentation
+
+We further investigated monocyte-platelet junctions by confocal microscopy to identify the stimulatory signaling axis driving monocyte cross-presentation. Platelet-containing PBMCs cultured overnight showed CD11b+ Ly6G− monocytes forming junctions with CD41+
+platelets (Fig. 3A), confirming interactions previously visualized by Amnis. Three-dimensional (3D) reconstruction of platelet-monocyte structures highlighted P-selectin molecules on the surface of activated platelets bridging contact at the platelet-monocyte interface (movie S1), likely binding to monocyte PSGL1 (42).
+
+Activation of platelets leads to secretion and display of a myriad of granule-stored molecules (43, 44), most prominently CD40 and CD40L, cytokines transforming growth factor–, CCL2, and IL-1
+(45), and adhesion molecule P-selectin (46). To understand the mechanism of platelet-initiated phDC induction, we performed a series of studies targeted at such molecules known to facilitate plateletmonocyte interactions. Blocking, neutralizing, or substituting platelet molecules, CD40, CD40L, monocyte chemoattractant protein-1 (MCP-1), and dickkopf-1 (DKK-1), had little impact on monocyte cross-presentation (fig. S6, A and B). Confocal images further suggest that monocytes may be interacting with aggregates of platelets, prompting us to test blocking such aggregate formation using antibodies against CD41 or CD61 (fig. S6C). Although we did not observe any impact of blocking portions of IIb3 on platelet surface, treating platelet-containing PBMCs with adenosine 5′-diphosphate receptor P2Y12 antagonist (47), Ticagrelor, abrogated subsequent T cell responses, implicating platelet activation in platelet-dependent monocyte cross-presentation (fig. S6D).
+
+P-selectin is a platelet activation marker and an important modulator of platelet-leukocyte interactions, including adhesion, immobilization, and cell recruitment during tissue repair and thrombotic disorders (41, 46); however, its significance in activating antigen cross-presentation machinery in monocytes is unknown. Therefore, we first investigated whether P-selectin contributes to observed platelet-dependent effects by testing whether recombinant P-selectin (P-selectin) recapitulates activation of antigen cross-presentation in PBMCs in the absence of platelets. Exposing sOVA-pulsed platelet-depleted PBMCs to culture dishes precoated with P-selectin restored cross-presentation, as demonstrated by the titratable recovery of antigen-dependent proliferation, activation-associated cytokine production, and OT1 T cell activation phenotypes (Fig. 3, B and C, and fig. S7A). We additionally tested the remaining two members of the selectin family and, unexpectedly, saw that E-selectin, but not L-selectin, also rescued platelet-depleted monocytes for cross-presentation (fig. S7B). As expected, neither P- nor E-selectin directly initiated T cell proliferation (fig. S7C), confirming that selectins specifically potentiated monocyte antigen cross-presentation, not nonspecific stimulation of T cells.
+
+Both P- and E-selectin are cognate ligands for monocyte receptor, PSGL1 (48). PSGL1 initiates adhesion, rolling, recruitment, and extravasation of leukocytes, as shown in flow systems and in vivo (49, 50), but its role in monocyte activation and differentiation is unexplored. We used an agonist anti-PSGL1 antibody (fig. S8, A and B) to investigate whether engaging this P-selectin receptor can trigger 
+
+![5_image_0.png](5_image_0.png)
+
+monocyte cross-presentation. Treating platelet-depleted PBMCs with anti-PSGL1 leads to recovery of PBMC cross-presentation capacity for T cell activation in an agonist concentration–dependent manner, and anti-PSGL1 addition to platelet-containing PBMCs had no antagonist behavior (Fig. 3D and fig. S8C). Furthermore, anti-PSGL1– treated platelet-depleted PBMCs were shown to stimulate cytokine Han ., 6 production and cytotoxic phenotype generation consistent with T cells activated by platelet-containing PBMCs (Fig. 3E and fig. S8D). Purified monocytes yielded equivalent results to PBMCs when treated with P-selectin and anti-PSGL1, confirming specificity of P-selectin/PSGL1-dependent effects to monocytes within PBMCs (Fig. 3F and fig. S8E). These findings not only establish the P-selectin/ PSGL1 axis as primary constituents in activation of cross-presentation in peripheral blood monocytes but also confirm platelets as the principal physiological driver for activation and maturation of monocytes to phDC.
+
+## P-Selectin/Psgl1 Interaction Drives Monocyte Maturation And Function In Human Pbmcs
+
+Having demonstrated the role of P-selectin and its receptor PSGL1 in activating cross-presentation in murine peripheral blood monocytes, we extended our studies to human donor samples to determine whether this platelet-dependent functional maturation also occurs in human monocytes. Confocal imaging of monocytes purified from donor PBMCs and cultured overnight in the absence of platelets showed uniform surface expression of CD14 and PSGL1 (fig. S9A and movie S6). In platelet-containing culture, we immediately noticed that CD61+ platelets induced monocyte PSGL1 to specifically cluster around platelet P-selectin–containing contacts to form "adhesion synapses" and even interactive platelet "bridges" between multiple platelets and monocytes (Fig. 4A and movie S2), reminiscent of the immunological synapse between APCs and lymphocytes. Formation of platelet-monocyte junctional complexes, accompanied by polarized PSGL1 localization, occurred exclusively in contact with activated platelets strongly expressing CD62p and displaying filopodial and lamellipodial extensions, while contact with resting CD62p− platelets did not bias PSGL1 distribution on monocytes (fig. S9, B and C, and movies S7 and S8). Cross-section analysis of the adhesion synapse further revealed that PSGL1 clustering surrounds multiple discrete nodes of P-selectin extending from platelets in a geometry reminiscent of a multipronged plug-and-socket connection (fig. S9D and movie S9). Despite polarization of PSGL1 in adhesion synapse formation with platelets, monocyte CD14 distribution remained constant in all cases, isolating platelet-monocyte interactions to P-selectin/PSGL1-mediated cell-cell contact.
+
+We next designed an ex vivo system to investigate whether platelets can activate human blood monocytes to initiate antigen-specific T cell responses using clinically relevant tumor-associated antigens 
+(TAAs) in combination with human TCR transgenic CD8+ T cell lines. First, we tested platelet-containing and platelet-depleted human leukocyte antigen (HLA)–A2 donor PBMCs (fig. S1B) and their ability to present melanoma-associated antigen recognized by T cells long peptide (MART1 LP) to patient tumor-infiltrating lymphocyte 
+(TIL)–derived MART1-specific DMF5 T cells (Fig. 4B) (51). Plateletcontaining PBMCs yielded up to 10-fold enhancement over plateletdepleted PBMCs in inducing DMF5 T cell human IFN (hIFNg) 
+production, as demonstrated with MART-1 antigen titrations (Fig. 4C). Recombinant human P-selectin was able to significantly restore the ability of platelet-depleted PBMCs to stimulate DMF5 (Fig. 4D, left), 
+confirming that platelet P-selectin mediates enhanced antigen crosspresentation in human samples. To rule out the contribution of nonmonocytic PBMC compartments, we repeated the experiment with purified human monocytes (Fig. 4D, right). P-selectin–treated plateletdepleted monocytes showed no significant difference against plateletcontaining monocytes in ability to cross-present antigen to DMF5.
+
+Han ., 6 We extended our studies to the human papilloma virus-16 (HPV-16) 
+E7 oncoprotein, using E7-specific human T cells created by transgenic modification of human donor T cells (52). Our results with E7 LP align with findings for tumor antigen MART-1, similarly demonstrating absence of antigen presentation capabilities with platelet depletion and confirming that immunogenic antigen cross-presentation in human peripheral blood can be driven by platelets for several cancerrelevant antigens (Fig. 4E).
+
+Continuing parallels between murine and human monocytes in platelet-dependent activation prompted us to check phenotypic maturation. Over 4 days of culture, CD11c+ human monocytes in platelet-containing PBMCs significantly up-regulated expressions of CD86, HLA-DR, and HLA-A,B,C in comparison to monocytes in platelet-depleted culture (Fig. 4F). These data demonstrate that platelet-induced functional changes in antigen processing and presentation are accompanied by evolution of traditional DC phenotypes in human peripheral blood monocytes. Consistent with murine data, platelet presence up-regulated CD14 in human phDC. 
+
+CD14+ monocytes have been shown to differentiate into DC populations upon migration through inflamed endothelium (14, 32), and CD14 is also known to initiate and regulate activation and DC life cycles through Src family kinase and Ca++/calcineurin-dependent pathways in DC (53), strengthening the link between platelet-mediated monocyte maturation and physiological mechanisms of DC generation in vivo. Overall, evidence of P-selectin/PSGL1 signaling between platelets and monocytes, phenotypic monocyte maturation, and acquisition of functional cross-presentation capacity indicate platelet-dependent mechanisms of monocyte-to-DC differentiation in both murine and human assays.
+
+## Platelet-Mediated Signaling Activates Antigen Processing And Presentation Pathways
+
+P-selectin has been shown to induce leukocyte activation of Src and Src family kinases (54–56), mitogen-activated protein (MAP) kinase signaling (57), nuclear translocation of nuclear factor B (NFB) 
+(58), and cytokine secretion (59), although prior reports have primarily focused on neutrophils (55–57). These signaling events, however, have proven essential for cytokine-mediated differentiation of DC from monocytes (53, 60); thus, we assessed the activation of these pathways in platelet-exposed and platelet-deprived monocyte populations to identify platelet-initiated signaling pathways invoked in monocytes. Western blot analysis showed that platelet exposure leads to activation of Src kinase in monocytes, as indicated by an increase in Src phosphorylation (Fig. 5A). Src kinase is known to phosphorylate p85, the regulatory subunit of phosphatidylinositol 3 (PI3) kinase complex, resulting in integrin activation (55). The PI3 kinase signaling cascade also results in the phosphorylation and activation of Akt (60), which we also observe in platelet stimulated monocytes (Fig. 5A).
+
+The Tec family kinase, Bruton tyrosine kinase (BTK), is activated via signaling events mediated by PI3 kinase (61) and the action of Src family kinases (62) and is implicated in the downstream signaling of PSGL1 (56). BTK, in turn, activates the MAP kinase pathway and phospholipase C–, which leads to calcium flux (57, 59). Western blot analysis indicated that phosphorylated extracellular signal– regulated kinase (ERK) levels were elevated when monocytes were incubated with platelets (Fig. 5A), verifying the activation of the MAP kinase signaling axis. This led us to directly quantify calcium flux in platelet-exposed or platelet-depleted monocytes using calcium-specific 
+
+![7_image_0.png](7_image_0.png)
+
+Han ., 6 
+
+![8_image_0.png](8_image_0.png)
+
+Han ., 6 dye Fluo-4. As shown by both confocal imaging and corresponding kymographs, platelet-exposed monocytes show significantly increased calcium-associated signal (Fig. 5B, top, and movie S3) compared to platelet-depleted monocytes (Fig. 5B, middle, and movie S4) at levels comparable to ionomycin stimulation (Fig. 5B, bottom, and movie S5). Together with Src, ERK, and Akt signaling, continuing cycles of calcium-fluxing platelet-exposed monocytes as quantitated (Fig. 5C) confirm platelet-associated activation of signaling pathways also reported to be essential in monocyte-to-DC differentiation (60).
+
+The Akt, BTK, and ERK signaling pathways are also upstream regulators of NFB signaling, a major immune cell pathway controlling transcription, cytokine production, and cell survival (58, 60, 63). 
+
+Platelet-initiated NFB nuclear translocation was verified by confocal imaging of platelet-exposed or platelet-depleted PBMC-borne monocytes 
+(Fig. 5, D and E). ERK and NFB signaling pathways are known regulators of DC antigen processing and presentation machinery (63, 64), costimulatory molecule expression, and cytokine secretion 
+(59, 65). As summarized diagrammatically in Fig. 5F, our results showing platelet-driven activation of several signaling pathways in monocytes establish demonstrable links between signaling through the P-selectin/PSGL1 axis and increases in antigen cross-presentation observed in phDC.
+
+## Evidence For Platelet-Matured Dcs Initiating Anticancer Immunity
+
+While soluble antigens make important experimental tools, dying tumor cells are an antigen source with direct clinical relevance to cancer immunology. Mounting an effective adaptive immune response in vivo requires APCs to overcome hurdles in internalizing, processing, and cross-presenting complex cellular antigens. To examine whether phDC could generate anticancer immunity using complex antigen sources, we challenged our platelet-matured mouse and human phDC with apoptotic tumor cells for stimulation assays with tumor antigen–specific T cells. A clinically used ultraviolet A (UVA)– photoactivatable chemotherapy agent, 8-methoxysoralen (8-MOP), was used to induce controlled immunogenic tumor cell death (66, 67).
+
+Platelet-containing or platelet-depleted mouse PBMCs were cocultured overnight with OVA-expressing melanoma, B16OVA, which was treated with 8-MOP/UVA in dosage sufficient to induce immunogenic cell death (67) to allow for tumor antigen acquisition (Fig. 6A). Only platelet-exposed PBMCs were able to cross-present tumor cell–derived antigen to induce antigen-specific OT1 CD8+
+T cell proliferation (Fig. 6B) and stimulate inflammatory cytokine production (Fig. 6C). Apoptotic B16OVA tumor cells alone were unable to stimulate an antigen-specific response, suggesting APC costimulation requirement by naïve OT1 T cells; platelet-depleted PBMCs also failed to induce T cell stimulation, paralleling observations from using sOVA. Unexpectedly, B16OVA-loaded BMDCs were not able to generate a robust T cell proliferation to match that of platelet-containing PBMCs, possibly indicating superior capacity for platelet-matured phDC to process complex cellular antigens (fig. S10). Furthermore, cytotoxic effector:target ratio assays using differentially stimulated effector T cells with live B16OVA tumor targets revealed that OT1 T cells stimulated with platelet-containing PBMCs or monocytes show highest antitumor efficacy (Fig. 6D), 
+significantly exceeding the cytotoxicity of OT1 stimulated by tumorloaded BMDCs or controls.
+
+With considerations for clinical tumor immunotherapy, we extended our analyses to human donor cells and TAA-expressing Han ., 6 patient-derived tumor cells to test human tumor–loaded phDC 
+in generating antigen-specific T cell responses. As outlined in Fig. 6A, PBMCs prepared from HLA-A2 donor blood in presence or absence of autologous platelets were cocultured with 8-MOP/
+UVA–treated tumor cells from two different malignancies, melanoma or head and neck squamous cell carcinoma. Capacity for cross-presentation was then evaluated using tumor antigen– specific human TCR transgenic T cells, DMF5, E6, and E7, for readouts.
+
+We first used primary melanoma MART-1(+) (YUCOT) or MART-1(−)
+(YUSIV and YUSOC) tumor cell lines derived and sequenced by the Yale Dermatology Specialized Programs of Research Excellence (SPORE) Specimen Resource Core (68) to generate apoptotic tumor antigen sources (67) and platelet-exposed or platelet-depleted PBMCs as APCs. Significant DMF5 stimulation was observed in the presence of MART-1+ YUCOT–loaded platelet-containing PBMCs, demonstrating the generation of cross-presenting antitumor human phDC solely from autologous platelets, PBMCs, and dying tumor cells (Fig. 6E).
+
+The remarkable ability of platelets to cue cross-presentation prompted us to explore the role of platelets in skewing uptake and processing capabilities in phDC. We analyzed internalization and intracellular localization of PKH-labeled apoptotic YUCOT by Amnis imaging and found that platelet-exposed human phDC exhibited less than 25% difference in amount of phagocytosed tumor cells compared to platelet-depleted monocytes (Fig. 6F). 
+
+Intracellular sequestration of antigen outside the traditional phagolysosome has been proposed as one explanation for the crosspresentation competence of DC (69). Thus, we quantitated tumor material either localizing in, or outside of, fluorescently labeled lysosomal compartments. Unexpectedly, extralysosomal localization of tumor antigen increased more than twofold in platelet-exposed phDC (Fig. 6, G and H), suggesting that platelet-interactions could be activating phDC for enhanced cross-presentation through mechanisms promoting extralysosomal localization of antigen.
+
+To explore translational opportunities for personalized phDCbased immunotherapy, we examined the ability to generate autologous responses from donor-derived transgenic T cells. Extending our investigations beyond melanoma to an oropharyngeal cancer associated with HPV infection, we challenged donor phDC to cross-present viral tumor oncoprotein antigens using HPV-16 E6/E7-positive head and neck squamous cell carcinoma (HPV+ SCC61) (70). T cells from an individual healthy blood donor were transduced with HPV E6 and E7 antigen–specific TCRs and stimulated with autologous PBMCs or monocytes loaded with 8-MOP/UVA–treated HPV+
+SCC61. Platelet-exposed PBMCs or monocytes elicited significantly enhanced hIFNg responses in autologous E6 (Fig. 6I) and E7 (Fig. 6J) T cells, while platelet-depleted PBMCs or monocytes presented no observable increase in cross-presentation capacity. This not only demonstrates the therapeutic generalizability of human phDC to treatment of antigenic malignancies beyond melanoma but also affirms the potential for personalized immunotherapy using patientderived, platelet-matured phDCs and T cells.
+
+Together, these results confirm that cross-presentation–competent human phDC can be induced specifically through activated platelet interaction with primary monocytes, creating potent therapeutic APCs with a variety of immunologically relevant antigen sources. These findings open the possibility of phDC clinical use in design of personalized cancer immunotherapies.
+
+![10_image_0.png](10_image_0.png)
+
+## Discussion
+
+Our studies identify platelets and platelet-associated molecules as key inducers of monocyte maturation into cross-presenting cells resembling DC, referred to here as phDC due to their physiological, platelet-driven formation without use of exogenous cytokines. When pulsed with soluble or complex cellular tumor antigens, phDC 
+induced from mouse or human blood monocytes exhibited remarkable capacity for stimulation of naïve, primary antigen-specific CD8+
+T cells, in stark contrast to monocytes cultured under plateletdeficient conditions. These suggest that physiological interactions with platelets initiate monocyte-to-DC maturation over a single day, in the absence of added cytokines. Our findings that a limited repertoire of progenitor monocyte features is maintained even after acquiring phenotypic and functional hallmarks characteristic to conventional DC suggest that after transition into phDC, the resulting APCs may undergo further maturation locally in physiologic sites of inflammation or insult that warrant encounters with activated platelets.
+
+It is increasingly recognized that platelets deploy stores of preformed molecules such as junctional adhesion molecule C, GpIb 
+(glycoprotein Ib), and, most prominently, CD40L (CD154) (19, 38) during inflammation and promote leukocyte maturation. However, no previous reports have directly linked platelet interaction with activation of antigen cross-presentation capacity in monocytes. Here, we identify platelet P-selectin as the principal initiator of monocyte cross-presentation programming, a hallmark of adaptive immune control by professional APCs. Platelet P-selectin formed an adhesion synapse signaling axis by binding to monocyte PSGL1, triggering activation and DC-associated phenotypic changes. Although the geometries formed differ from the "bulls-eye" model of the supramolecular activation cluster (71), the monocyte-platelet adhesion junction demonstrates contact-dependent polarization of PSGL1 on monocyte surfaces and suggests dynamic molecular reorganization upon interaction with platelet P-selectin. We hypothesize that the activation synapse between platelets and monocytes acts not only as a tethering interface but also as a dynamic adaptive controller, liken to the immunological synapse between APCs and T cells, modulating P-selectin–mediated activation of PI3 kinase signaling, calcium fluxing, and NFB translocation, as well as, functionally, cross-presentation and DC-maturation (72). Although we identified P-selectin as the primary initiator of platelet-dependent DC maturation and cross-presentation, our studies do not exclude a role for other platelet-borne molecules in linking platelets to adaptive immune functions of blood monocytes.
+
+As part of maintaining tissue homeostasis and immunosurveillance, platelets act as bridges and "pathfinders" for recruiting blood monocyte into inflamed endothelium in vivo (15, 23, 73). Since tissue transmigration/transendothelial trafficking has previously been shown to signal monocyte differentiation for DC conversion (14, 74), our finding that only platelet- and endothelial-associated P- and E-selectins, but not lymphocyte-associated L-selectin, confer cross-presentation capacity on monocytes that further supports intrinsic ties between inflammation in the vasculature, platelets, and monocyte maturation. However, activation of platelets that lead to up-regulation of P-selectin and hemostatic events does not occur spontaneously in vivo. Monocytes and platelets exist in extremely close proximity in the circulation and tissues, and the lack of unprompted or undesirable monocyte activation or thrombotic events indicates that these blood components remain in a tightly controlled, inactivated state under steady-
+Han ., 6 state conditions until signaled by insults such as infection or inflammation (45, 46). Our data indicate that our platelet/monocyte culture system may co-opt the in vivo conditions, normally leading to monocyte activation and DC differentiation during diapedesis, as has been previously suggested by studies using in vitro flow systems (66). This evidence, together with demonstrated plateletdependent signaling cascades central to innate immune activation and adaptive immune function, leads us to speculate that rapid production of therapeutic phDCs from platelet-monocyte interactions leverages physiologic pathways in which platelets intimately connect innate immune processes of wound healing and inflammation to activation of adaptive immunity through in vivo DC differentiation.
+
+Our finding that phDCs mount a robust antigen-specific CTL 
+response against live tumor cells, outperforming cytokine-derived BMDCs, suggests that leveraging physiologic interactions in generating functional DC may be critical for in vivo immunotherapeutic applications. A renewed attention to platelets as a key regulator of physiologic functions and disorders may provide new immunologic insights into previously ill-understood phenomenology. In particular, platelet involvement may explain previous reports of spontaneous DC generation from cultures of whole PBMC preparations (75). Furthermore, our proposed production of cross-presentation– competent, activated platelet–induced phDC cements the mechanism of ECP as one driven by platelet-initiated monocyte-to-DC transition during flow-based ex vivo interactions of PBMCs (76), resolving a clinical enigma that has endured since ECP's introduction 30 years ago until its widespread use today. Our findings further corroborate results from experimental ECP as applied to murine in vivo solid tumor models (16), which exhibited complete loss of therapeutic efficacy upon platelet removal. This platelet-dependent in vivo relevance is strongly supported by data, confirming that DC differentiation was absolutely dependent on the presence of activated platelets in ECP model systems, where monocyte-to-DC maturation was completely blocked by monoclonal anti–P-selectin antibodies (76) and where DC-dependent successful antimelanoma effects in vivo were completely abrogated by the removal of platelets from the experimental ECP system (16). Implications of translation to future designs of DC-based immunotherapies for cancers beyond CTCL and, potentially, opportunistic infections are particularly notable, as our insights are drawn from an existing Food and Drug Administration–approved clinical therapy. To this end, our results in generating patient-specific T cell responses against HPV+ tumor cells using patient-derived phDC represent a seminal step toward clinical implementation of platelet-driven DC maturation for directed personalized immunotherapy.
+
+## Materials And **Methods** Animals
+
+C57Bl/6J and B6.SJL-Ptprca *Pepcb*/BoyJ (B6.SJL CD45.1) mice were purchased from the Jackson Laboratory. OT1 CD45.2 [C57Bl/6-Tg (TcraTcrb)1100Mjb/J] mice that recognize OVA peptide residues 257 to 264 in the context of H2Kb were purchased from the Jackson Laboratory. OT2 CD45.2 [C57/Bl/6-Tg(TcraTcrb)425bn/J] mice that recognize OVA peptide residues 323 to 339 in the context of I-Ab were purchased from the Jackson Laboratory. Age- and sex-matched mice that were at least 9 weeks of age were used for all experiments. Experiments were performed according to the Yale Institutional Animal Care and Use Committee–approved animal protocols, in agreement with the National Institutes of Animal Healthcare Guidelines. Mice were maintained under specific pathogen–free conditions, food, and water provided ad libitum. The animal facility is accredited by the Association for Assessment of Laboratory Animal Care.
+
+## Cell Culture
+
+RPMI 1640, Dulbecco's modified Eagle's medium (DMEM), OptiMEM, and media supplements were obtained from Invitrogen, Carlsbad, CA unless otherwise noted. Complete RPMI 1640 (cRPMI) media were made by supplementing RPMI 1640 with 10% heat-inactivated fetal bovine serum (FBS) (HyClone), 10 mM Hepes, 1% nonessential amino acids, 2 mM l-glutamine, 1 mM sodium pyruvate, 0.05 mM 
+-mercaptoethanol, and antibiotics. All cell lines were cultured at 37°C in 5% CO2. B16F10 cells (provided by M. Bosenberg, Yale University, New Haven, CT) were grown in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. B16F10 melanoma cells expressing truncated cytoplasmic OVA (B16OVA, clone M05. F5, provided by L. D. Falo, Jr., University of Pittsburgh School of Medicine) were maintained in cRPMI with Geneticin G418 (1 mg/ml). YUCOT, YUSOC, and YUSIV human melanoma cell lines (received from the Yale SPORE Skin Cancer Core) were grown in OptiMEM 
+media containing 5% FBS and 1% penicillin/streptomycin. HPV− SCC61 and HPV+ SCC61 (obtained from W. Yarbrough, Yale Department of Surgery) were cultured in DMEM/F12 with 10% FBS, 
+hydrocortisone (0.4 g/ml), and 1% penicillin/streptomycin. DMF5 
+[gift of J. R. Wunderlich, Surgery Branch Cell Prep Core, National Cancer Institute (NCI)], HPV E6 and HPV E7 (gift of C. Hinrichs, NCI Clinical Research Center) TCR transgenic T cell lines were cultured in AIM V media supplemented with 10% Lonza hAB serum and recombinant human IL-2 (600 IU/ml). All cell lines are routinely tested for *Mycoplasma* by standard polymerase chain reaction methods at each cell batch freezing. Cells were used for experiments within one passage of thawing a frozen aliquot.
+
+## Isolation Of **Murine Pbmcs**
+
+Peripheral blood was collected from mice via superficial temporal vein or retro-orbital plexus into containers containing 1:100 of heparin (5000 U/ml; McKesson Packaging Services) unless otherwise stated. To compare the effects of different anticoagulants on platelet activation, blood was collected in Vacutainers precoated with heparin as described above. Platelet-containing PBMCs were isolated from peripheral whole blood via Lympholyte M (Cedarlane Labs) gradient separation, followed by ACK buffer (Lonza) red blood cell lysis.
+
+## Platelet Depletion From **Murine Pbmcs**
+
+CD41 Biotin and subsequent Anti-Biotin MicroBeads with column magnetic separation (Miltenyi Biotec, 130-105-869, 130-090-485, and 130-042-401) were used for platelet depletion from murine PBMCs. Platelet depletion was confirmed by quantitation Hemavet hematology counter (Drew Scientific, HV950FS).
+
+## Monocyte Isolation From **Murine Pbmcs**
+
+Two micrograms each anti-mouse biotin cocktail composed of CD3
+(BioLegend \#100304), LY6G (BioLegend \#127604), NK1.1 (BioLegend \#108704), CD45/B220 (BioLegend \#103204), and CD19 (BioLegend \#115504) and subsequent Anti-Biotin MicroBeads and column magnetic separation (Miltenyi Biotec, 130-090-485 and 130-042-401) 
+Han ., 6 were used for the negative selection of murine monocytes. Anti-mouse CD41 biotin and anti-mouse biotin monocyte cocktail (as described above) were combined with subsequent Anti-Biotin MicroBeads and column magnetic separation for the isolation of platelet-depleted monocytes from murine PBMCs. Monocyte isolation purity was confirmed by flow cytometry, while platelet content was monitored by Hemavet analysis.
+
+## Bmdc Generation
+
+BMDCs were derived in vitro from femur and tibia bone marrow cells of C57/Bl/6J mice. Marrow was flushed from bones using a 25-gauge needle with cell culture media. After passing through a 40-m cell strainer, red blood cells were lysed from bone marrow using ACK lysis buffer and plated in cell culture media containing GM-CSF (20 ng/ml). After 5 days, nonadherent cells were washed and replated in fresh GM-CSF–supplemented media and incubated for 48 hours more. Nonadherent cells were removed, washed, and used immediately for experiments with immature BMDCs. 
+
+LPS-stimmed BMDCs were prepared by stimulating immature BMDCs with LPS (50 ng/ml) for 4 hours under standard culture conditions.
+
+## Incubation Of **Murine Pbmcs, Bmdcs, Or Monocytes** With Soluble And **Cellular Antigen**
+
+Platelet-containing or platelet-depleted murine PBMCs, monocytes, or BMDCs were cultured at 2.5 × 106 cells/ml overnight under standard conditions in RPMI 1640 without phenol red (Invitrogen, Carlsbad, CA) supplemented with 15% autologous mouse serum, 1% penicillin/
+streptomycin, and 1% l-glutamine. OVA was added at 50 g/ml to PBMCs or monocytes during overnight culture. EndoFit (InvivoGen) OVA was used unless otherwise stated. For cultures with apoptotic tumors as cellular antigen, 1.25 × 106 tumor cells/ml were added for overnight culture. After overnight culture, cells were harvested, washed, and plated in 96-well plates in cRPMI.
+
+## Pbmc And Monocyte Stimulation And **Inhibition**
+
+Tissue culture plates were coated with Fc-chimeric P-selectin (CD62P, BioLegend \#755404), E-selectin (CD62E, BioLegend \#755504), and L-selectin (CD62L, BioLegend \#772806) for up to 3 hours under standard culture conditions before addition of cells for overnight culture at 20 g/ml unless otherwise indicated. Tissue culture plates were coated with anti-mouse PSGL1 antibody (4RA10, BD Biosciences 
+\#557787) for up to 3 hours under standard culture conditions before addition of cells for overnight culture at 10 g/ml, unless otherwise indicated. Blocking with anti-mouse CD40 (HM40-3, BioLegend 
+\#102908), CD40L (MR1, BioLegend \#106508), MCP-1 (2H5, BioLegend \#505905), CD41 (MWReg30, BioLegend \#133910), or CD61 (2C9.G2, BioLegend \#104310) and experiments with Ticagrelor (Sigma-Aldrich) and DKK-1 (BioLegend \#759604) were performed by addition to PBMCs before overnight culture. Thrombin (Sigma-Aldrich) was added to the collected PBMCs for 30 min before analysis.
+
+## T Cell Labeling And **Isolation**
+
+Spleens from OT1 and OT2 transgenic mice (aged 10 to 14 weeks) were collected and dissociated into single-cell suspensions. Red blood cells from OT1 and OT2 splenocytes were lysed using ACK lysis buffer and labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE) at 5 M. Labeled cells were washed using 5× volume of cRPMI, and CD8+ or CD4+ T cells from OT1 or OT2 splenocytes were isolated using negative selection kits STEMCELL EasySep Mouse CD8 (\#19853) or CD4 (\#19852) T cell isolation kit, respectively, according to the manufacturer's protocols.
+
+## T Cell Proliferation And **Cytokine Secretion Assays**
+
+CFSE-stained T cells were cocultured at 1 × 106/ml in 96-well plates with 1 × 106/ml of antigen-loaded PBMCs or 1 × 105/ml of antigenloaded monocytes. Cells were cocultured in cRPMI for 3 days under standard conditions. At the end of coculture, cell proliferation indicated by CFSE dilution was assessed by flow cytometry 
+(Attune NxT, FlowJo X). Coculture supernatants were collected and analyzed for IL-2 (BD \#555148) and IFNg enzyme-linked immunosorbent assay (ELISA) (BD \#555138) per the manufacturer's instructions.
+
+## Mouse Flow Cytometry Analysis
+
+Cells were stained following standard protocols. Experiments used antibodies specific for mouse Fc receptor (FcR) block (93, BioLegend \#101320), CD8 (53-6.7, BioLegend \#100712), CD45.2 (104, BioLegend \#109830), CD44 (IM7, BioLegend \#103032), CD69 (H1.2F3, BioLegend \#104508), PD1 (29F.1A12, BioLegend \#135214), KLRG1 (2F1/KLRG1, BioLegend \#138408), CD11b (M1-70, BioLegend \#101206), CD11c (N418, BioLegend \#117320), SIINFEKL-H2Kb (25-D1.16, BioLegend \#141608), CD80 (2D10, BioLegend \#305232), CD83 (Michel-19, BioLegend \#121510), CD86 (GL-1, BioLegend \#105014), MHC II (M5/114.15.2, BioLegend \#107624), granzyme B (QA16A02, BioLegend \#372212), CD16 (93, BioLegend \#101326), CD14 (M14-23, BioLegend \#150106), Ly6G (1A8, BioLegend \#127617), F4/80 (BM8, BioLegend \#133914), CD115 (AFS98, BioLegend \#135510), CD63 (NVG-2, BioLegend \#143906), CD154 (MR1, BioLegend \#106505), CD61 (2C9, BioLegend \#104306), CD62p (RMP-1, BioLegend \#109220), CD41 (MWReg30, BioLegend \#133912), CD3 (17A2, BioLegend \#100210), CD19 (6D5, BioLegend \#115520), NK1.1 (PK136, BioLegend \#108714), B220 (RA3-6B2, BioLegend \#103240), CD25 (PC61, BD Pharmingen \#553866), and CD127 (A7R34, eBioscience 45-127-80). Color-matched isotype control antibodies were obtained from the same vendors. Stratedigm or Attune NxT flow cytometer was used to gate set on live cells by 7-aminoactinomycin D (7-AAD) Viability Staining (BioLegend \#420404), EMA (Invitrogen E1374), or Zombie NIR (BioLegend 
+\#423106) exclusion. A minimum of 3 × 104 events were collected per sample. Data were analyzed with FlowJo 10 software (FlowJo LLC).
+
+## T Cell–Mediated Cytotoxicity
+
+Lactate dehydrogenase (LDH) release assay (Roche, Penzberg, Germany) was used to measure OT1 CD8+ T cell lytic activity against B16OVA target cells in vitro according to the manufacturer's guidelines. B16OVA cells were cultured in cRPMI with Geneticin G418 (1 mg/ml). After confluence, cells were dissociated using trypsin EDTA (Invitrogen, Carlsbad, CA). A total of 104 target cells were incubated with serially diluted, previously activated effector T cells in 200 l of assay medium in a 96-well plate. After 6 hours, the plate was centrifuged at 1500 revolutions per minute, the supernatant was transferred, and 100 l of LDH reaction mixture was added. The plate was incubated at room temperature away from light for 10 min, and absorbance was measured at 492 nm. Percent cell–mediated cytotoxicity was calculated as follows: 100 × (experimental − effector spontaneous − target spontaneous)/(target maximum − target spontaneous).
+
+8-MOP/UVA treatment of murine and **human tumor cells**
+To induce apoptosis, 2.5 × 106 tumor cells (B16OVA, YUCOT, YUSOC, YUSIV, HPV− SCC61, and HPV+ SCC61) were incubated with 8-MOP 
+(200 ng/ml; UVADEX, Therakos) in 300 l of FBS for 20 min and subsequently exposed to 2 J/cm2 (B16OVA and B16F10) or 4 J/cm2 (YUCOT, YUSOC, YUSIV, HPV− SCC61, and HPV+ SCC61) of UVA irradiation. 8-MOP and UVA dosages for each cell line were preestablished by titration to identify the minimal 8-MOP/UVA dose required to render tumor cells nonviable (tumor cell viability assessed by monitoring cell survival and proliferation over 10-day culture following 8-MOP/UVA exposure).
+
+## Ema Cell Death Analysis
+
+A stock concentration of EMA (Invitrogen) at 5 mg/ml in dimethyl sulfoxide was kept frozen and light protected. EMA was diluted in staining buffer to a concentration of 3.75 g/ml and kept on ice and in the dark just before addition to cells. Cells are resuspended at 1 × 106 cells per 100 l (107/ml) in staining buffer and an equal volume of EMA (3.75 g/ml) is added, and the cells are mixed. Cells are kept in the dark and on ice for 3 min. While keeping the tubes on ice, any caps are removed, and the cells are then exposed to a fluorescent light source for 10 min at a 15-cm distance. Cells were then washed in staining buffer and analyzed by flow cytometry. 8-MOP/UVA-treated tumor cells (B16OVA, YUCOT, YUSOC, 
+and YUSIV) were incubated in T25 tissue culture flasks at 2.5 × 106 cells per flask and incubated for 24, 48, and 96 hours under standard culture conditions. Individual flasks were analyzed at each time point for cell death by EMA. Untreated cells were analyzed as negative control.
+
+## Tumor Cell Growth Assay
+
+Tumor cells (B16OVA, YUCOT, YUSOC, and YUSIV) either untreated or treated with 8-MOP/UVA (as described above) were plated in six-well plates at multiple concentrations (1 × 104 to 5 × 105 cells per well) and imaged at 24, 48, and 96 hours after initial plating. Cells were monitored by bright-field imaging at ×10 magnification using Accu-Scope 3031 Microscope Series, and images were taken using Micrometrics SE Premium 4.
+
+## Human Donor Pbmc Isolation
+
+All studies were performed with blood donated by healthy HLA-A2– restricted volunteers. Written informed consent was obtained from all volunteers, and the studies were conducted in accordance with recognized ethical guidelines [e.g., Declaration of Helsinki, Council for International Organizations of Medical Sciences (CIOMS), Belmont Report, and U.S. Common Rule] and were approved by Yale Human Investigational Review Board under protocol number 0301023636. Peripheral blood was collected into 1:100 of heparin (5000 U/ml; McKesson Packaging Services) and platelet-containing PBMCs isolated by density gradient centrifugation over ISOLYMPH (CTL Scientific Supply Corp.) per the manufacturer's protocol, followed by treatment with ACK buffer (Lonza) to eliminate the residual red blood cells. All studies were performed with blood donated by healthy volunteers. We obtained written informed consent from all volunteers, and the studies were conducted in accordance with recognized ethical guidelines (e.g., Declaration of Helsinki, CIOMS, Belmont Report, and U.S. Common Rule) and were approved by Yale Human Investigational Review Board under protocol number 0301023636.
+
+## Platelet Depletion (Negative Selection) From **Human Pbmcs**
+
+Human CD61 MicroBeads and column magnetic separation (Miltenyi Biotec 130-051-101 and 130-042-401) were used for platelet depletion of human PBMCs. Platelet depletion confirmed by Hemavet quantification as above.
+
+## Monocyte Isolation From **Human Pbmcs**
+
+Pan Monocyte Isolation Kit, Human (Miltenyi Biotec, 130-096-537 and 130-042-401) was used for the negative selection of monocytes from human PBMCs. For preparation of platelet-depleted monocytes, human PBMCs were first incubated with huCD61 MicroBeads and then washed and treated with the using the Pan Monocyte Isolation Kit as above. Monocyte isolation purity was confirmed by flow cytometry, while platelet content was monitored by Hemavet quantification as above.
+
+## Overnight Incubation Of **Human Pbmcs Or Monocytes** With Soluble And **Cellular Antigen** Isolated Human Pbmcs Or Monocytes Were Cultured At 2.5 × 106 Cells/Ml
+
+overnight in RPMI 1640 without phenol red (Invitrogen, Carlsbad, CA) supplemented with 15% human AB serum (Lonza) or autologous donor serum, 1% penicillin/streptomycin (Invitrogen), and 1% l-glutamine (Invitrogen) under standard conditions. Soluble antigens; form-fitting peptides, MART127L, HPV E629–38, and HPV 
+E711–19; and LPs, MART1 LP and E7 LP, were added to PBMCs or monocytes during overnight culture. For cultures with apoptotic tumors as cellular antigen, 8-MOP/UVA–treated tumor cells, YUCOT, 
+YUSOC, YUSIV, HPV− SCC61, or HPV+ SSC61, were added at 1.25 × 106 cells/ml for overnight culture. After overnight culture, cells were harvested and analyzed, or washed, and plated in 96-well plates in cRPMI supplemented with 15% human AB serum (Lonza).
+
+## Human Transgenic T Cells
+
+The DMF5 HLA-A2–restricted CD8+ T cells were originally derived and expanded for autologous T cell transfer therapy within the Rosenberg group, NCI Surgery Branch (gift of J. R. Wunderlich, Surgery Branch Cell Prep Core). Cell line was expanded and cryopreserved within the Edelson group in the Department of Dermatology, Yale University. HPV E6 and E7 HLA-A2–restricted CD8+ T cell lines were originally clonally expanded from patient TIL and tested for reactivity against HPV-associated tumors by the Hinrichs group, NCI Clinical Research Center. E6 and E7 CD8+ T cells were reproduced within the Edelson group from healthy HLA-A2+ donor T cells isolated using negative selection (Miltenyi Biotec) and transduced to coexpress either the anti-E6(29-38) TCR anti-E7(11-19) TCR from viral vectors (provided by the Hinrichs group). CD8 T cells were expanded using a rapid expansion protocol. Following expansion, CD8 T cell purity was determined with flow cytometry analysis.
+
+## Human T Cell Activation Assays
+
+DMF5, HPV E6, and HPV E7 T cells were cocultured at 1 × 106/ml in 96-well plates with 1 × 106/ml of antigen-loaded PBMCs or 1 × 105/ml of antigen-loaded monocytes for 3 days under standard culture conditions. Coculture supernatants were analyzed for hIFNg ELISA (BioLegend no. 430103) per the manufacturer's instruction.
+
+## Human Flow Cytometry Analysis
+
+Cells harvested after overnight incubation were stained following standard protocols. Experiments used antibodies specific for human FcR block (BioLegend \#422302), CD11c (Bu15, BioLegend \#337214), 
+Han ., 6 CD80 (2D10, BioLegend \#305220), CD86 (Bu63, BioLegend \#374210) HLA-DR (L243, BioLegend \#307629), HLA-A,B,C (W6/32, BioLegend \#311410), CD14 (M5E2, BioLegend \#301828), CD63 (H5C6, BioLegend \#353007), CD61 (VI-PL2, BioLegend \#336416), CD41/CD61 (PAC-1, BioLegend 362804), CD62p (AK4, BioLegend \#304906), mTCRb (H57-597, BioLegend \#109206), CD4 (OKT4, BioLegend \#317428), CD8 (SK1, BioLegend \#344704), and human CD3-APC (Clone OKT3, BioLegend). Color-matched isotype control antibodies were obtained from the same vendors. Flow cytometry was performed with a Stratedigm flow cytometer with electronic gates set on live cells by a combination of forward and side light scatter and 7-AAD (BioLegend), EMA (Invitrogen), Zombie Aqua (BioLegend), or Zombie NIR (BioLegend) exclusion. A minimum of 3 × 104 events were collected per sample, and data were analyzed with FlowJo software (FlowJo LLC).
+
+## Western Blotting
+
+Cell lysates were prepared by incubating platelet containing or platelet-deprived monocytes in 1% Triton X-100 in 10 mM tris (pH 7.4) and 150 mM sodium chloride + protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche) + phosphatase inhibitors (PhosSTOP, Roche) at 4°C for 1 hour. Protein estimation of the clarified lysate was carried out using Bradford dye (Bio-Rad). Laemmli sample buffer was added to clarified lysates containing equal amount of protein and subjected to SDS–polyacrylamide gel electrophoresis, followed by Western blotting. Antibodies used for analysis, c-Src, ATK, p-AKT, GRP94, glyceraldehyde-3-phosphate dehydrogenase (Proteintech), Phospho-Src, ERK, Phospho-ERK (Cell Signaling Technologies), anti-MART1 antibody (A103; a gift of R. Halaban), or anti-OVA monoclonal antibody (mAb) (Rockland), were used as per the supplier's recommendations.
+
+## Amnis Imaging
+
+ImageStream data and images were acquired using the Amnis Inspire software and the Amnis ImageStreamX Mk II two-camera system, using the 405, 488, 561, and 642 lasers and the 60× objective. Data were analyzed using Amnis IDEAS software (Luminex Corp.). Colocalization was determined using the similarity feature of IDEAS. Similarity feature as defined by IDEAS is as follows: the log-transformed Pearson's correlation coefficent and the measure of the degree to which two images are linearly correlated within a masked region.
+
+## Immunofluorescence Imaging Using Confocal Microscopy
+
+Before imaging analysis, mouse or human PBMC was allowed to adhere on untreated ibidi -Slide VI (ibidi) overnight in media containing autologous serum. Cells were then fixed with 4% Paraformaldehyde (PFA), followed by staining with fluorophore conjugated antibodies anti-mouse CD41 (BD \#562917), CD11b (M1/70, BioLegend \#101254), Ly6G (1A8, BioLegend \#127626), CD62P (RB40.34, BD \#563674), anti-human CD61 (VI-PL2, BD \#744381), CD14 (BioLegend \#325630), CD162 (BD \#562806), and CD62p (BioLegend 
+\#304918). For NFB nuclear translocation analysis, platelet-containing or platelet-depleted human monocytes were incubated overnight in a Petri dish. Subsequently, cells were harvested and stained with NFB 
+(D14E12, Cell Signaling Technologies \#8242) according to the standard protocol. For fixation and permeabilization, eBioscience FoxP3/transcription factor staining kit (Thermo Fisher Scientific 00-5523-00) was used. After staining procedure, cells were transferred on to ibidi -Slide for confocal visualization. Mean intensity of NFB signal was measured within the 4′,6-diamidino-2-phenylindole 
+(DAPI)–stained nuclei of CD14+ monocytes. Fluorescent images were obtained using spinning disk confocal microscope, using an UltraVIEW VoX System (PerkinElmer) equipped with 405-, 488-, 561-, and 647-nm solid-state lasers (Melles Griot), 60× 1.4–numerical aperture oil objective lens, and 1 kb × 1 kb electron multiplying charge-coupled device (Hamamatsu Photonics), and controlled by Volocity software.
+
+## Calcium Influx Analysis
+
+Ca++ influx was determined by using Fluo-4 Calcium Imaging Kit 
+(Thermo Fisher Scientific), followed by costaining with anti-human CD61 antibody (Alexa Fluor 647 conjugate, BioLegend). After completing the staining protocol, cells were plated onto untreated ibidi -Slide 
+(ibidi) immediately before confocal visualization and then monitored for calcium signaling. Imaging commenced upon initial focusing, and individual cells were tracked in 12-s intervals for 1 hour. Ionomycin 
+(Thermo Fisher Scientific) addition was performed at 50 M final concentration and imaged until signal reached saturation. Movie creation and data analysis were performed using Volocity software.
+
+## Statistics
+
+Statistical significance in comparisons was calculated using the one-way or two-way analysis of variance (ANOVA).
+
+## Supplementary Materials Supplementary Material For This Article Is Available At Http://Advances.Sciencemag.Org/Cgi/
+
+content/full/6/11/eaaz1580/DC1 Fig. S1. Platelet depletion from PBMCs. Fig. S2. PBMC-driven OT1 T cell response is antigen specific and platelet dependent. Fig. S3. Monocytes are key PBMC population necessary in observed platelet-dependent cross-presentation. Fig. S4. Platelet-induced maturation in PBMC monocytes and cross-primed T cells. Fig. S5. Platelet-matured monocytes demonstrate specific enhancement of antigen cross-presentation. Fig. S6. Effect of platelet inhibitors on platelet-initiated cross-presentation. Fig. S7. P- and E-selectin rescue cross-presentation in platelet-depleted PBMCs. Fig. S8. rP-selectin and anti-PSGL1 mAb exhibit titratable, monocyte-specific agonist activity for initiating cross-presentation. Fig. S9. Confocal microscopy of human monocytes in presence or absence of activated platelets. Fig. S10. Comparison of APCs in processing apoptotic tumor cells for antigen-specific T cell proliferation.
+
+Movie S1. 3D reconstruction of murine monocyte with platelets.
+
+Movie S2. 3D reconstruction of human monocyte with platelets. Movie S3. Calcium flux in human monocyte upon interaction with platelets. Movie S4. Calcium flux is absent in human monocyte without platelet. Movie S5. Calcium flux in human monocyte upon ionomycin stimulation. Movie S6. 3D construction of monocyte PSGL1 expression and distribution. Movie S7. 3D reconstruction of monocyte PSGL1 around unactivated platelet. Movie S8. 3D reconstruction of monocyte PSGL1 around activated platelet. Movie S9. Cross-sections of P-selectin:PSGL1 platelet-monocyte "adhesion synapse".
+
+View/request a protocol for this paper from *Bio-protocol*.
+
+## References And Notes 1. R. M. Steinman, Decisions About Dendritic Cells: Past, Present, And Future.
+
+Annu. Rev. Immunol. 30, 1–22 (2012).
+
+2. L. Bone, L. F. Whyte, S. A. Carnoutsos, A. H. Cook, D. N. Hart, Monitoring human blood dendritic cell numbers in normal individuals and in stem cell transplantation. *Blood* 93, 728–736 (1999).
+
+3. F. Sallusto, A. Lanzavecchia, Efficient presentation ofsoluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J. *Exp. Med.* 179, 1109–1118 (1994).
+
+4. M. Collin, V. Bigley, Human dendritic cell subsets: An update. *Immunology* 154, 3–20 
+(2018).
+
+5. A.-C. Villani, R. Satija, G. Reynolds, S. Sarkizova, K. Shekhar, J. Fletcher, M. Griesbeck, A. Butler, S. Zheng, S. Lazo, L. Jardine, D. Dixon, E. Stephenson, E. Nilsson, I. Grundberg, D. McDonald, A. Filby, W. Li, P. L. De Jager, O. Rozenblatt-Rosen, A. A. Lane, M. Haniffa, A. Regev, N. Hacohen, Single-cell RNA-seq reveals new types of human blood dendritic cells, monocytes, and progenitors. *Science* 356, eaah4573 (2017).
+
+6. Y. Osugi, S. Vuckovic, D. N. J. Hart, Myeloid blood CD11c+ dendritic cells and monocytederived dendritic cells differ in their ability to stimulate T lymphocytes. *Blood* 100, 2858–2866 (2002).
+
+7. P. Kalinski, H. Edington, H. J. Zeh, H. Okada, L. H. Butterfield, J. M. Kirkwood, D. L. Bartlett, Dendritic cells in cancer immunotherapy: Vaccines or autologous transplants? 
+
+Immunol. Res. 50, 235–247 (2011).
+
+8. P. J. Tacken, I. J. M. de Vries, R. Torensma, C. G. Figdor, Dendritic-cell immunotherapy: 
+From ex vivo loading to in vivo targeting. *Nat. Rev. Immunol.* 7, 790 (2007).
+
+9. R. M. Steinman, I. Mellman, Immunotherapy: Bewitched, bothered, and bewildered no more. *Science* 305, 197–200 (2004).
+
+10. A. Langenkamp, M. Messi, A. Lanzavecchia, F. Sallusto, Kinetics of dendritic cell activation: 
+Impact on priming of TH1, TH2 and nonpolarized T cells. *Nat. Immunol.* 1, 311–316 (2000).
+
+11. P. B. Watchmaker, E. Berk, R. Muthuswamy, R. B. Mailliard, J. A. Urban, J. M. Kirkwood, P. Kalinski, Independent regulation of chemokine responsiveness and cytolytic function versus CD8+ T cell expansion by dendritic cells. J. *Immunol.* 184, 591–597 (2010).
+
+12. C. Cheong, I. Matos, J.-H. Choi, D. B. Dandamudi, E. Shrestha, M. P. Longhi, K. L. Jeffrey, R. M. Anthony, C. Kluger, G. Nchinda, H. Koh, A. Rodriguez, J. Idoyaga, M. Pack, K. Velinzon, C. G. Park, R. M. Steinman, Microbial stimulation fully differentiates monocytes to DC-SIGN/CD209+ dendritic cells for immune T cell areas. *Cell* 143, 416–429 
+(2010).
+
+13. M. Greter, J. Helft, A. Chow, D. Hashimoto, A. Mortha, J. Agudo-Cantero, M. Bogunovic, E. L. Gautier, J. Miller, M. Leboeuf, G. Lu, C. Aloman, B. D. Brown, J. W. Pollard, H. Xiong, G. J. Randolph, J. E. Chipuk, P. S. Frenette, M. Merad, GM-CSF controls nonlymphoid tissue dendritic cell homeostasis but is dispensable for the differentiation of inflammatory dendritic cells. *Immunity* 36, 1031–1046 (2012).
+
+14. G. J. Randolph, S. Beaulieu, S. Lebecque, R. M. Steinman, W. A. Muller, Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking. *Science* 282, 480–484 (1998).
+
+15. G. Zuchtriegel, B. Uhl, D. Puhr-Westerheide, M. Pörnbacher, K. Lauber, F. Krombach, C. A. Reichel, Platelets guide leukocytes to their sites of extravasation. *PLOS Biol.* 14, e1002459 (2016).
+
+16. A. Ventura, A. Vassall, E. Robinson, R. Filler, D. Hanlon, K. Meeth, H. Ezaldein, M. Girardi, O. Sobolev, M. W. Bosenberg, R. L. Edelson, Extracorporeal photochemotherapy drives monocyte-to-dendritic cell maturation to induce anticancer immunity. *Cancer Res.* 78, 4045–4058 (2018).
+
+17. J. S. Raval, N. R. Ratcliffe, Extracorporeal photopheresis and personalized medicine in the 21st century: The future's so bright! J. *Clin. Apher.* 33, 461–463 (2018).
+
+18. N. Kibbi, O. Sobolev, M. Girardi, R. L. Edelson, Induction of anti-tumor CD8 T cell responses by experimental ECP-induced human dendritic antigen presenting cells. 
+
+Transfus. Apher. Sci. 55, 146–152 (2016).
+
+19. C. N. Morrell, A. A. Aggrey, L. M. Chapman, K. L. Modjeski, Emerging roles for platelets asimmune and inflammatory cells. *Blood* 123, 2759–2767 (2014).
+
+20. S. Kossmann, J. Lagrange, S. Jäckel, K. Jurk, M. Ehlken, T. Schönfelder, Y. Weihert, M. Knorr, M. Brandt, N. Xia, H. Li, A. Daiber, M. Oelze, C. Reinhardt, K. Lackner, A. Gruber, B. Monia, S. H. Karbach, U. Walter, Z. M. Ruggeri, T. Renné, W. Ruf, T. Münzel, P. Wenzel, Platelet-localized FXI promotes a vascular coagulation-inflammatory circuit in arterial hypertension. *Sci. Transl. Med.* 9, 1–17 (2017).
+
+21. S. Rachidi, A. Metelli, B. Riesenberg, B. X. Wu, M. H. Nelson, C. Wallace, C. M. Paulos, M. P. Rubinstein, E. Garrett-Mayer, M. Hennig, D. W. Bearden, Y. Yang, B. Liu, Z. Li, Platelets subvert T cell immunity against cancer via GARP-TGF axis. *Sci. Immunol.* 2, eaai7911 
+(2017).
+
+22. S. C. Pitchford, S. Momi, S. Giannini, L. Casali, D. Spina, C. P. Page, P. Gresele, Platelet P-selectin is required for pulmonary eosinophil and lymphocyte recruitment in a murine model of allergic inflammation. *Blood* 105, 2074–2081 (2005).
+
+23. C. J. Kuckleburg, C. M. Yates, N. Kalia, Y. Zhao, G. B. Nash, S. P. Watson, G. E. Rainger, Endothelial cell-borne platelet bridges selectively recruit monocytes in human and mouse models of vascular inflammation. *Cardiovasc. Res.* 91, 134–141 (2011).
+
+24. M. R. Yeaman, Platelets: At the nexus of antimicrobial defence. *Nat. Rev. Microbiol.* 12, 426–437 (2014).
+
+25. D. R. Tough, S. Sun, X. Zhang, J. Sprent, Stimulation of naive and memory T cells by cytokines. *Immunol. Rev.* 170, 39–47 (1999).
+
+26. L. M. Chapman, A. A. Aggrey, D. J. Field, K. Srivastava, S. Ture, K. Yui, D. J. Topham, W. M. Baldwin III, C. N. Morrell, Platelets present antigen in the context of MHC class I. 
+
+J. *Immunol.* 189, 916–923 (2012).
+
+27. C. Hespel, M. Moser, Role of inflammatory dendritic cells in innate and adaptive immunity. Eur. J. *Immunol.* 42, 2535–2543 (2012).
+
+28. G. J. Randolph, C. Jakubzick, C. Qu, Antigen presentation by monocytes and monocytederived cells. *Curr. Opin. Immunol.* 20, 52–60 (2008).
+
+29. O. P. Joffre, E. Segura, A. Savina, S. Amigorena, Cross-presentation by dendritic cells. 
+
+Nat. Rev. Immunol. 12, 557–569 (2012).
+
+30. F. Geissmann, M. G. Manz, S. Jung, M. H. Sieweke, M. Merad, K. Ley, Development of monocytes, macrophages, and dendritic cells. *Science* 327, 656–661 (2010).
+
+31. S. R. Larson, S. M. Atif, S. L. Gibbings, S. M. Thomas, M. G. Prabagar, T. Danhorn, S. M. Leach, P. M. Henson, C. V. Jakubzick, Ly6C+ monocyte efferocytosis and crosspresentation of cell-associated antigens. *Cell Death Differ.* 23, 997–1003 (2016).
+
+32. G. J. Randolph, K. Inaba, D. F. Robbiani, R. M. Steinman, W. A. Muller, Differentiation of phagocytic monocytes into lymph node dendritic cells in vivo. *Immunity* 11, 753–761 
+(1999).
+
+33. S. D. Wright, R. A. Ramos, P. S. Tobias, R. J. Ulevitch, J. C. Mathison, CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. *Science* 249, 1431–1433 (1990).
+
+34. G. Passacquale, P. Vamadevan, L. Pereira, C. Hamid, V. Corrigall, A. Ferro, Monocyteplatelet interaction induces a pro-inflammatory phenotype in circulating monocytes. 
+
+PLOS ONE 6, e25595 (2011).
+
+35. R. Goncalves, X. Zhang, H. Cohen, A. Debrabant, D. M. Mosser, Platelet activation attracts a subpopulation of effector monocytes to sites of *Leishmania major* infection. J. *Exp. Med.* 208, 1253–1265 (2011).
+
+36. I. Fricke, D. Mitchell, F. Petersen, A. Böhle, S. Bulfone-Paus, S. Brandau, Platelet factor 4 in conjunction with IL-4 directs differentiation of human monocytes into specialized antigen-presenting cells. *FASEB J.* 18, 1588–1590 (2004).
+
+37. M. Hagihara, A. Higuchi, N. Tamura, Y. Ueda, K. Hirabayashi, Y. Ikeda, S. Kato, S. Sakamoto, T. Hotta, S. Handa, S. Goto, Platelets, after exposure to a high shear stress, induce IL-10-producing, mature dendritic cells in vitro. J. *Immunol.* 172, 5297–5303 (2004).
+
+38. B. D. Elzey, J. Tian, R. J. Jensen, A. K. Swanson, J. R. Lees, S. R. Lentz, C. S. Stein, B. Nieswandt, Y. Wang, B. L. Davidson, T. L. Ratliff, Platelet-mediated modulation of adaptive immunity. A communication link between innate and adaptive immune compartments. *Immunity* 19, 9–19 (2003).
+
+39. B. S. Coller, Platelets and thrombolytic therapy. N. Engl. J. *Med.* 322, 33–42 (1990).
+
+40. H. Beutier, B. Hechler, O. Godon, Y. Wang, C. M. Gillis, L. de Chaisemartin, A. Gouel-Chéron, S. Magnenat, L. E. Macdonald, A.J. Murphy; NASA Study Group, S. Chollet-Martin, D. Longrois, C. Gachet, P. Bruhns, F. Jönsson, Platelets expressing IgG receptor FcRIIA/CD32A 
+determine the severity of experimental anaphylaxis. *Sci. Immunol.* 3, eaan5997 (2018).
+
+41. J. E. Freedman, J. Loscalzo, Platelet-monocyte aggregates: Bridging thrombosis and inflammation. *Circulation* 105, 2130–2132 (2002).
+
+42. D. A. Carlow, K. Gossens, S. Naus, K. M. Veerman, W. Seo, H. J. Ziltener, PSGL-1 function in immunity and steady state homeostasis. *Immunol. Rev.* 230, 75–96 (2009).
+
+43. A. Zufferey, D. Schvartz, S. Nolli, J.-L. Reny, J.-C. Sanchez, P. Fontana, Characterization of the platelet granule proteome: Evidence of the presence of MHC1 in alpha-granules. 
+
+J. *Proteomics* 101, 130–140 (2014).
+
+44. E. M. Golebiewska, A. W. Poole, Platelet secretion: From haemostasis to wound healing and beyond. *Blood Rev.* 29, 153–162 (2015).
+
+45. J. W. Semple, J. E. Italiano Jr., J. Freedman, Platelets and the immune continuum. 
+
+Nat. Rev. Immunol. 11, 264–274 (2011).
+
+46. P. André, P-selectin in haemostasis. Br. J. *Haematol.* 126, 298–306 (2004).
+
+47. Y. D. Wijeyeratne, S. Heptinstall, Anti-platelet therapy: ADP receptor antagonists. 
+
+Br. J. *Clin. Pharmacol.* 72, 647–657 (2011).
+
+48. C. E. Green, D. N. Pearson, R. T. Camphausen, D. E. Staunton, S. I. Simon, Shear-dependent capping of L-selectin and P-selectin glycoprotein ligand 1 by E-selectin signals activation of high-avidity 2-integrin on neutrophils. J. *Immunol.* 172, 7780–7790 (2004).
+
+49. R. Tinoco, D. C. Otero, A. A. Takahashi, L. M. Bradley, PSGL-1: A new player in the immune checkpoint landscape. *Trends Immunol.* 38, 323–335 (2017).
+
+50. K. C. Ahn, A. J. Jun, P. Pawar, S. Jadhav, S. Napier, O. J. T. McCarty, K. Konstantopoulos, Preferential binding of platelets to monocytes over neutrophils under flow. 
+
+Biochem. Biophys. Res. Commun. 329, 345–355 (2005).
+
+51. L. A. Johnson, B. Heemskerk, D. J. Powell Jr., C. J. Cohen, R. A. Morgan, M. E. Dudley, P. F. Robbins, S. A. Rosenberg, Gene transfer of tumor-reactive TCR confers both high avidity and tumor reactivity to nonreactive peripheral blood mononuclear cells and tumor-infiltrating lymphocytes. J. *Immunol.* 177, 6548–6559 (2006).
+
+52. L. M. Draper, M. L. M. Kwong, A. Gros, S. Stevanovi, E. Tran, S. Kerkar, M. Raffeld, S. A. Rosenberg, C. S. Hinrichs, Targeting of HPV-16+ epithelial cancer cells by TCR gene engineered T cells directed against E6. *Clin. Cancer Res.* 21, 4431–4439 (2015).
+
+53. I. Zanoni, R. Ostuni, G. Capuano, M. Collini, M. Caccia, A. E. Ronchi, M. Rocchetti, F. Mingozzi, M. Foti, G. Chirico, B. Costa, A. Zaza, P. Ricciardi-Castagnoli, F. Granucci, CD14 regulates the dendritic cell life cycle after LPS exposure through NFAT activation. 
+
+Nature 460, 264–268 (2009).
+
+Han ., 6 54. P. Piccardoni, R. Sideri, S. Manarini, A. Piccoli, N. Martelli, G. de Gaetano, C. Cerletti, V. Evangelista, Platelet/polymorphonuclear leukocyte adhesion: A new role for SRC 
+kinases in Mac-1 adhesive function triggered by P-selectin. *Blood* 98, 108–116 (2001).
+
+55. H.-B. Wang, J.-T. Wang, L. Zhang, Z. H. Geng, W.-L. Xu, T. Xu, Y. Huo, X. Zhu, E. F. Plow, M. Chen, J.-G. Geng, P-selectin primes leukocyte integrin activation during inflammation. 
+
+Nat. Immunol. 8, 882–892 (2007).
+
+56. T. Xu, L. Zhang, Z. H. Geng, H.-B. Wang, J.-T. Wang, M. Chen, J.-G. Geng, P-selectin cross-links PSGL-1 and enhances neutrophil adhesion to fibrinogen and ICAM-1 in a Src kinase-dependent, but GPCR-independent mechanism. *Cell Adh. Migr.* 1, 115–123 
+(2007).
+
+57. H. Mueller, A. Stadtmann, H. van Aken, E. Hirsch, D. Wang, K. Ley, A. Zarbock, Tyrosine kinase Btk regulates E-selectin-mediated integrin activation and neutrophil recruitment by controlling phospholipase C (PLC) 2 and PI3K pathways. *Blood* 115, 3118–3127 
+(2010).
+
+58. A. S. Weyrich, T. M. McIntyre, R. P. McEver, S. M. Prescott, G. A. Zimmerman, Monocyte tethering by P-selectin regulates monocyte chemotactic protein-1 and tumor necrosis factor-alpha secretion. Signal integration and NF-kappa B translocation. J. *Clin. Invest.* 95, 2297–2303 (1995).
+
+59. K. I.-P. J. Hidari, A. S. Weyrich, G. A. Zimmerman, R. P. McEver, Engagement of P-selectin glycoprotein ligand-1 enhances tyrosine phosphorylation and activates mitogenactivated protein kinases in human neutrophils. J. *Biol. Chem.* 272, 28750–28756 (1997).
+
+60. J. Xie, J. Qian, J. Yang, S. Wang, M. E. Freeman III, Q. Yi, Critical roles of Raf/MEK/ERK 
+and PI3K/AKT signaling and inactivation of p38 MAP kinase in the differentiation and survival of monocyte-derived immature dendritic cells. *Exp. Hematol.* 33, 564–572 
+(2005).
+
+61. L. E. Rameh, L. C. Cantley, The role of phosphoinositide 3-kinase lipid products in cell function. J. *Biol. Chem.* 274, 8347–8350 (1999).
+
+62. D. J. Rawlings, A. M. Scharenberg, H. Park, M. I. Wahl, S. Lin, R. M. Kato, A.-C. Fluckiger, O. N. Witte, J.-P. Kinet, Activation of BTK by a phosphorylation mechanism initiated by SRC family kinases. *Science* 271, 822–825 (1996).
+
+63. S. Vijayan, T. Sidiq, S. Yousuf, P. J. van den Elsen, K. S. Kobayashi, Class I transactivator, NLRC5: A central player in the MHC class I pathway and cancer immune surveillance. 
+
+Immunogenetics 71, 273–282 (2019).
+
+64. R. R. Brutkiewicz, Cell signaling pathways that regulate antigen presentation. 
+
+J. *Immunol.* 197, 2971–2979 (2016).
+
+65. A. S. Weyrich, M. R. Elstad, R. P. McEver, T. M. McIntyre, K. L. Moore, J. H. Morrissey, S. M. Prescott, G. A. Zimmerman, Activated platelets signal chemokine synthesis by human monocytes. J. *Clin. Invest.* 97, 1525–1534 (1996).
+
+66. R. L. Edelson, Mechanistic insights into extracorporeal photochemotherapy: Efficient induction of monocyte-to-dendritic cell maturation. *Transfus. Apher. Sci.* 50, 322–329 
+(2014).
+
+67. K. Tatsuno, T. Yamazaki, D. Hanlon, P. Han, E. Robinson, O. Sobolev, A. Yurter, F. Rivera-Molina, N. Arshad, R. L. Edelson, L. Galluzzi, Extracorporeal photochemotherapy induces bona fide immunogenic cell death. *Cell Death Dis.* 10, 578 (2019).
+
+68. M. Krauthammer, Y. Kong, B. H. Ha, P. Evans, A. Bacchiocchi, J. P. McCusker, E. Cheng, M. J. Davis, G. Goh, M. Choi, S. Ariyan, D. Narayan, K. Dutton-Regester, A. Capatana, E. C. Holman, M. Bosenberg, M. Sznol, H. M. Kluger, D. E. Brash, D. F. Stern, M. A. Materin, R. S. Lo, S. Mane, S. Ma, K. K. Kidd, N. K. Hayward, R. P. Lifton, J. Schlessinger, T. J. Boggon, R. Halaban, Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. *Nat. Genet.* 44, 1006–1014 (2012).
+
+69. J. E. Grotzke, D. Sengupta, Q. Lu, P. Cresswell, The ongoing saga of the mechanism (s) 
+of MHC class I-restricted cross-presentation. *Curr. Opin. Immunol.* 46, 89–96 (2017).
+
+70. E. Gubanova, B. Brown, S. V. Ivanov, T. Helleday, G. B. Mills, W. G. Yarbrough, N. Issaeva, Downregulation of SMG-1 in HPV-positive head and neck squamous cell carcinoma due to promoter hypermethylation correlates with improved survival. *Clin. Cancer Res.*
+18, 1257–1267 (2012).
+
+71. A. Grakoui, S. K. Bromley, C. Sumen, M. M. Davis, A. S. Shaw, P. M. Allen, M. L. Dustin, The immunological synapse: A molecular machine controlling T cell activation. *Science* 285, 221–227 (1999).
+
+72. K.-H. Lee, A. R. Dinner, C. Tu, G. Campi, S. Raychaudhuri, R. Varma, T. N. Sims, W. R. Burack, H. Wu, J. Wang, O. Kanagawa, M. Markiewicz, P. M. Allen, M. L. Dustin, A. K. Chakraborty, A. S. Shaw, The immunological synapse balances T cell receptor signaling and degradation. 
+
+Science 302, 1218–1222 (2003).
+
+73. J.-E. Alard, A. Ortega-Gomez, K. Wichapong, D. Bongiovanni, M. Horckmans, R. T. A. Megens, G. Leoni, B. Ferraro, J. Rossaint, N. Paulin, J. Ng, H. Ippel, D. Suylen, R. Hinkel, X. Blanchet, F. Gaillard, M. D'Amico, P. von Hundelshausen, A. Zarbock, C. Scheiermann, T. M. Hackeng, S. Steffens, C. Kupatt, G. A. F. Nicolaes, C. Weber, O. Soehnlein, Recruitment of classical monocytes can be inhibited by disturbing heteromers of neutrophil HNP1 and platelet CCL5. *Sci. Transl. Med.* 7, 317ra196 (2015).
+
+74. M. Le Borgne, N. Etchart, A. Goubier, S. A. Lira, J. C. Sirard, N. Rooijen, C. Caux, S. Aït-Yahia, A. Vicari, D. Kaiserlian, B. Dubois, Dendritic cells rapidly recruited into epithelial tissues via 
+
+CCR6/CCL20 are responsible for CD8+ T cell crosspriming in vivo. *Immunity* 24, 191–201 
+(2006).
+
+75. C. S. K. Ho, D. Munster, C. M. Pyke, D. N. J. Hart, J. A. López, Spontaneous generation and survival of blood dendritic cells in mononuclear cell culture without exogenous cytokines. *Blood* 99, 2897–2904 (2002).
+
+76. T. S. Durazzo, R. E. Tigelaar, R. Filler, A. Hayday, M. Girardi, R. L. Edelson, Induction of monocyte-to-dendritic cell maturation by extracorporeal photochemotherapy: 
+Initiation via direct platelet signaling. *Transfus. Apher. Sci.* 50, 370–378 (2014).
+Acknowledgments: We thank M. Ene for guiding discussions, critical inputs, and unwavering intellectual support throughout project development, manuscript preparation, and visual media curation. We thank B. Coller at Rockefeller University and P. Cresswell in the Department of Immunobiology at Yale School of Medicine for formative discussions and manuscript review. We thank R. Flavell and K. Herold in the Department of Immunobiology at Yale School of Medicine for helpful discussions. We also thank D. Horwitz at University of Southern California school of Rheumatology for intellectual discussions. I. Mellman (Genentech) was an early intellectual force in this work, and we thank him for years of open-mindedness and early guidance regarding the setup of mouse models, optimal experiments for assessing antigen presentation, and processing in DCs. We thank our volunteer blood donors and I. Christensen and her staff at Yale ECP Treatment Center for help with volunteer blood procurement. 
+
+Funding: Given the general implications of the findings for cell therapy, partial funding was facilitated by Integraid Inc. (for partial funding P.H. in the Fahmy Lab) and Toralgen Inc. for procurement of reagents in this work. Partial funding for effort in the Fahmy Lab was also provided by NIH 1R01CA026412, NSF Graduate Research Fellowship Program (to P.H.) and discretionary funds from the Fahmy Lab. Additional funding for the work was provided by Yale Cancer Center (R.E.), NY Cardiac Center GS056321 (R.E.), NIAMSD Training Grant 5T32AR007016, as well as NIH R01- AI097206 (by P. Cresswell), Cancer Research Institute Irvington Postdoctoral Fellowship (to N.A.), and NIH R01GM118486 (to D.T.). Author contributions: P.H. conceptualized and designed the research, curated data, performed experiments, analyzed the results, and drafted the manuscript. D.H. also designed research and methodology, performed experiments, and drafted the manuscript. N.A. performed investigation and drafted the manuscript. J.S.L. and K.T. performed investigation, data curation, analysis, and manuscript revision. C.C. and F.R.-M. performed investigation. E.R. performed project administration and resource management. R.F. performed experiments and provided resources. O.S. discussed the results, helped with visualization, and drafted the manuscript. D.T. provided funding and resources. T.F. and R.E. conceptualized the research, acquired funding, and provided project supervision. **Competing interests:** O.S. is VP 
+Immunology at Transimmune AG. R.E. has ownership interest (including patents) in and is a consultant/advisory board member of Transimmune AG. All other authors declare that they have no competing interests. **Data and materials availability:** All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this to this paper may be requested from the authors. The human DMF5 cell line can be provided by the Surgery Branch, NCI, pending scientific review and a completed material transfer agreement. Requests for the DMF5 cell line should be submitted to S. Rosenberg, MD, PhD, Surgery Branch, NCI. Submitted 16 August 2019 Accepted 17 December 2019 Published 11 March 2020 10.1126/sciadv.aaz1580 Citation: P. Han, D. Hanlon, N. Arshad, J. S. Lee, K. Tatsuno, E. Robinson, R. Filler, O. Sobolev, C. Cote, F. Rivera-Molina, D. Toomre, T. Fahmy, R. Edelson, Platelet P-selectin initiates cross-presentation and dendritic cell differentiation in blood monocytes. *Sci. Adv.* 6, eaaz1580 (2020).

medical/md/PMC7141989.md

@@ -0,0 +1,340 @@
+
+
+![0_image_0.png](0_image_0.png)
+
+![0_image_1.png](0_image_1.png)
+
+J Audiol Otol 2020;24(2):61-70 pISSN 2384-1621 / eISSN 2384-1710 https://doi.org/10.7874/jao.2019.00346
+
+# Academic Performance, Communication, And Psychosocial Development Of Prelingual Deaf Children With Cochlear Implants In Mainstream Schools
+
+Ji Eun Choi1, Sung Hwa Hong2, and Il Joon Moon3 1 Department of Otorhinolaryngology-Head and Neck Surgery, Dankook University Hospital, Cheonan, Korea 2 Department of Otorhinolaryngology-Head and Neck Surgery, School of Medicine, Sungkyunkwan University, Samsung Changwon Hospital, Changwon, Korea 3 Department of Otorhinolaryngology-Head and Neck Surgery, School of Medicine, Sungkyunkwan University, Samsung Medical Center, Seoul, Korea Received August 28, 2019 Revised October 15, 2019 Accepted November 15, 2019 Address for correspondence Il Joon Moon, MD, PhD
+Department of OtorhinolaryngologyHead and Neck Surgery, School of Medicine, Sungkyunkwan University, Samsung Medical Center, 81 Irwon-ro, Gangnam-gu, Seoul 06351, Korea Tel +82-2-3410-3579 Fax +82-2-3410-3879 E-mail moonij@skku.edu Background and Objectives: To assess the academic performance, communication skills, and psychosocial development of prelingual deaf children with cochlear implants (CIs) attending mainstream schools, and to evaluate the impact of auditory speech perception on their classroom performance. **Subjects and Methods**: As participant, 67 children with CI attending mainstream schools were included. A survey was conducted using a structured questionnaire on academic performance in the native language, second language, mathematics, social studies, science, art, communication skills, self-esteem, and social relations. Additionally, auditory and speech performances on the last follow-up were reviewed retrospectively. **Results**: Most implanted children attending mainstream school appeared to have positive selfesteem and confidence, and had little difficulty in conversing in a quiet classroom. Also, half of the implanted children (38/67) scored above average in general academic achievement. 
+
+However, academic achievement in the second language (English), social studies, and science were usually poorer than general academic achievement. Furthermore, half of the implanted children had difficulty in understanding the class content (30/67) or conversing with peers in a noisy classroom (32/67). These difficulties were significantly associated with poor speech perception. **Conclusions**: Improving the listening environment for implanted children attending mainstream schools is necessary. **J Audiol Otol 2020;24(2):61-70**
+KEY WORDS:0Cochlear implant · Mainstreaming education · Academic performance · 
+Psychosocial aspects.
+
+## Introduction
+
+![0_Image_2.Png](0_Image_2.Png)
+
+Profound deafness in childhood affects the development of auditory speech perception, speech production, and language skills. Failure to develop adequate oral communication skills can have a significant negative effect on academic performance and psychosocial development in these children. A 
+cochlear implant (CI) is an electronic prosthetic device that is surgically placed in the inner ear to provide useful sound This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
+
+perception by electrically stimulating the auditory nerve. It has been proved to be an effective management device for children with bilaterally severe-to-profound sensorineural hearing loss receiving limited benefit from hearing aids (HAs). 
+
+Many studies have demonstrated the benefits of CIs concerning speech perception, production, and language development due to the enhanced audition provided by CIs [1-5]. Thus, the academic performance and psychosocial development of children with CIs is expected to be better than their non-implanted peers. Over the past two to three decades, there has been a significant trend towards placing students with special educational needs in mainstream schools rather than in segregated special schools and special classes [6]. Besides, the proportion of children with CIs in mainstream schools has been steadily increasing [7-9]. Thus, classroom performance and social integration are some of the major challenges faced by children with CIs in mainstream schools. However, only a few studies have addressed the academic performance and psychosocial development of these children in mainstream schools, and have reported mixed results. Some studies reported that children with CIs in mainstream schools had satisfactory academic achievement [10,11], while others reported that their academic performance lagged behind their normal-hearing peers 
+[12,13]. Information on the subject-specific academic performance of these children is also lacking [13,14]. As with academic performance, wide variability in psychosocial development has been reported. Some studies reported positive findings regarding the social well-being and social functioning of children with CIs in mainstream schools [12,15,16] while others revealed ongoing difficulties in social participation with normal-hearing peers [17-19]. For successful social integration of children with CIs in inclusive educational settings, the overall classroom performance of children with CIs in mainstream schools, and the factors affecting this performance need to be determined. Thus, our study aimed to assess the academic performance, communication skills, and psychosocial development of prelingual deaf children with CIs attending mainstream schools, and to evaluate the impact of auditory speech perception on their classroom performance. Given the lack of evaluation tools, we used structured questionnaires to examine academic performance in several subjects, communication skills, self-esteem, and the social relations of implanted children. We also reviewed medical speech evaluation records retrospectively. 
+
+## Subjects And Methods Participants
+
+A prospective cohort study of prelingual deaf children with CIs was performed from August to September 2015. All children underwent CI before the age of 5 years at Samsung Medical Center and had at least 5 years of experience with the CI. 
+
+Of the 149 children, 72 agreed to participate in the in-person or telephone interview along with their parents. Of the 72 children, 67 children attending mainstream schools were enrolled. 
+
+Participants included 30 boys and 37 girls with an age range of 6 to 17 years [mean±standard deviation (SD)=10±3 years] 
+at the time of the study. Before implantation, CI candidates underwent auditory brainstem response and auditory steadystate response to predict their hearing thresholds. All the children had bilateral profound sensorineural hearing loss (>90 dB) across the speech frequency range and showed limited benefit from HAs in best-aided conditions. Fifty-one children were implanted with the Nucleus device (Cochlear Corporation, Lane Cove, New South Wales, Australia), and 16 children were implanted with the Clarion device (Advance Bionics Corporation, Sylmar, CA, USA). First devices were implanted at an age ranging from 13 months to 4 years 10 months (mean± 
+SD=31±13 months). The duration of implant usage ranged from 5 to 13 years (mean±SD=8±2 years). 
+
+## Ethics Statement
+
+All the participants were recruited and assessed in the Hearing Laboratory at the Samsung Medical Center. Written informed consent for participation was taken from each participant. The Institutional Review Board of Samsung Medical Center (IRB No. 2015-08-126-007) approved this study. All the study protocols were performed following the relevant guidelines and regulations.
+
+## Auditory And Speech Performance Evaluation
+
+Auditory and speech performances on the last follow-up at the Samsung Medical Center, at least 3 years after the implantation, were reviewed retrospectively. Aided pure-tone thresholds were measured in the sound field using warble tones presented from a loudspeaker located one meter away from the children at 0 degrees azimuth by an experienced audiologist [20]. The auditory perception was evaluated by the categories of auditory performance (CAP) scores. CAP comprises 8 hierarchical divisions of auditory perceptive ability: 0, the lowest level, describes no awareness of environmental sounds; and 7, the highest level, describes the use of a telephone with a familiar speaker. Speech perception in both auditory-only (AO) and audiovisual conditions was evaluated using consonant-vowel-consonant monosyllabic and bi-syllabic words. Stimuli were presented using a monitored live voice of an experienced speech therapist. The presentation level was approximately 70 dB SPL, as determined with a handheld sound level meter. Children were instructed to repeat each presented stimulus. Speech acquisition and production were assessed using the speech production scale (SPC) and the modification of Ling's 7 distinct stages [21,22] of the normal data of Korean phoneme development. The SPC assesses phonetic (articulation) and phonologic (meaningful speech) acquisition levels at each stage in young children with CI. The 'staircase' diagram of SPC is illustrated in in Supplementary Material 1 (in the online-only Data Supplement).
+
+## Questionnaires
+
+A survey of academic performance, communication skills, 62 J Audiol Otol 2020;24(2):61-70 and psychosocial development were conducted through inperson or telephone interviews. A structured questionnaire was designed for children and their parents. Background information about device strategies (unilateral, bilateral, and bimodal CI users) and usage, communication modes (oral or/
+and sign language), and school type were evaluated. Five categories of school enrollment were recognized: ordinary classes in mainstream schools, special classes in mainstream schools, special schools, schools for the deaf, and vocational schools. Grade retention, defined as the need to repeat a year due to failing grades, was also assessed. Academic achievement was assessed using quartiles and included the survey of overall academic performance, language (Korean and English), mathematics, social studies, science, and artistic performance (art and music). Communication development was assessed using closed questions on various situations at school and at home. 
+
+Lastly, self-esteem and social relations were assessed by inquiring about friends and future hopes. An English translation of the questionnaire is provided in Supplementary Material 2 (in the online-only Data Supplement).
+
+## Statistical Analysis
+
+Results were analyzed using SPSS 18.0 (SPSS Inc., Chicago, IL, USA). Clinical information (age, sex, side of first CI, age at first CI, and duration of first CI use) and the results of auditory and speech performance evaluations were compared between the three listening modes using the Kruskal-Wallis and the chi-square tests. In case of a significant difference between the three listening modes, a post-hoc analysis using the Mann-Whitney test or chi-square test was performed to evaluate the differences between two different listening modes (i.e., unilateral CI users vs. bimodal listeners, unilateral CI users vs. bilateral CI users, and bimodal listeners vs. bilateral CI users). Chi-square test or Fisher's exact test was used to compare the distribution of responses to items on academic achievement, communication skills, and psychosocial development according to the three listening modes. To evaluate the impact of auditory speech perception ability on classroom performance, a multivariate logistic model was used to compare the bi-syllabic word recognition scores (WRSs) in AO 
+condition and classroom performance after adjusting for the current age, sex, and listening modes. The Bonferroni correction was applied to the p-value because of multiple testing. 
+
+Adjusted p-values were calculated by multiplying the original p-values by the number of comparisons (3 for listening modes). A p-value or adjusted p-value of less than 0.05 was considered statistically significant.
+
+## Results Demographics
+
+Among 67 children with CIs, 17 children (25%) wore only one CI (unilateral CI users), 29 children (43%) were experienced bimodal listeners with a CI in one ear and an HA in the other (HA+CI), and 21 children (31%) received two implants in sequential procedures (bilateral CI users, CI+CI) with the interval between the first and second implantations ranging from 1-8 years (mean±SD interval=3±2 years). All the children reportedly wore their device(s) more than 70% of the day and used oral communication. Supplementary Table 1 (in the online-only Data Supplement) includes the clinical and device information of each implanted children. Table 1 presents the comparison of the clinical information between the three listening modes (unilateral CI user, bimodal listener, and bilateral CI user). No significant difference was found in age and first CI information (side of first CI, age at first CI, and duration of first CI use) between the three listening modes. However, the sex ratio was significantly different between the three listening modes (p=0.035).
+
+Table 1 also presents the comparisons of the auditory and speech performances between the three listening modes. No significant difference was found in aided pure-tone thresholds of the first device between the three listening modes. Supplementary Table 2 (in the online-only Data Supplement) includes the individual aided pure-tone thresholds at 250, 500 Hz, 1, 2, and 4 kHz. Most children showed good performance in speech evaluation 3 years after the implantation. However, there were significant differences in CAP scores (p=0.006), 
+WRSs (p<0.05 for monosyllabic and bi-syllabic), and SPSs 
+(p=0.001 for phonetic level and p=0.002 for phonologic level) 
+between the three different modes. Overall, the bimodal listeners and bilateral CI users showed significantly superior auditory perception (CAP scores and WRSs) and superior speech production in post-hoc analysis than unilateral CI users (Table 1). There were no significant differences in auditory perception and speech production between bimodal listeners and bilateral CI users in the post-hoc analysis. 
+
+## Academic Performance
+
+Of the total 67 implanted children, 61 and 6 children were enrolled in ordinary classes with normal-hearing peers and a special class in a mainstream school, respectively. Grade retentions were reportedly experienced by 12 children (18%) one or more times. Table 2 shows participants' clinical information and speech performance. Eight of these children were unilateral CI users, 1 child was a bimodal listener, and 3 were bilateral CI users. Two children had Noonan syndrome, 1 child had congenital heart disease, and 1 child had enlarged vestibular aqueduct syndrome.
+
+Fig. 1A shows the academic performance of the 67 implanted children attending mainstream schools in each subject. 
+
+When the academic achievement was assessed using quartiles, 28, 10, 17, and 12 implanted children had general academic achievement in the 1-25% (top 25%), 26-50%, 51-75%, 
+and 76-100% (bottom 25%) of their class, respectively. Ac-
+
+| Table 1. Demographics of unilateral CI users, bimodal listeners, and bilateral CI users Group 1  Group 2   Group 3                   | p* for    |           |          |                |           |           |        |
+|--------------------------------------------------------------------------------------------------------------------------------------|-----------|-----------|----------|----------------|-----------|-----------|--------|
+| (n=17)                                                                                                                               | (n=29)    | (n=21)    | p-values | group  1 vs. 2 | p* for    | p* for    |        |
+| Variable                                                                                                                             | group     | group     |          |                |           |           |        |
+| Unilateral                                                                                                                           | Bimodal   | Bilateral | 2 vs. 3  |                |           |           |        |
+| CI users                                                                                                                             | listeners | CI users  |          |                |           |           |        |
+| Age (years)                                                                                                                          | 11±3      | 10±3      | 10±3     | 0.118§         |           |           |        |
+| Sex (male:female)                                                                                                                    | 11:6      | 8:21      | 11:10    | 0.035†∥        | 0.042†∥   | 1.332†    | 0.225† |
+| Side of first device (right:left)                                                                                                    | 9:8       | 14:15     | 16:5     | 0.125†         |           |           |        |
+| First device (Nucleus:Clarion)                                                                                                       | 10:7      | 23:6      | 18:3     | 0.134†         |           |           |        |
+| Age at first CI (months)                                                                                                             | 30±13     | 31±11     | 30±15    | 0.669§         |           |           |        |
+| Duration of first CI use (years)                                                                                                     | 9±3       | 8±2       | 8±2      | 0.057§         |           |           |        |
+| Aided PTA of the first CI (W4FA, dB HL)                                                                                              | 27±6      | 28±11     | 25±4     | 0.538§         |           |           |        |
+| CAP scores                                                                                                                           | 5.8±1.2   | 6.6±0.7   | 6.7±0.7  | 0.006§∥        | 0.018‡∥   | 0.021‡∥   | 2.424‡ |
+| Mono-syllabic WRSs (%) AV condition                                                                                                  | 80±32     | 96±19     | 99±5     | <0.001§∥      | 0.003‡∥   | <0.001‡∥ | 0.951‡ |
+| AO condition                                                                                                                         | 61±31     | 86±19     | 93±8     | <0.001§∥      | <0.001‡∥ | <0.001‡∥ | 0.231‡ |
+| Bi-syllabic WRSs (%) AV condition                                                                                                    | 85±32     | 96±19     | 99±5     | 0.009§∥        | 0.066‡    | 0.027‡∥   | 0.951‡ |
+| AO condition                                                                                                                         | 68±33     | 89±19     | 95±8     | <0.001§∥      | 0.018‡∥   | <0.001‡∥ | 0.165‡ |
+| Speech production scale Phonetic level                                                                                               | 6.3±1.3   | 7.3±0.9   | 7.6±0.7  | 0.001§∥        | 0.012‡∥   | 0.003‡∥   | 0.882‡ |
+| Phonologic level                                                                                                                     | 6.6±1.2   | 7.4±0.9   | 7.7±0.6  | 0.002§∥        | 0.045‡∥   | 0.003‡∥   | 0.345‡ |
+| Continuous values were presented as mean±standard deviation. *Adjusted p-values were calculated by multiplying the original  1 vs. 3 |           |           |          |                |           |           |        |
+
+| Table 2. Clinical information and speech performance of children who experienced grade retention First Cochlear Implantation Aided PTA Bi-syllabic Subject Sex Current age (year) Age at Duration Type of   | Comments      |    |    |    |    |      |     |                                |
+|-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|---------------|----|----|----|----|------|-----|--------------------------------|
+| device                                                                                                                                                                                                      | condition (%) |    |    |    |    |      |     |                                |
+| W4F (dB HL)                                                                                                                                                                                                 | WRS in AO     |    |    |    |    |      |     |                                |
+| of CI use (year)                                                                                                                                                                                            |               |    |    |    |    |      |     |                                |
+| UCI5                                                                                                                                                                                                        | M             | 15 | N  | 50 | 12 | 28.3 | 60  | Congenital heart disease       |
+| UCI6                                                                                                                                                                                                        | M             | 14 | C  | 36 | 11 | 35.0 |     | 0                              |
+| UCI11                                                                                                                                                                                                       | M             | 10 | N  | 24 | 9  | 18.3 | 92  |                                |
+| UCI12                                                                                                                                                                                                       | F             | 12 | C  | 39 | 9  | 30.8 |     | 0                              |
+| UCI14                                                                                                                                                                                                       | F             | 14 | N  | 47 | 10 | 36.7 | 36  |                                |
+| UCI15                                                                                                                                                                                                       | F             | 12 | C  | 35 | 10 | 23.3 | 80  |                                |
+| UCI16                                                                                                                                                                                                       | M             | 11 | C  | 23 | 10 | 25.0 | 76  | Revision CI (3 years after CI) |
+| UCI17                                                                                                                                                                                                       | M             | 7  | N  | 32 | 5  | 29.2 | 84  |                                |
+| CI+HA12                                                                                                                                                                                                     | F             | 9  | N  | 27 | 7  | 22.5 | 84  | Noonan syndrome                |
+| BCI2                                                                                                                                                                                                        | F             | 17 | N  | 58 | 12 | 27.5 | 88  |                                |
+| BCI4                                                                                                                                                                                                        | F             | 9  | N  | 21 | 8  | 22.5 | 100 | EVAS                           |
+| BCI18                                                                                                                                                                                                       | M             | 8  | C  | 18 | 7  | 26.7 | 100 | Noonan syndrome                |
+| M: male, F: female, N: Nucleus, C: Clarion, CI: cochlear implant, PTA: pure-tone average, W4F: weighted four-frequency average [W4F=(0.5 kHz+2×1 kHz+2×2 kHz+4 kHz)⁄6], EVAS: enlarged vestibular aqueduct syndrome, WRS: word recognition score,  AO: auditory-only, UCI: unilateral CI, HA: hearing aid, BCI: bilateral CIimplantation (month)                                                                                                                                                                                                             |               |    |    |    |    |      |     |                                |
+
+![4_image_0.png](4_image_0.png)
+
+ademic achievements in English (p=0.005 in chi-square test) 
+and social studies (p=0.039 in chi-square test) were significantly lower than general academic achievement. Fig. 1B 
+shows the academic performance in each subject according to the listening modes. Academic achievement in social studies 
+(p=0.036 in Fischer's exact test) and science (p=0.028 in Fischer's exact test) differed significantly according to the listening modes. In post-hoc analysis with Fischer's exact test, unilateral CI users showed poorer academic achievement in social studies (adjusted p=0.026) and science (adjusted p=0.014) than bilateral CI users. These differences were insignificant between bimodal listeners and bilateral CI users. 
+
+Communication skills and psychosocial development Table 3 shows communication skills at school and at home, and psychosocial development of the 67 implanted children attending mainstream schools. About half (55%) of the children understood all or almost all of the teaching content (Q1 at school). In a quiet classroom, most implanted children (79%) reported little or no difficulty during one-on-one conversations 
+(Q2 at school). Also, most implanted children (88%) experienced little or no stress conversing with an unfamiliar person at school (Q4 at school). However, half of the implanted children (48%) reported some difficulty during individual conversations in a noisy classroom (Q3 at school). Difficulty in communicating during class (Q1 at school) or in a quiet classroom 
+(Q2 at school) differed significantly depending on the listening mode. In post-hoc analysis with Fischer's exact test, bilateral CI users understood the class content better than bimodal listeners (adjusted p=0.037) and were more comfortable with individual conversations in a quiet classroom than unilateral CI users (adjusted p=0.02). 
+
+Implanted children generally experienced more difficulty communicating at school than at home. At home, 91% and 76% of implanted children reported little or no difficulty communicating in a quiet and noisy background, respectively (Q1 and Q2 at home). However, only 34% of the implanted children were able to understand all or almost all the words of their family while concentrating on other things (Q3 at home). No significant difference was found in communication skills at home between the three listening modes. 
+
+A survey of psychosocial development revealed that most implanted children (96%) had a friend with normal hearing (Q1), and 96% of implanted children were unafraid of making 
+
+| Table 3. Communication skills and psychosocial development Questionnaire                                             | Total                                                                 | Unilateral   | Bimodal   | Bilateral   | p for   |
+|----------------------------------------------------------------------------------------------------------------------|-----------------------------------------------------------------------|--------------|-----------|-------------|---------|
+| CI users                                                                                                             | listeners                                                             | CI users     | groups    |             |         |
+| Communication at school Q1. In the class,                                                                            | 0.004*†                                                               |              |           |             |         |
+| A1                                                                                                                   | I can understand all the teaching content.                            | 13           | 2         | 2           | 9       |
+| A2                                                                                                                   | I can understand almost all the teaching content.                     | 24           | 5         | 12          | 7       |
+| A3                                                                                                                   | I can understand about half of the teaching content.                  | 25           | 6         | 14          | 5       |
+| A4                                                                                                                   | I can understand only 20-30% of the teaching content.                 | 4            | 4         | 0           | 0       |
+| A5                                                                                                                   | I barely understand the teaching content.                             | 1            | 0         | 0           | 0       |
+| Q2. During a one-on-one conversation with a friend in a quiet classroom,                                             | 0.033*†                                                               |              |           |             |         |
+| A1                                                                                                                   | I have no difficulty having a conversation.                           | 37           | 9         | 14          | 14      |
+| A2                                                                                                                   | I have a little difficulty having a conversation.                     | 16           | 1         | 9           | 6       |
+| A3                                                                                                                   | I can understand about half of my friend's words.                     | 11           | 6         | 5           | 0       |
+| A4                                                                                                                   | I can understand 20-30% of my friend's words.                         | 3            | 1         | 1           | 1       |
+| A5                                                                                                                   | I struggle to have a conversation.                                    | 0            | 0         | 0           | 0       |
+| Q3. During a one-on-one conversation with a friend in a noisy classroom,                                             | 0.382†                                                                |              |           |             |         |
+| A1                                                                                                                   | I have no difficulty having a conversation.                           | 4            | 0         | 1           | 3       |
+| A2                                                                                                                   | I have a little difficulty having a conversation.                     | 31           | 7         | 13          | 11      |
+| A3                                                                                                                   | I can understand about half of my friend's words.                     | 25           | 6         | 13          | 6       |
+| A4                                                                                                                   | I can understand 20-30% of my friend's words.                         | 5            | 3         | 1           | 1       |
+| A5                                                                                                                   | I struggle to have a conversation.                                    | 2            | 1         | 1           | 0       |
+| Q4. During conversation with an unfamiliar person,                                                                   | 0.968†                                                                |              |           |             |         |
+| A1                                                                                                                   | I can converse without stress.                                        | 29           | 8         | 11          | 10      |
+| A2                                                                                                                   | I am slightly stressed during the conversation, but I can still talk. | 30           | 7         | 14          | 9       |
+| A3                                                                                                                   | I try to avoid the conversation as much as possible.                  | 8            | 2         | 4           | 2       |
+| A4                                                                                                                   | I absolutely avoid the conversation.                                  | 0            | 0         | 0           | 0       |
+| Communication at home Q1. During conversation with family in a quiet background,                                     | 0.664†                                                                |              |           |             |         |
+| A1                                                                                                                   | I have no difficulty having a conversation.                           | 52           | 11        | 24          | 17      |
+| A2                                                                                                                   | I have a little difficulty having a conversation.                     | 9            | 4         | 3           | 2       |
+| A3                                                                                                                   | I can understand about half of my family's words.                     | 6            | 2         | 2           | 2       |
+| A4                                                                                                                   | I can understand 20-30% of my family's words.                         | 0            | 0         | 0           | 0       |
+| A5                                                                                                                   | I struggle to have a conversation.                                    | 0            | 0         | 0           | 0       |
+| Q2. During conversation with family in a noisy background,                                                           | 0.786†                                                                |              |           |             |         |
+| A1                                                                                                                   | I have no difficulty having a conversation.                           | 23           | 4         | 11          | 8       |
+| A2                                                                                                                   | I have a little difficulty having a conversation.                     | 28           | 7         | 11          | 10      |
+| A3                                                                                                                   | I can understand about half of my family's words.                     | 12           | 5         | 5           | 2       |
+| A4                                                                                                                   | I can understand 20-30% of my family's words.                         | 4            | 1         | 2           | 1       |
+| A5                                                                                                                   | I struggle to have a conversation.                                    | 0            | 0         | 0           | 0       |
+| Q3. If my family suddenly speaks to me while I am concentrating on other things (e.g., watching TV, reading a book), | 0.814†                                                                |              |           |             |         |
+| A1                                                                                                                   | I can understand all the words.                                       | 4            | 0         | 1           | 3       |
+| A2                                                                                                                   | I can understand almost all the words.                                | 19           | 5         | 8           | 6       |
+| A3                                                                                                                   | Sometimes I ask what was said because I have missed words.            | 32           | 8         | 16          | 8       |
+| A4                                                                                                                   | I usually ask what was said because I have missed words.              | 9            | 3         | 3           | 3       |
+| A5                                                                                                                   | I miss words spoken by my family.                                     | 3            | 1         | 1           | 1       |
+| Self-esteem and social relations Q1. My friends                                                                      | 0.784†                                                                |              |           |             |         |
+| A1                                                                                                                   | Mostly have normal hearing.                                           | 64           | 17        | 27          | 20      |
+| A2                                                                                                                   | Mostly have hearing loss and use hearing aids or                      | 0            | 0         | 0           | 0       |
+| cochlear implants.                                                                                                   |                                                                       |              |           |             |         |
+| 66 J Audiol Otol 2020;24(2):61-70                                                                                    |                                                                       |              |           |             |         |
+
+| Table 3. Communication skills and psychosocial development (continued) Questionnaire                            | Total                                                              | Unilateral   | Bimodal   | Bilateral   | p for   |    |
+|-----------------------------------------------------------------------------------------------------------------|--------------------------------------------------------------------|--------------|-----------|-------------|---------|----|
+| CI users                                                                                                        | listeners                                                          | CI users     | groups    |             |         |    |
+| A3                                                                                                              | Range from those with normal hearing to those with                 | 3            | 0         | 2           | 1       |    |
+| hearing loss.                                                                                                   |                                                                    |              |           |             |         |    |
+| A4                                                                                                              | Mostly have hearing loss and use sign language.                    | 0            | 0         | 0           | 0       |    |
+| Q2. What do you want to be (do) in the future?                                                                  | 0.332‡                                                             |              |           |             |         |    |
+| A1                                                                                                              | I want to be a (                                                   | ).           | 52        | 11          | 24      | 17 |
+| A2                                                                                                              | I don't know.                                                      | 15           | 6         | 5           | 4       |    |
+| Q3. Do you think that you'll be able to have the same career as people with normal hearing?                     | 0.299‡                                                             |              |           |             |         |    |
+| A1                                                                                                              | Yes, I think so.                                                   | 37           | 7         | 15          | 15      |    |
+| A2                                                                                                              | It may be difficult, but I think it will be possible if I try.     | 24           | 7         | 12          | 5       |    |
+| A3                                                                                                              | I think it's very unlikely.                                        | 6            | 3         | 2           | 1       |    |
+| A4                                                                                                              | I think it's impossible.                                           | 0            | 0         | 0           | 0       |    |
+| Q4. Do you think it will be difficult to perform tasks after getting a job because of difficulty communicating? | 0.220†                                                             |              |           |             |         |    |
+| A1                                                                                                              | No, I don't anticipate that this will be an issue as I have no     | 26           | 4         | 15          | 7       |    |
+| communication difficulties.                                                                                     |                                                                    |              |           |             |         |    |
+| A2                                                                                                              | There may be some communication difficulties, but it will not      | 34           | 9         | 13          | 12      |    |
+| have a significant impact on performing tasks.                                                                  |                                                                    |              |           |             |         |    |
+| A3                                                                                                              | I think communication difficulties will affect my work. I think it | 5            | 3         | 1           | 1       |    |
+| will be difficult to perform most of the tasks required of me.                                                  |                                                                    |              |           |             |         |    |
+| A4                                                                                                              | I don't think I will be able to carry out my work because          | 2            | 1         | 0           | 1       |    |
+| of communication difficulties.                                                                                  |                                                                    |              |           |             |         |    |
+| Q5. When I make a new friend,                                                                                   | 0.404‡                                                             |              |           |             |         |    |
+| A1                                                                                                              | I am not afraid to make a new friend because I don't have          | 40           | 8         | 19          | 13      |    |
+| any difficulty communicating with new people.                                                                   |                                                                    |              |           |             |         |    |
+| A2                                                                                                              | Even though I have a little difficulty communicating with new      | 24           | 7         | 9           | 8       |    |
+| people, I am not afraid to make a new friend.                                                                   |                                                                    |              |           |             |         |    |
+| A3                                                                                                              | I am afraid to make a new friend because it is difficult for me    | 3            | 2         | 1           | 0       |    |
+| to communicate with new people.                                                                                 |                                                                    |              |           |             |         |    |
+| A4                                                                                                              | I don't want to make a new friend because I can't                  | 0            | 0         | 0           | 0       |    |
+| communicate with new people.                                                                                    |                                                                    |              |           |             |         |    |
+| *p<0.05, †Fischer's exact test, ‡chi-squared test. CI: cochlear implant                                        |                                                                    |              |           |             |         |    |
+
+a new friend (Q5). When asked about their future careers, 78% of the children wanted a job (Q2) in various fields regardless of their communication skills. Furthermore, 91% and 90% of the implanted children responded positively when asked about getting a job (Q3) and performing workplace tasks (Q4) in the future. No significant difference was seen in the responses to the psychosocial development survey between the three listening modes.
+
+## The Impact Of Auditory Speech Performance On Classroom Performance
+
+Bivariate logistic regression models were constructed to examine the relationship between bi-syllabic WRS in AO condition and classroom performance (Table 4). Classroom performance (academic achievement and communication at school) 
+was divided into good and poor performance based on the questionnaire responses. Good performers were defined as children who scored above average (within the top 50%) on the academic achievement questionnaires, or to the top 1 and 2 on the communication skills questionnaires. The remaining were defined as children with poor performance. A multivariate logistic regression model was constructed while adjusting for potential confounders (current age, sex, and listening modes). In the crude model, high scores on the bi-syllabic WRSs were significantly associated with a decrease in the odds of having poor academic performance in all subjects except art and music (all p<0.05). However, academic achievement in art and music was not significantly associated with the bi-syllabic WRSs. In the adjusted model, the bi-syllabic identification scores were significantly associated with academic achievement in Korean, social studies, and science (all p<0.05). High scores on the bi-syllabic WRSs were also significantly associated with a decrease in the odds of having communication difficulties at school (all p<0.05 in the adjusted model).
+
+| Table 4. Relationship among bi-syllabic word recognition and classroom performance Variables Good (ref) vs. poor Bi-syllabic WRS (%) Crude model                                                                                                     | Adjusted model*   |         |           |               |        |               |
+|------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|-------------------|---------|-----------|---------------|--------|---------------|
+| performers                                                                                                                                                                                                                                           | N                 | Mean±SD | OR        | 95% CI        | OR     | 95% CI        |
+| Academic achievement General 1-50%                                                                                                                                                                                                                   | 38                | 94±7    | reference |               |        |               |
+| 51-100%                                                                                                                                                                                                                                              | 29                | 75±32   | 0.939†    | (0.892-0.987) | 0.948  | (0.898-1.001) |
+| Korean                                                                                                                                                                                                                                               | 1-50%             | 43      | 92±10     | reference     |        |               |
+| 51-100%                                                                                                                                                                                                                                              | 24                | 74±35   | 0.961†    | (0.930-0.993) | 0.958† | (0.922-0.996) |
+| English                                                                                                                                                                                                                                              | 1-50%             | 24      | 94±8      | reference     |        |               |
+| 51-100%                                                                                                                                                                                                                                              | 43                | 81±28   | 0.940†    | (0.883-1.000) | 0.941  | (0.879-1.008) |
+| Mathematics                                                                                                                                                                                                                                          | 1-50%             | 40      | 94±7      | reference     |        |               |
+| 51-100%                                                                                                                                                                                                                                              | 27                | 74±33   | 0.940†    | (0.896-0.987) | 0.950  | (0.902-1.001) |
+| Social studies                                                                                                                                                                                                                                       | 1-50%             | 32      | 94±9      | reference     |        |               |
+| 51-100%                                                                                                                                                                                                                                              | 35                | 79±30   | 0.952†    | (0.909-0.996) | 0.924† | (0.867-0.985) |
+| Science                                                                                                                                                                                                                                              | 1-50%             | 30      | 94±7      | reference     |        |               |
+| 51-100%                                                                                                                                                                                                                                              | 37                | 79±30   | 0.947†    | (0.900-0.996) | 0.926† | (0.868-0.988) |
+| Art and music                                                                                                                                                                                                                                        | 1-50%             | 41      | 91±17     | reference     |        |               |
+| 51-100%                                                                                                                                                                                                                                              | 26                | 78±30   | 0.976     | (0.952-1.001) | 0.981  | (0.955-1.009) |
+| Communications at school Q1 A1-2                                                                                                                                                                                                                     | 37                | 94±6    | reference |               |        |               |
+| A3-5                                                                                                                                                                                                                                                 | 30                | 75±32   | 0.924†    | (0.872-0.980) | 0.925† | (0.868-0.986) |
+| Q2                                                                                                                                                                                                                                                   | A1-2              | 53      | 93±8      | reference     |        |               |
+| A3-5                                                                                                                                                                                                                                                 | 14                | 59±40   | 0.929†    | (0.885-0.977) | 0.937† | (0.888-0.989) |
+| Q3                                                                                                                                                                                                                                                   | A1-2              | 35      | 94±6      | reference     |        |               |
+| A3-5                                                                                                                                                                                                                                                 | 32                | 77±31   | 0.939†    | (0.892-0.990) | 0.930† | (0.877-0.987) |
+| Q4                                                                                                                                                                                                                                                   | A1-2              | 59      | 87±21     | reference     |        |               |
+| A3-4                                                                                                                                                                                                                                                 | 8                 | 75±37   | 0.984     | (0.960-1.008) | 0.881† | (0.786-0.987) |
+| Good performers were defined as children who scored above average (within the top 50%) on the academic achievement  questionnaires, or among the top 1 and 2 on the questionnaires on communication skills. The rest of the children were defined as |                   |         |           |               |        |               |
+
+## Discussion
+
+In this study, most implanted children (61 of 67) attended ordinary classes with normal-hearing peers in a mainstream school. In Korea, students requiring special education are usually placed in mainstream schools rather than in separate special schools and special classes. Previous studies have emphasized the following principal benefits of inclusive education of implanted children: naturalistic access to typical linguistic and behavioral models of hearing peers, and social acceptance by hearing peers [6,23,24]. Children with CIs in mainstream schools reported having friends with mostly normal hearing (Q1 in Table 3). This result reflects their social interactions with peers during school life. Thus, the inclusive education of implanted children in mainstream schools appears to provide opportunities for contact and social interactions with normal peers. Based on the responses to the psychosocial development questions (self-esteem and social 68 J Audiol Otol 2020;24(2):61-70 relations section in Table 3), most implanted children in mainstream schools seemed to have a positive attitude towards self-esteem and confidence.
+
+In a mainstream education setting, half the implanted children scored above average in general academic achievement 
+(Fig. 1A). Consistent with a previous study [13], academic achievement was best in mathematics. However, academic achievement in a second language (English) and social studies were usually poorer than general academic achievement (Fig. 1A). Particularly, our cohort reported difficulty in listening comprehension and pronunciation in English. When interviewed, the children also had difficulty understanding abstract concepts in social studies and science. Children with lower scores on the bi-syllabic identification test were significantly likely to have poor academic performance in social studies and science (Table 4). This may be because these subjects are often taught with complex verbal explanations. Children with CI have been reported to experience delays in concept formation [25]. Therefore, it is necessary to provide these children with various supplementary materials or preteach them the subject-relevant vocabulary so that the new information can be integrated meaningfully into the prior knowledge framework. 
+
+Most implanted children had little difficulty in conversing in a quiet background at school or home (Table 3). However, communication at school was considerably more challenging than at home in a noisy background. In a noisy background, 24% of the implanted children responded having some difficulty communicating at home, while half of the implanted children (48%) had some difficulty conversing at school. Also, half of the implanted children (45%) had difficulty in understanding the class. Although children with CIs can perceive speech, they may have difficulty in understanding during group or outdoor activities. Therefore, providing a good listening environment by considering the seating arrangements or using hearing assistive technologies such as personal FM systems for some children with poor speech perception is necessary for improving classroom performance. 
+
+This study had several limitations. First, the academic performance outcomes are mostly derived from parents' opinions rather than from scores on validated measures directly testing the children's outcomes. Careful observation of implanted children's classroom performance is required in both national and school-based achievement testing for tracking studies. Second, this study included a heterogeneous group of children in terms of age, implantation age, CI device characteristics, presence or absence of additional disabilities, and the range of received educational supports. This study did not consider the CI device characteristics or educational supports. However, when adjusted for current age, sex, and listening modes, this study demonstrated that speech performance was significantly associated with academic performance. Educating children with CIs in mainstream schools appears to positively impact self-esteem and confidence in social integration in the future. However, 12 of the 67 implanted children attending mainstream schools experienced one or more grade retention episodes. The academic performance of CI children in mainstream schools was mostly satisfactory; however, they scored below average in some subjects. Furthermore, they reported some difficulty in understanding the class content and holding a conversation in a noisy background. Most of these difficulties were reflected by poor speech perception. 
+
+Therefore, improving the listening environment for implanted children in mainstream schools is necessary.
+
+## Supplementary Materials
+
+The online-only Data Supplement is available with this article at https://doi.org/10.7874/jao.2019.00346.
+
+## Acknowledgments None.
+
+Conflicts of interest The authors have no financial conflicts of interest.
+
+## Author Contributions
+
+Conceptualization: Sung Hwa Hong and Il Joon Moon. Data curation: Ji Eun Choi. Formal analysis: Ji Eun Choi. Methodology: Il Joon Moon. Project administration: Sung Hwa Hong. Supervision: Il Joon Moon. Visualization: Ji Eun Choi. Writing—original draft: Ji Eun Choi. Writing—review & editing: Ji Eun Choi and Il Joon Moon. Approval of final manuscript: All authors.
+
+| Ji Eun Choi   | https://orcid.org/0000-0001-8105-813X   |
+|---------------|-----------------------------------------|
+| Sung Hwa Hong | https://orcid.org/0000-0001-6906-8925   |
+| Il Joon Moon  | https://orcid.org/0000-0002-3613-0734   |
+
+## References
+
+1) Svirsky MA, Robbins AM, Kirk KI, Pisoni DB, Miyamoto RT. 
+
+Language development in profoundly deaf children with cochlear implants. Psychol Sci 2000;11:153-8.
+
+2) Richter B, Eissele S, Laszig R, Löhle E. Receptive and expressive language skills of 106 children with a minimum of 2 years' experience in hearing with a cochlear implant. Int J Pediatr Otorhinolaryngol 2002;64:111-25.
+
+3) Calmels MN, Saliba I, Wanna G, Cochard N, Fillaux J, Deguine O, et al. Speech perception and speech intelligibility in children after cochlear implantation. Int J Pediatr Otorhinolaryngol 2004;68:347-51.
+
+4) Connor CM, Craig HK, Raudenbush SW, Heavner K, Zwolan TA. 
+
+The age at which young deaf children receive cochlear implants and their vocabulary and speech-production growth: is there an added value for early implantation? Ear Hear 2006;27:628-44.
+
+5) Nicholas JG, Geers AE. Effects of early auditory experience on the spoken language of deaf children at 3 years of age. Ear Hear 2006; 27:286-98.
+
+6) Xie YH, Potměšil M, Peters B. Children who are deaf or hard of hearing in inclusive educational settings: a literature review on interactions with peers. J Deaf Stud Deaf Educ 2014;19:423-37.
+
+7) Francis HW, Koch ME, Wyatt JR, Niparko JK. Trends in education-al placement and cost-benefit considerations in children with cochlear implants. Arch Otolaryngol Head Neck Surg 1999;125:499-505.
+
+8) Punch R, Hyde M. Children with cochlear implants in Australia: educational settings, supports, and outcomes. J Deaf Stud Deaf Educ 2010;15:405-21. 
+
+9) Geers A, Brenner C. Background and educational characteristics of prelingually deaf children implanted by five years of age. Ear Hear 2003;24:2S-14S.
+
+10) Wu CM, Liu TC, Liao PJ, Chen CK, Chang BL, Lin BG. Academic achievements and classroom performance in Mandarin-speaking prelingually deafened school children with cochlear implants. Int J Pediatr Otorhinolaryngol 2013;77:1474-80. 
+
+11) Motasaddi-Zarandy M, Rezai H, Mahdavi-Arab M, Golestan B. The scholastic achievement of profoundly deaf children with cochlear implants compared to their normal peers. Arch Iran Med 2009;12: 441-7.
+
+12) Damen GW, van den Oever-Goltstein MH, Langereis MC, Chute PM, Mylanus EA. Classroom performance of children with cochlear implants in mainstream education. Ann Otol Rhinol Laryngol 
+2006;115:542-52.
+
+13) Mukari SZ, Ling LN, Ghani HA. Educational performance of pediatric cochlear implant recipients in mainstream classes. Int J Pediatr Otorhinolaryngol 2007;71:231-40. 
+
+14) Spencer LJ, Gantz BJ, Knutson JF. Outcomes and achievement of students who grew up with access to cochlear implants. Laryngoscope 2004;114:1576-81.
+
+15) Wauters LN, Knoors H. Social integration of deaf children in inclusive settings. J Deaf Stud Deaf Educ 2008;13:21-36. 16) Schorr EA. Early cochlear implant experience and emotional functioning during childhood: Loneliness in middle and late childhood. 
+
+Volta Review 2006;106:365-79.
+
+17) Punch R, Hyde M. Social participation of children and adolescents with cochlear implants: a qualitative analysis of parent, teacher, and child interviews. J Deaf Stud Deaf Educ 2011;16:474-93.
+
+18) Martin D, Bat-Chava Y, Lalwani A, Waltzman SB. Peer relationships of deaf children with cochlear implants: predictors of peer entry and peer interaction success. J Deaf Stud Deaf Educ 2011;16:10820. 
+
+19) Bat-Chava Y, Deignan E. Peer relationships of children with cochlear implants. J Deaf Stud Deaf Educ 2001;6:186-99.
+
+20) Carhart R, Jerger JF. Preferred method for clinical determination of pure-tone thresholds. J Speech Hear Disord 1959;24:330-45.
+
+21) Ling D. Speech development in hearing-impaired children. J Commun Disord 1978;11:119-24.
+
+22) Moon IJ, Kim EY, Chu H, Chung WH, Cho YS, Hong SH. A new measurement tool for speech development based on Ling's stages of speech acquisition in pediatric cochlear implant recipients. Int J Pediatr Otorhinolaryngol 2011;75:495-9.
+
+23) Percy-Smith L, Jensen JH, Cayé-Thomasen P, Thomsen J, Gudman M, Lopez AG. Factors that affect the social well-being of children with cochlear implants. Cochlear Implants Int 2008;9:199-214.
+
+24) van Gent T, Goedhart AW, Hindley PA, Treffers PD. Prevalence and correlates of psychopathology in a sample of deaf adolescents. J Child Psychol Psychiatry 2007;48:950-8.
+
+25) Castellanos I, Kronenberger WG, Beer J, Colson BG, Henning SC, 
+Ditmars A, et al. Concept formation skills in long-term cochlear implant users. J Deaf Stud Deaf Educ 2015;20:27-40. 

medical/md/PMC7306245.md

@@ -0,0 +1,382 @@
+
+
+![0_image_0.png](0_image_0.png)
+
+![0_image_1.png](0_image_1.png)
+
+![0_image_2.png](0_image_2.png)
+
+# Enhancement Of Dissolution Of Atorvastatin Through Preparation Of Polymeric Solid Dispersions Using Supercritical Fluid Technology
+
+Bashar Altaani*, Rana Obaidat, and Walaa Malkawi Department of Pharmaceutical Technology, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid 22110, Jordan.
+
+## Abstract
+
+Background and purpose: This study aimed at preparation of solid dispersions in order to enhance dissolution of poorly water-soluble atorvastatin using supercritical CO2 technology. Atorvastatin has poor bioavailability of 12%, mainly due to poor water solubility and dissolution. Dispersion of drugs in various hydrophilic carriers using supercritical fluid technology has been found to be an outstanding method to prepare solid dispersion. Experimental approach: Four different polymers were employed. These were polyvinyl pyrrolidone K30 
+(PVP), polyethylene glycol 6000 (PEG), Soluplus®, and chitosan. Full physicochemical characterizations were performed in addition to *in vitro* dissolution study. Findings / Results: The used polymers enhanced the dissolution rate of atorvastatin. However, supercritical parameters affected the dissolution profile and drug loading efficiency of the prepared dispersions. High performance liquid chromatography assay indicated the stability of the prepared PEG, Soluplus® and chitosan-based dispersions. On the other hand, PVP solid dispersions were not stable and formed sticky paste. Powder X-ray diffraction showed similar patterns for PEG-based dispersions after exposure to storage condition, while the intensity of atorvastatin peaks increased after three months of storage of Soluplus® and chitosan dispersions. Conclusion and implications: Supercritical fluid technology proved to have great potential to prepare dispersions for biopharmaceutics classification system (BCS) class II drugs. Dissolution enhancement of atorvastatin was achieved through successful preparation of polymeric dispersions of the drug using the supercritical technology without further addition of solvents. 
+
+Keywords: Atorvastatin; Solublity enhancement; Polyethylene glycol; Solid dispersions; Soluplus; Supercritical fluid technology. 
+
+## Introduction
+
+Surface tension and solvent strength, which vary between gas-like and liquid-like values, depend on the temperature and pressure conditions (1). Many gasses have been used as supercritical fluid (SCF), but CO2 has been considered the best gas as it is nontoxic, nonflammable, inexpensive, and readily available. Also, it has a mild critical temperature (Tc = 31 °C) and low critical pressure (Pc = 7.38 MPa). SCF offered many advantages in the pharmaceutical arena specially for heat sensitive materials, drying process, and preparation of carriers and solid dispersions (SDs) (2). 
+
+Dispersion of the active ingredient in an inert carrier matrix through SD is one of the most commonly used methods to enhance the dissolution and hence the bioavailability of poorly water-soluble drugs. Many traditional methods have been used to produce SDs including hot melt extrusion (3), fusion method (4), solvent-evaporation method (5), and spray drying (6). However, SCF technique proved its suitability for preparing SDs. This is attributed to the preparation of SD in a light and oxygen-free atmosphere (7). 
+
+Access this article online
+
+![0_image_3.png](0_image_3.png)
+
+Website: http://rps.mui.ac.ir
+
+| DOI: 10.4103/1735-5362.283812   |
+|---------------------------------|
+
+![0_image_4.png](0_image_4.png)
+
+SDs prepared by SCF technology showed good flow properties, small particle size, and absence of the residual organic solvent as opposed to conventional techniques (7). Obaidat *et al*. proved the significant enhancement of tacrolimus dissolution profile by preparing SDs using SCF method (8).
+
+Many polymers proved to be utilized in preparing SDs such as polyvinyl pyrrolidone 
+(PVP), polyethylene glycol (PEG), Soluplus®, 
+and chitosan. These polymers have several advantageous properties including water solubility, biocompatibility, and safety. PVP is a common carrier which is used for preparing SDs of poorly water soluble drugs to improve their solubility and dissolution rate and hence their bioavailability. Different methods, including SCF technique has been used to improve aqueous solubility of lipophilic drugs (9). PEG is a hydrophilic and hygroscopic polymer. It has excellent ability to enhance the solubility of hydrophobic drugs; In addition, PEG can improve the physical and chemical stability of drugs and prevents drugs aggregation (7). It is one of the most widely and commonly used polymers for preparing SDs. Another unusual polymer is Soluplus®. It is a synthetic novel polymer. It has been applied in the recent years and considered as one of the third generation solid dispersion polymer. It can function as a matrix polymer for solid solutions as it behaves as a solubilizer through micelle formation. It is water soluble, nonionic and slightly surface active. Soluplus®
+has good flowability and low hygroscopicity (10). Chitosan is derived from chitin by deacetylation of chitin in alkaline conditions or by enzymatic hydrolysis (11). Chitosan is a hydrophilic, cationic, polysaccharide polymer. It is of great interest due to its biocompatibility, biodegradability, bioactivity, nontoxic, and non-allergic (12). 
+
+Atorvastatin is a synthetic lipid loweringagent. It selectively and competitively inhibits the enzyme β-hydroxy β-methylbutyryl-CoA (HMG-CoA) reductase. It is commonly used as atorvastatin calcium salt. It exists as white to off-white crystalline powder. It is insoluble in aqueous solution below pH 4. It has a short half-life and needs 1-2 h to reach its maximum concentration (Tmax) in the plasma (13).
+
+Atorvastatin has a good intestinal permeability but low bioavailability; the bioavailability of 40 mg oral dose is only 12%. Its low bioavailability is due to its first pass hepatic metabolism, poor water solubility, and crystalline nature (14). Atorvastatin is administered in high doses to overcome its insufficient bioavailability. High doses of atorvastatin can lead to undesirable side effects such as liver abnormalities, rhabdomyolysis, arthralgia, and kidney failure (13). Many approaches were utilized to enhance the dissolution and bioavailability of atorvastatin. 
+
+This includes the formation of a dry emulsion containing atorvastatin using spray-drying method (15). Preparing of amorphous atorvastain is another approach. Amorphous atorvastatin was prepared using supercritical antisolvent by which the physichochemical properties and the bioavailability of atorvastatin were improved (16). In addition, prepartion of SDs by different techniques to enhance the dissolution of atorvastatin using several carriers like PVP (13), Soluplus®(15), 
+gum karaya (17), and PEG 6000 (18) were reported.
+
+The primary objective of this work was to employ SCF technology as a method to prepare SDs of atorvastatin without the use of any additional solvents in order to enhance the dissolution of the drug. The selected polymers were PVP, PEG, Soluplus®, and chitosan. The physicochemical properties of raw materials, physical mixtures, and prepared dispersions were studied. Also, *in vitro* drug release, drugloading efficiency, and stability study were conducted.
+
+## Materials And Methods
+
+Atorvastatin calcium was supplied by Biocon, India. Kollidon 30 (PVP K30) as supplied by Aldrich Chemicals, USA. PEG 6000 and sodium triphosphate (STPP) were supplied by Sigma-Aldrich, USA. Soluplus® 
+was kindly supplied by BASF Ludwigshafen, Germany. High molecular weight chitosan 600 kDa was provided by Shanghai Hanshare Industry CO., China. Potassium dihydrogen phosphate (KH2PO4), extra pure, was supplied by ScharlauChemie, Spain. Sodium hydroxide 
+(NaOH) and methanol were supplied by Fisher Scientific, UK. Potassium bromide (KBr) IR grade by Sigma-Aldrich, France. Ethanol was supplied by Solvochem, Holland. Hydrochloric acid (HCl, 37% w/w) was supplied by Biosolvo, France. Acetonitrile (purity 99.9%) was supplied by Anhuni Fulltime Specialized Solvents and Reagents Co., China. Acetic Acid was supplied by Xilong Chemical Industry Incorporated, China. Liquid CO2 (purity 99.9%) was supplied by Jordanian Gas Company, Amman, Jordan. 
+
+Distilled water was used for all experiments. All Chemicals were used without any modification.
+
+## Preparation Of Chitosan Carrier
+
+Chitosan oligomer (11 kDa) was prepared by allowing raw material chitosan (600 kDa) to react with 2 M HCl for 4 h, as described previously (19,20). The molecular weight of chitosan carrier oligomer was determined by viscosity analysis using a sine wave Vibro SV10/SV-100 viscometer (KSV Instrument Helsinki, Finland) (20). The obtained chitosan oligomer powders were stored in glass vials at room temperature.
+
+Chitosan carrier was prepared by reacting 100 mL of 1% low molecular weight chitosan solution with 100 mL of 0.5% STPP. STPP solution was added at high mixing speed (4000 rpm), and the mixing was continued for 30 min. Then, the mixture was dehydrated by immersion in a series of successive ethanol baths of increasing ethanol concentration (20, 40, 60, 80, and 100%, V/V in water). After that ethanol was dried using SCF apparatus (Eurotechnica, GmbH, Germany) at 1450 psi and 40 °C for 2 h (2).
+
+## Preparation Of Atorvastatin Solid Dispersions
+
+Atorvastatin was physically mixed with one of the polymers (PVP, PEG, Soluplus®, or chitosan carrier) to produce a mixture of the drug to polymer in ratio of 1:9. Then it was processed by SCF apparatus at different temperatures, pressures and loading times. Also, drug to polymer ratio for PEG-based SDs was changed (Table 1). The produced SDs were ground using a mortar and pestle and sieved through 300 μm sieve and then stored in an amber airtight container in the refrigerator.
+
+SDs
+
+Conditions
+
+Drug: polymer
+
+%Average drug 
+
+Pressure content ± SD (w/w)
+
+(psi)
+
+Temperature (ºC)
+
+Time
+
+(h) **Polymers**
+
+SD1 1450 40 2 PVP 1: 9 67.83 ± 1.88
+
+SD2 1450 60 2 PVP 1: 9 79.73 ± 0.99 SD3 1450 80 2 PVP 1: 9 88.68 ± 0.36 SD4 1450 80 4 PVP 1: 9 81.98 ± 2.95 SD5 1450 80 6 PVP 1: 9 87.45 ± 6.69 SD6 1450 40 2 PEG 1: 9 79.23 ± 1.27 SD7 1450 50 2 PEG 1: 9 80.65 ± 1.63 SD8 1450 60 2 PEG 1: 9 104.8 ± 15.6 SD9 1450 50 2 PEG 2: 8 66.22 ± 7.16 SD10 1450 50 2 PEG 3: 7 90.17 ± 9.69 SD11 1450 40 2 Soluplus 1: 9 80.47 ± 0.41 SD12 1810 40 2 Soluplus 1: 9 83.80 ± 0.94 SD13 2170 40 2 Soluplus 1: 9 79.90 ± 0.31 SD14 1450 40 2 Chitosan 1: 9 94.67 ± 3.45 SD15 1450 60 2 Chitosan 1: 9 94.79 ± 6.53 SD16 1450 80 2 Chitosan 1: 9 97.33 ± 4.77 SD17 1810 80 2 Chitosan 1: 9 106.7 ± 11.2 SD18 2170 80 2 Chitosan 1: 9 102.5 ± 5.31
+
+## Preparation Of Physical Mixture
+
+Physical mixtures (PMs) were prepared by mixing atorvastatin physically with the polymers using a mortar and pestle to produce a PM in a ratio of 1:9. The PMs were sieved through 300 μm sieve then stored in an amber airtight container in the refrigerator. 
+
+## Physicochemical Characterization Differential Scanning Calorimetry
+
+Differential scanning calorimetry (DSC) 
+measurements were carried out for atorvastatin, the used polymers, the prepared SDs, and their corresponding physical mixtures using DSC 204 (Netzch, Germany). Indium was used to calibrate temperature and energy scale. An accurately weighed sample was placed in a sealed aluminum pan (P/N 201-52943). Then, it was heated in the range 30-200 °C under constant nitrogen flow of 30 mL/min. An empty sealed aluminum pan was used as a reference. Sample crimper was used to seal the pans. 
+
+## Powder X-Ray Diffraction
+
+Powder X-Ray diffraction (PXRD) pattern of atorvastatin, the used polymers, the prepared SDs and their corresponding physical mixtures were acquired using Ultima IV X-ray diffractometer (Rigaku, Japan) equipped with cobalt radiator at voltage of 40 KV and a current of 30 mA. The angle (2 Ө) scanning range of the samples was between 0o and 60o at step of 0.02o. 
+
+Scanning electron microscopy Scanning electron microscopy (SEM) 
+images were obtained using Quanta FEG 450, SEM (FEI, US), to study the surface morphology of atorvastatin, raw polymers, SDs, and their corresponding PMs. Before SEM analysis, the samples were placed on stubs and coated with platinum under vacuum atmosphere using Q150R rotary-pumped sputter coater/ carbon coater (Quorum Technologies, UK).
+
+## Determination Of Drug Content Drug Content Was Determined By Dissolving
+
+an amount equivalent to 1 mg atorvastatin from each formula in 50 mL methanol and then stirred for 30 min. The total amount of the drug was measured using UV-1800 spectrophotometer (Shimadzu, Japan) at λmax 246 nm. Drug content was calculated using the following equation: 
+  = 
+  
+ℎ   × 100
+
+## In Vitro Drug Release Study
+
+Drug release was performed for the prepared SDs and their corresponding PMs, using dissolution test apparatus II (rotating paddle) at 37 ± 0.5 °C. The rotational speed were set at 75 rpm. The dissolution media was 900 mL of freshly prepared phosphate buffer solution (0.05 M) with pH 6.8. This media is recommended by Food and Drug Administration. A sample equivalent to 40 mg of atorvastatin from the prepared SDs and PMs were accurately weighed and filled manually into a gelatin capsule (size 0) and placed in the dissolution test. The samples were withdrawn at predetermined time intervals over 2 h. The withdrawn samples were filtered through a filter unit (pore size 0.45 μm, nylon filter membrane, Bonna-Agela Technologies). Each withdrawn volume was replaced by an equal volume of fresh dissolution media to maintain the volume and sink condition. The samples were diluted appropriately and assayed for atorvastatin by UV-VIS spectroscopy at λmax of 241 nm. 
+
+## Mathematical Modeling Of Release Kinetics
+
+The *in vitro* drug release data were fitted to several release kinetic models including zero order, Higuchi and Korsmeyer-Peppas equations. The regression coefficient was calculated to determine the best-fitted model and the release mechanism 
+
+## Stability Study
+
+Selected samples were subjected to specific stability studies conditions. Selection was based on samples showing the best dissolution profile. The samples were stored at two different conditions 30 ± 2 °C, 75 ± 5% relative humidity and 40 ± 2 °C and 75 ± 5% 
+relative humidity for three months. The stability of the selected SDs was tested chemically and physically. Chemical stability was evaluated by determining the concentration of dug using highperformance liquid chromatography (HPLC) to detect any possible degradation. Other stability tests included drug loading efficiency and PXRD pattern. 
+
+## Hplc Method
+
+Chemical stability and detection of any degradation were studied by performing a validated HPLC method for inter- and intraday variation (21). The retention time of atorvastatin and formulations were detected by HPLC apparatus, model LC-10AD VP with UV-VIS detector model SPD-10A VP and auto sampler model SIL-20A, Shimadzu, Japan. Methanol was used as the solvent to dissolve atorvastatin and the SDs. The chromatographic column was ACE C18 (250×4.6 mm, 5 μm). The mobile phase was acetic acid solution (0.05%):acetonitrile 
+(35:65). A UV detector was set at 246 nm. The flow rate was 1 mL/min and the injection volume 20 μL. The experiment was done at ambient temperature.
+
+## Statistical Analysis
+
+![4_Image_0.Png](4_Image_0.Png)
+
+All measurements were carried out repeatedly and the results were expressed as the mean ± standard deviation (SD). The data from the different groups were statistically analyzed using a paired t-test. P values less than 0.05 were considered statistically significant. Microsoft Office Excel application was used for the calculations.
+
+## Results Physicochemical Characterization Differential Scanning Calorimetry
+
+DSC thermogram (Fig. 1) shows a sharp endothermic peak of atorvastatin at 157.7 °C. DSC thermograms of all polymers matched well with published literature with broad peak existing at 30-150 °C for PVP (13). On the other hand, a sharp peak indicating crystalline nature was shown for PEG at 65 °C (13). A 
+broad endothermic hump related to glass transition (Tg) temperature for Soluplus® was detected at 72.2 ºC (22). A broad endothermic peak from 40-130 ºC has been detected for chitosan (11). The characteristic DSC thermograms of atorvastatin were not seen in all the prepared PMs and SDs. This indicates that thermal analysis could not provide sufficient data about physical state of the drug inside PMs and SDs. A clear shift of Tg of Soluplus® from 72.2 to 93 °C occurred in the prepared SD.
+
+![5_image_0.png](5_image_0.png)
+
+Powder X-ray diffraction PXRD of atorvastatin (Fig. 2) showed presence of sharp peaks at 2Ө equals to 6.10, 9.11, 9.42, 10.22, 10.50, 11.80, 12.13, 16.93, 18.79, 19.40, 21.54, 22.65, 23.25, 23.65, and 24.33 degrees. PXRDs of pure polymers matched well with published literature, without the appearance of any sharp peak for PVP with PXRD showing only two broad peaks in the range of 5-15, and 15-25 degrees (13). PXRD of PEG shows two characteristic peaks at 2Ө equal to 19.12, and 23.3 degrees. 
+
+Also, PXRD diffractogram of Soluplus® 
+indicates the absence of any characteristic peaks. Moreover, chitosan carrier shows a sharp characteristic peak at 2Ө equals to 15 degrees with two peaks at 2Ө equals to 10 and 20 degrees (23). These peaks were maintained in the prepared PM and SD. Fourier transform infra-red spectroscopy Fourier transform infra-red spectroscopy 
+(FTIR) spectroscopy (Fig. 3) of atorvastatin shows, the absorbance peak at 3665 cm-1 indicating free O-H stretching. The peaks at 3364 and 1649 cm-1 indicate the stretching vibrations of N-H and C=C bond of the aromatic ring, respectively. The absorbance peak at 1105 cm-1 indicated O-H bending, and at 746 and 690 cm-1 indicated C-F stretching 
+(24). FTIR spectrum for pure polymers also matched with previous reported data. For PVP, FTIR spectrum shows a broad peak from 3200 to 3700 cm-1 which were related to the presence of water in the polymer, this confirmed the result of DSC thermogram. 
+
+Another two important peaks at 2953 and 1676 cm-1 were related to C-H stretching and C=O, 
+respectively (13). Also for PEG, its spectrum shows important peaks at 3441, 2893, and 2099 cm-1 which were related to O-H, C-H, 
+and C-O-C stretches, respectively (25). As well FTIR spectrum of Soluplus® shows aliphatic C-H stretching at 2924 cm-1 and C=O 
+stretching at 1732 and 1634 cm-1, the spectrum has been confirmed by comparing it to the previously studied spectrum (15). For chitosan carrier, FTIR spectroscopy illustrated a peak in the area between 1593 and 1643 cm-1 represented NH2 scissoring vibration, the region between 1600 and 1400 cm-1 represented N-H bending vibration and the region between 1000 and 1150 cm-1 represented vibration of C-O-C, C-OH, and CC in the ring. The presence of theses peaks indicated depolymerization of chitosan (20). 
+
+The peaks of atorvastatin were observed in the prepared PMs and SDs of PVP and PEG, 
+while disappeared for chitosan and Soluplus®
+based SDs as well as for chitosan PM. Scanning electron microscopy 
+
+![6_image_0.png](6_image_0.png)
+
+SEM morphology study for atorvastatin prepared using different carriers by SCF process shown in Fig. 4 in comparison with their corresponding PMs. Atorvastatin appeared as rod-shaped crystals with smooth surfaces and partially agglomerated in bundles. In PMs, PVP K30 appeared as spherical balls, PEG 6000 appeared as bulky crystalline particles with a smooth surface, while, Soluplus® appeared as regular shapes with smooth surfaces, and chitosan carrier showed that the particles are less uniform in size. In all the prepared PMs and SDs, the particles of the drug were observed. It was noticed the change of Soluplus® and chitosan surfaces after exposing to SCF CO2. 
+
+![6_image_1.png](6_image_1.png)
+
+## Determination Of Drug Content
+
+The overall drug content (Table 1) 
+exceeded 66.22% reaching values more than 100% in some preparations. Chitosan carrier based SDs showed the highest content of drug. It can be seen that PVP K30 and PEG 6000 based SDs showed an increase in drug content with increasing SCF processing temperature. Also, results showed that when processing time was 4 h for PVP K30-based SDs, drug content was lower than when processing time was 2 and 6 h. Also, drug content did not depend on SCF processing pressure for Soluplus® and chitosan based SDs. 
+
+## In Vitro Release Study 
+
+![7_Image_0.Png](7_Image_0.Png)
+
+The dissolution profiles of atorvastatin, the prepared PMs, and SDs are shown in Fig. 5. The prepared PMs enhanced the dissolution profile of atorvastatin, except for the PM 
+prepared using Soluplus®. PVP K30 revealed a slower dissolution rate. For all the dissolution profiles, the maximum reported error bar was ±14. The results of the mechanism of atorvastatin release are summarized in Table 2. 
+
+Dissolution profiles of the prepared SDs were best fitted to Korsmeyer and Peppas except for SD5 which was best fitted to Higuchi equation. 
+
+## Effect Of Pressure, Temperature, Loading Time, And Polymer To Drug Ratio On Drug Release
+
+The effect of SCF processing parameters and the effect of polymer to drug ratio over drug release were evaluated (Fig. 5). Soluplus®
+and chitosan dispersions were used to study the effect of operational pressure while PEG 6000 and chitosan dispersions were used to study the effect of operational temperature. Also, the effect of polymer to drug ratio was evaluated for PEG 6000 SDs. 
+
+The drug release was affected by changing the pressure operator for Soluplus®, and chitosan dispersions; it was found that the drug release enhanced by decreasing the operational pressure. Also, the drug release was affected by changing the operational temperature for PEG 6000 chitosan-based SDs. The drug release enhanced by decreasing the operational temperature. 
+
+![8_image_0.png](8_image_0.png)
+
+## Stability
+
+Chemical and physical stability was studied for selected SDs (SD3, SD7, SD11, and SD14). HPLC assay (Fig. 6), the drug content (Table 3), and PXRD (Fig. 7) were evaluated for PEG, Soluplus®, and chitosan based SDs. 
+
+For HPLC assay, the results showed the presence of a single peak which was related to atorvastatin. 
+
+Moreover, the results of drug content indicated that there was no significant difference after three months (P ≤ 0.05), except for PEG-based SD *i.e.* SD7 when it was stored at 40 ± 2 °C and 75 ± 5% relative humidity. Also, the PXRD pattern of PEGbased SD did not change after three months of storing. However, the PXRD of Soluplus® and chitosan based SDs, SD11 and SD14, respectively, exhibited an increase in the intensity of some peaks related to atorvastatin. On the other hand, a sticky paste has been formed by SD3 which indicates the instability of SD prepared using PVPK30. 
+
+Due to the formed sticky paste, samples could not be obtained for HPLC and PXRD analysis. 
+
+![9_image_0.png](9_image_0.png)
+
+| Table 3. Loading efficiency (LE) of SD7, SD11, and SD14 at day 0 and 90. Data are presented as mean ± SD; n =  3. 40 ± 2 °C and 75 ± 5% RH P values LE ± SD, Day 90 P values LE ± SD, Day 90  30 ± 2 °C and 75 ± 5% RH SDs LE ± SD, Day 0 SD7 82.88 ± 3.34 90.33 ± 7.82 0.32 55.22 ± 4.65 < 0.05 SD11 77.79 ± 3.38 85.65 ± 5.43 0.22 83.26 ± 12.95 0.62 SD14 97.33 ± 4.77 109.52 ± 10.73 0.23 112.24 ± 6.59 0.12   |
+|--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+
+## Discussion
+
+The sharp endothermic peak of atorvastatin, which was obtained by DSC thermogram, was attributed to the melting point indicating the crystalline nature of the drug (26). Also, PXRD confirmed the presence of polymorph I. The results of DSC and PXRD indicated amorphous nature of PVP K30 (27). On the other hand, the crystalline nature of PEG 6000 was confirmed by the presence of a melting point in DSC thermogram and two characteristic peaks in PXRD. The absence of any characteristic peaks in the diffractogram pattern of Soluplus® indicated the amorphous nature of the polymer demonstrated by DSC thermogram too. Moreover, the PXRD of chitosan carrier indicated the formation of annealed polymorph (2). The disappearance of atorvastatin peak in PEG 6000-based SDs and PMs was due to the complete miscibility between the drug and the melted polymer which occurred during the heating cycle at 10 °C/min. Patil *et al*. has reported the same behavior for Gliclazide- PEG 6000 SD (25). Although DSC analysis of PEG 6000-based SDs and PMs showed complete miscibility. PXRD indicated the presence of crystalline material of atorvastatin (25). This emphasizes that thermal analysis alone is not enough to characterize polymers especially those with low melting point. While the shift in Tg of Soluplus® was related to dissolving of the drug in the polymer; Tg does not exhibit a shift in its value unless the two components are in one phase. It has been reported that Tg of a polymer is affected by the dissolved polymer and can be explained by the intermolecular interactions where a low molecular weight compound is dissolved in the polymer, modified its intermolecular interactions and replaced them with new secondary bonds, therefore the mobility of the system is altered and leads to increase or decrease in the polymer`s Tg (28). FTIR spectrum results for dispersions prepared using PVP K30, PEG 6000, and chitosan indicated the absence of any chemical interaction between the drug and the polymers (13). While FTIR spectrum for Soluplus®-based SDs showed the interaction between the drug and the polymer; demonstrated by decrease peak intensity of NH stretching bond at 3364 cm-1 such result has been reported previously (25). The weakening or disappearing of N-H stretching bond was due to the interaction of atorvastatin with Soluplus®. N-H of atorvastatin can form Hbond with C=O group of amide group of Soluplus®. SEM morphology indicated the presence of the drug in its crystalline nature, as it has been previously proved by PXRD. After exposing of Soluplus® to supercritical CO2, its surface has been foamed and bubbles have been formed. Similar behavior reported for poly (methyl methacrylate) after it was exposed to supercritical CO2 (29). Foaming can be related to the solubility of CO2 in Soluplus® that is illustrated from the presence of characteristic FTIR peak at 1600 cm-1 indicating the presence of CO2 inside the polymer. However, the foaming behavior of Soluplus®decreased by the presence of the drug, hence further future studies for Soluplus® should be performed. 
+
+Loading efficiency was good (≥ 66.22%) in prepared SDs. Exceeding 100% in loading efficiency can be attributed to polymer loss during the preparation process. Also, the increase in the loading efficiency with increasing of processing temperature for PVP K30 and PEG 6000 dispersions is in agreement with what was previously reported (8). 
+
+The results of HPLC indicated the chemical stability of SDs after exposing to the storage conditions for three months except for PVP-based SDs that showed sticky paste. PVP usually suffers from such long-term instabilities especially in high relative humidity conditions 
+(30). Reported changes in both Soluplus® and chitosan is related to solubilization of CO2 inside in a supercritical state (29). This can lead to changes upon storage. 
+
+Although the results of this study proved the ability of solvent-free SCF in dispersing the drug inside the polymer, yet precipitation of atorvastatin in these polymers was as a crystalline form unlike with tacrolimus SDs that were reported by Obaidat *et al*. (31). This illustrates the importance of studying physicochemical characteristics of the drug as well as the used polymer in SCF. Solubilization of the drug is very critical in precipitation of the drug in the amorphous form. Solubilization of the drug is supposed to occur in supercritical CO2, or inside the polymeric material in the supercritical state with precipitation during depressurization. Utilizing solvent-free CO2 is not enough to disperse all types of drugs in the amorphous form, and utilizing additional cosolvent would be necessary. 
+
+The enhancement of dissolution profile by PMs prepared using PVP K30, PEG 6000, and chitosan can be attributed to bringing the drug in close contact with hydrophilic polymers, which increased the wettability of the drug. However, the reduction of the dissolution profile for PMs prepared using Soluplus® may be related to gel formation and sticky nature of Soluplus® when it contacted with water. All the carriers showed an increase in the dissolution profile of atorvastatin; because of the hydrophilic properties and the solubilization power of the polymers (13). PVP K30 revealed a slower dissolution rate compared to other polymers which can be related to the formation of a gel layer by the hydrated polymer which led to slow diffusion of the drug from the polymer (32). 
+
+Higuchi equation describes the release of drugs from the insoluble matrix as a square root of time (33). Korsmeyer-Peppas equation is a semi-empirical model that correlates drug release with time by a simple exponential equation for a fraction of drug released. When n ≤ 0.43 indicates Fickian release which means that release is diffusionally controlled. Intermediate values 0.43 <n < 0.85 indicate a non-Fickian kinetics, anomalous or nontypical behavior, which means that the release is controlled by both diffusion and polymer relaxation. Values of n > 0.85 indicate a super case kinetic II transport which is transport or relaxation controlled release. This model is useful when there is more than one mechanism of the release or when the drug release mechanism is unknown (34).
+
+All atorvastatin-PVP dispersions have n values above 0.85, which indicates super case kinetic II transport. Therefore the mechanism of drug release could be a polymer relaxation, the initial slow release of the drug from PVP-based SDs is attributed to incomplete hydration of the polymer which led to incomplete relaxation. SD5 best fitted to Higuchi model, this mechanism was reported for PVP before (35). Atorvastatin-PEG 6000 dispersions had n < 0.43 that indicate Fikian diffusional characteristics. 
+
+Atorvastatin-Soluplus® dispersions showed Fickian release for all the formulations, except for SD13 where the mechanism has been shifted to non-Fickian release. Soluplus®-based SDs have reported both mechanisms (36). 
+
+Atorvastatin-chitosan dispersions release data fitting in Korsmeyer-Peppas model showed that n value was less than 0.43 (range: 0.199 - 0.365) which indicate Fickian diffusionally controlled release. This result is in agreement with what previously reported by Zou *et al* (37). They studied the release of bovin serum albumin from chitosan microspheres and they have found that the release behavior is Fickian diffusion suggesting drug diffusion through the swelled polymer spheres. The drug release was influenced by changing the operational pressure for Soluplus® and chitosan solid dispersions. It was generally found that decreasing the operational pressure facilitate drug release. This finding is a result of enhancing the partitioning between the drug and the polymer. Operational pressure also affects the transport properties of SCF CO2. 
+
+The viscosity of SCF CO2 decreases along with diffusivity improvement with decreasing operational pressure. Therefore, the transport properties and plasticization are enhanced by decreasing operational pressure and the partitioning between the drug and the polymers enhances too (8). Also, the drug release was affected by changing the operator temperature for PEG 6000 and chitosan dispersions. The release of drug enhanced by decreasing the operational temperature. Finally, ratio between the used polymer to the drug is not the only factor that affects drug release. Operational condition has a profound effect on drug performance.
+
+## Conclusion
+
+SCF technology proved to have great potential in preparing dispersions for BCS 
+class II drugs. A good loading efficiency was obtained for all the polymers. Dissolution enhancement of atorvastatin was achieved through successful preparation of polymeric dispersions of the drug using SCF technology without further addition of solvents. Great enhancement of dissolution profile was obtained using Soluplus® and PEG solid dispersions showing high rate and percentage of release for the drug. The possibility of hydrogen bonding between the drug and Soluplus® was proved using FTIR. 
+
+## Acknowledgements
+
+This work was financially support by the Deanship of Research at Jordan University of Science and Technology (JUST) under the Grant No. 206/2015. The authors would like to acknowledge Scientific Research Funds (SRF) at Ministry of Higher Education (Amman, Jordan) for providing our lab with SCF unit (MPH/2/15/2013). 
+
+## Conflict Of Interest Statement
+
+The authors declare that they have no conflict of interest for this study.
+
+## Authors' Contribution
+
+B. Altaani, R. Obaidat, and W. Malkawi proposed the experiments and research design. W. Malkawi performed the experiments with supervision of R. Obaidat and B. Altaani . R. Obaidat analyzed the results of solid-state characterizations with contribution of other authors. B. Altaani analyzed the results of in vitro drug release and drug assay with contribution of others authors. B. Altaani wrote the manuscript for publication with help of other authors. 
+
+## References
+
+1. Badens E, Majerik V, Horvath G, Szokonya L, Bosc N, Teillaud E, *et al*. Comparison of solid dispersions produced by supercritical antisolvent and sprayfreezing technologies. Int J Pharm. 2009;377(12):25-34. DOI: 10.1016/j.ijpharm.2009.04.047.
+
+2. Obaidat RM, Tashtoush BM, Bayan MF, Al Bustami RT, Alnaief M. Drying using supercritical
+fluid technology as a potential method for preparation of chitosan aerogel microparticles. 
+
+AAPS PharmSciTech. 2015;16(6):1235-1244. 
+
+DOI: 10.1208/s12249-015-0312-2.
+
+3. Maniruzzaman M, Boateng JS, Snowden MJ,
+Douroumis D. A Review of hot-melt extrusion:
+process technology to pharmaceutical products. ISRN Pharm. 2012;2012:436763-436771. DOI: 10.5402/2012/436763.
+
+4. *Kamalakkannan V, Puratchikody A, Ramanathan L.*
+Development and characterization of controlled release polar lipid microparticles of candesartan cilexetil by solid dispersion. Res Pharm Sci. 2013;8(2):125-136.
+
+5. Sharma A, Jain CP. Preparation and characterization of solid dispersions of carvedilol with PVP K30. Res Pharm Sci. 2010;5(1):49-56.
+
+6. Dixit M, Kini AG, Kulkarni PK. Preparation and characterization of microparticles of piroxicam by spray drying and spray chilling methods. Res Pharm Sci. 2010;5(2):89-97.
+
+7. Tabbakhian M, Hasanzadeh F, Tavakoli N,
+Jamshidian Z. Dissolution enhancement of glibenclamide by solid dispersion: solvent evaporation versus a supercritical fluid-based solvent - antisolvent technique. Res Pharm Sci. 2014;9(5):337-350.
+
+8. Obaidat RM, Tashtoush BM, Awad AA, Al Bustami RT. Using supercritical fluid technology (SFT) in preparation of tacrolimus solid dispersions. AAPS
+PharmSciTech. 2017;18(2):481-493. DOI: 10.1208/s12249-016-0492-4.
+
+9. Vo CL, Park C, Lee BJ. Current trends and future perspectives of solid dispersions containing poorly water-soluble drugs. Eur J Pharm Biopharm.
+
+2013;85(3 Pt B):799-813. DOI: 10.1016/j.ejpb.2013.09.007.
+
+10. Shamma RN, Basha M. Soluplus®: a novel polymeric solubilizer for optimization of carvedilol solid dispersions: formulation design and effect of method of preparation. Powder Technol.
+
+2013;237:406-414. DOI: 10.1016/j.powtec.2012.12.038.
+
+11. Maestrelli F, Zerrouk N, Chemtob C, Mura P.
+
+Influence of chitosan and its glutamate and hydrochloride salts on naproxen dissolution rate and permeation across Caco-2 cells. Int J Pharm.
+
+2004;271(1-2):257-267. DOI: 10.1016/j.ijpharm.2003.11.024.
+
+12. Zhong L, Zhu X, Luo X, Su W. Dissolution properties and physical characterization of telmisartan-chitosan solid dispersions prepared by mechanochemical activation. AAPS PharmSciTech. 2013;14(2):541-550. DOI: 10.1208/s12249-0139937-1.
+
+13. Hu L, Gu D, Hu Q, Shi Y, Gao N. Investigation of solid dispersion of atorvastatin calcium in polyethylene glycol 6000 and polyvinylpyrrolidone.
+
+Trop J Pharm Res. 2014;13(6):835-842. DOI: 10.4314/tjpr.v13i6.2.
+
+14. Yin YM, Cui FD, Kim JS, Choi MK, Choi BC,
+Chung SJ, *et al*. Preparation, characterization and in vitro intestinal absorption of a dry emulsion formulation containing atorvastatin calcium. Drug Deliv. 2009;16(1):30-36. DOI: 10.1080/10717540802481380.
+
+15. Ha ES, Baek IH, Cho W, Hwang SJ, Kim MS.
+
+Preparation and evaluation of solid dispersion of atorvastatin calcium with soluplus(R) by spray drying technique. Chem Pharm Bull (Tokyo). 2014;62(6):545-551. DOI: 10.1248/cpb.c14-00030.
+
+16. Kim JS, Kim MS, Park HJ, Jin SJ, Lee S, Hwang SJ.
+
+Physicochemical properties and oral bioavailability of amorphous atorvastatin hemi-calcium using spray-drying and SAS process. Int J Pharm. 2008;359(1-2):211-219. DOI: 10.1016/j.ijpharm. 2008.04.006.
+
+17. Aggarwal S, Gupta GD, Chaudhary S. Solubility and dissolution enhancement of poorly aqueous soluble drug atorvastatin calcium using modified gum karaya as carrier: *in vitro-in vivo* evaluation. Int J Drug Deliv. 2012;4(3):341-365.
+
+DOI: 10.5138/ijdd.v4i3.75.
+
+18. Lakshmi Narasaiah L, Kalyan Reddy K, Kishore K,
+Raj Kumar R, Srinivasa Rao S, Venkateswara Reddy V. Enhanced dissolution rate of atorvastatin calcium using solid dispersion with PEG 6000 by dropping method. J Pharm Sci & Res. 2010;2(8):484-491.
+
+19. Qandil AM, Obaidat AA, Mohammed Ali MA, AlTaani BM, Tashtoush BM, Al-Jbour ND, *et al*.
+
+Investigation of the interactions in complexes of low molecular weight chitosan with ibuprofen. J Solution Chem. 2009;38(6):695-712.
+
+DOI: 10.1007/s10953-009-9405-4.
+
+20. Obaidat R, Al-Jbour N, Al-Sou'd K, Sweidan K, AlRemawi M, Badwan A. Some physico-chemical properties of low molecular weight chitosans and their relationship to conformation in aqueous solution. J Solution Chem. 2010;39(4):575-588.
+
+DOI: 10.1007/s10953-010-9517-x.
+
+21. Shen H, Zhong M. Preparation and evaluation of self-microemulsifying drug delivery systems (SMEDDS) containing atorvastatin. J Pharm Pharmacol. 2006;58(9):1183-1191. DOI: 10.1211/ jpp.58.9.0004.
+
+22. Lee JY, Kang WS, Piao J, Yoon IS, Kim DD, Cho HJ. Soluplus(R)/TPGS-based solid dispersions prepared by hot-melt extrusion equipped with twinscrew systems for enhancing oral bioavailability of valsartan. Drug Des Devel Ther. 2015;9:2745-2756.
+
+DOI: 10.2147/DDDT.S84070.
+
+23. Ioelovich M. Crystallinity and hydrophility of chitin and chitosan. Res Rev: J Chem. 2014;3(3):7-14.
+
+24. Lv HX, Zhang ZH, Jiang H, Waddad AY, Zhou JP.
+
+Preparation, physicochemical characteristics and bioavailability studies of an atorvastatin hydroxypropyl-beta-cyclodextrin complex. Pharmazie. 2012;67(1):46-53.
+
+DOI: 10.1691/ph.2012.1082.
+
+25. Patil MP, Gaikwad NJ. Characterization of gliclazide-polyethylene glycol solid dispersion and its effect on dissolution. Braz J Pharm Sci.
+
+2011;47(1):161-166.
+
+DOI: 10.1590/S1984-82502011000100020.
+
+26. Bathool A, Vishakante GD, Khan MS, Shivakumar HG. Development and characterization of atorvastatin calcium loaded chitosan nanoparticles for sustain drug delivery. Adv Mat Lett. 2012;3(6):466-470.
+
+DOI: 10.5185/amlett.2012.icnano.153.
+
+27. Abd El-kader M, Abu-Abdeen M. Thermal and mechanical studies of PVP/2-HEC blend films. Aust J Basic & Appl Sci. 2012;6(13):454-462.
+
+28. Terife G, Wang P, Faridi N, Gogos CG. Hot melt mixing and foaming of soluplus® and indomethacin. Polym Eng Sci. 2012;52(8):1629-1639.
+
+DOI: 10.1002/pen.23106.
+
+29. Rende D, Schadler LS, Ozisik R. Controlling foam morphology of poly(methyl methacrylate) via surface chemistry and concentration of silica nanoparticles and supercritical carbon dioxide process parameters. J Chem. 2013;2013:864926,113.
+
+DOI: 10.1155/2013/864926.
+
+30. Caron V, Hu Y, Tajber L, Erxleben A, Corrigan O,
+McArdle P, *et al*. Amorphous solid dispersions of sulfonamide/soluplus® and sulfonamide/PVP srepared by ball milling. AAPS PharmSciTech. 2013;14(1):464-474.
+
+DOI: 10.1208/s12249-013-9931-7.
+
+31. Obaidat RM, Tashtoush BM, Awad AA, Al Bustami RT. Using supercritical fluid technology (SFT) in preparation of tacrolimus solid dispersions. AAPS PharmSciTech. 2017;18(2):481-493. 
+
+DOI: 10.1208/s12249-016-0492-4.
+
+32. Roohullah, Iqbal Z, Nasir F, Akhlaq M, Sadozai SK,
+Zada A, *et al*. Sustained release carbamezapine matrix tablets prepared by solvent-evaporation technique using different polymers. Middle East J Sci Res. 2013;15(10):1368-1374. DOI: 10.5829/idosi.mejsr.2013.15.10.7553.
+
+33. Shoaib MH, Tazeen J, Merchant HA, Yousuf RI.
+
+Evaluation of drug release kinetics from ibuprofen matrix tablets using HPMC. Pak J Pharm Sci. 2006;19(2):119-124.
+
+34. Parize A, Stulzer H, Laranjeira M, Brighente I,
+Souza T. Evaluation of chitosan microparticles containing curcumin and crosslinked with sodium tripolyphosphate produced by spray drying. Quim Nova. 2012;35(6):1127-1132.
+
+DOI: 10.1590/S0100-40422012000600011.
+
+35. Shah I, Bhatt S, Yadav A. Enhancement of solubility and dissolution of nebivolol by solid dispersion technique. Int J Pharm Pharm Sci. 2014;6(7):566-571.
+
+36. Sambath L, Muthu AK, Kumar MA. Soluplus complexation influence the release of lovastatin from porous osmotic pump tablet. World J Pharm Pharm Sci. 2013;2(5):3506-3521.
+
+37. Zou X, Zhao X, Ye L, Wang Q, Li H. Preparation and drug release behavior of pH-responsive bovine serum albumin-loaded chitosan microspheres. J Ind Eng Chem. 2015;21:1389-1397. DOI: 10.1016/j.jiec. 2014.06.012.

medical/md/PMC7540570.md

@@ -0,0 +1,318 @@
+
+## Hepatology Nonalcoholic Fatty Liver Disease Burden: Australia, 2019–2030
+
+Leon A Adams,* Stuart K Roberts,† Simone I Strasser,‡ Suzanne E Mahady,§,¶ Elizabeth Powell,** Chris Estes,†† Homie Razavi†† and Jacob George‡‡
+*Medical School, The University of Western Australia, Perth, Western Australia, †Department of Gastroenterology, The Alfred, §School of Public Health and Preventive Medicine, Monash University, ¶Department of Gastroenterology, Royal Melbourne Hospital, Melbourne, Victoria, ‡AW Morrow Gastroenterology and Liver Centre, Royal Prince Alfred Hospital, ‡‡School of Medicine, University of Sydney, Sydney, New South Wales, **Department of Gastroenterology and Hepatology, Princess Alexandra Hospital, Brisbane, Queensland, Australia; and ††Center for Disease Analysis, Lafayette, Colorado, USA Key words Fatty liver, Hepatocellular carcinoma, Liver cirrhosis, Liver neoplasms, Metabolic syndrome, Nonalcoholic fatty liver disease. Accepted for publication 2 February 2020. Correspondence Chris Estes, Center for Disease Analysis, Lafayette, CO, USA. Email: cestes@cdafound.org Declaration of conflict of interest: Funding for this project was provided by Gilead Sciences. The funders had no role in the study design, data collection, analysis, interpretation of the data, or preparation of the manuscript.
+
+Author contribution: H. R. and C. E. conceived and designed the analysis. L. A. A., S. K. R., S. I. S., S. E. M., E. P., C. E., H. R., and J. G. contributed the data and provided data analysis and interpretation. L. A. A., S. K. R., S. I. S., S. E. M., E. P., C. E., H. R., and J. G. provided critical revision of the work.
+
+## Abstract
+
+Background and Aim: Nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) account for a large and growing proportion of liver disease burden globally. The burden of NAFLD/NASH manifests in increasing levels of advanced liver disease and primary liver cancer in Australia. A Markov model was used to forecast NAFLD burden in Australia through 2030.
+
+Methods: A model was used to estimate fibrosis progression, primary liver cancer, and liver deaths among the Australian NAFLD population, with changes in incident NAFLD
+cases based on long-term trends for changes in the prevalence of obesity. Published estimates and surveillance data were applied to build and validate the model projections, including surveillance data for the incidence of liver cancer.
+
+Results: Prevalent NAFLD cases were projected to increase 25% from the current burden
+(5 551 000 [4 748 000–6 306 000] cases in 2019) to 7 024 000 [5 838 000–7 886 000]
+cases in 2030. The projected increase in the number of NASH cases (40%) was greater than that of NAFLD cases. Incident cases of advanced liver disease are projected to increase up to 85% by 2030, and incident NAFLD liver deaths are estimated to increase 85% from 1900 (1100–3300) deaths in 2019 to 3500 (2100–6100) deaths in 2030.
+
+Conclusions: Restraining growth of the obese and diabetic populations, along with potential therapeutic options, will be essential for mitigating disease burden.
+
+## Introduction
+
+Nonalcoholic fatty liver disease (NAFLD) is recognized as a cause of advanced liver disease globally1–3 and particularly in Australia,4 where the increasing burden of metabolic syndrome is reflected in national survey data.5 NAFLD is defined as the presence of excessive liver fat in the absence of other causes such as excess alcohol.6 This analysis tracked NAFLD cases by fibrosis stage and categorized all cases as nonalcoholic steatohepatitis (NASH) or nonalcoholic fatty liver (NAFL) (simple steatosis).
+
+NASH is associated with liver fibrosis that may progress to advanced liver disease and related mortality.7,8 Advanced age along with obesity, diabetes, and metabolic syndrome have been identified as predictors for progression to advanced fibrosis.9 Advanced liver disease and NAFLD-related primary liver cancer typically develop after significant fibrosis has occurred; however, primary liver cancer may also occur among non-cirrhotic NASH patients.10 Recent analyses have estimated the disease burden and economic costs related to NASH based on existing literature11 while dynamic modeling techniques can compensate for inherent limitations in estimates of NAFLD disease progression.12 There is an urgent need to understand the future burden of NAFLDrelated liver disease in Australia. Using a modeling framework to inform decision making may facilitate development of strategies to ameliorate further increases in disease burden.
+
+## Methods
+
+Model. In order to estimate changes over time in NAFLD burden in Australia, a Markov model was constructed in Microsoft Excel to calculate the number of NAFLD cases by disease stage beginning in 1950.12 The total population by age group and gender was tracked over time, with new NAFLD cases entering the model based upon changes in the prevalence of adult obesity in Australia.
+
+Afflicted individuals were followed through each stage of the disease including fibrosis and advanced liver disease (Fig. S1) while also accounting for all-cause mortality (including general background mortality and excess cardiovascular and non-liver cancer mortality) as well as NAFLD-related liver mortality. Fibrosis
+
+![0_image_0.png](0_image_0.png)
+
+![0_image_1.png](0_image_1.png)
+
+progression rates increased with advancing age and were varied by gender with male experiencing faster progression (Table S1). Model results were compared with data and studies that estimate the incidence of primary liver cancer attributable to NAFLD in Australia. A Delphi process was used to identify and incorporate key model inputs and review outputs with local experts against available estimates of disease burden (Table S2).
+
+During initial model development, fibrosis progression and NASH status were adjusted to ensure distribution exceeded the number of NASH-related primary liver cancer cases reported in the surveillance system,13 with adjustments based on relative rates of overweight (25 > body mass index [BMI] ≤ 30 kg/m2) and obesity (BMI ≥ 30 kg/m2)
+14 and published odds of disease progression to advanced fibrosis.15 Meta-analysis of reported fibrosis progression rates among NAFLD and NASH cases7 has demonstrated a range so broad that modeling projections is not feasible. Therefore, ranges around fibrosis progression rates by age, gender, and fibrosis stage were back-calculated as described in a previous analysis.16 Cohort data were used for the relative increase in progression by age and gender17 with rates further modified based on results of meta-analysis18 and historical trends for hepatocellular carcinoma (HCC) incidence by age and gender.19 Progression rates to primary liver cancer, decompensated cirrhosis, and liverrelated death were based on reported estimates13 (Table S1).
+
+Population and mortality. The annual Australian population (1950–2050) by age group and gender was based on population data from the Australia Bureau of Statistics.20,21 To calculate annual mortality, estimated deaths by age group and gender from the United Nations were divided by population estimates.22 Background mortality rates were adjusted to account for incrementally increased mortality related to cardiovascular disease23 and nonliver cancers.24 Excess non-liver mortality varies by age; among a cohort of adults in the Sydney area with elevated liver enzymes, there was no significant increase in mortality reported for adults aged ≤ 49 years as compared with adults with normal enzyme results. Increased risk of mortality was observed among participants aged ≥ 50 years, and a significant mortality hazard ratio was observed for adults aged ≥ 80 years. Elevated non-liver mortality may also vary significantly by fibrosis stage and NASH status,8,25,26 which are heavily correlated with age. Thus, a standard mortality ratio (SMR) of 1.15 [uncertainty range: 1.00–1.30] was applied to background mortality rates for ≥ F1 NAFLD cases and the portion of F0 cases that were classified as NASH. F0 cases with simple steatosis were assumed to have no elevated mortality
+(SMR = 1.0). Uncertainty analysis was used to account for the potential that NAFLD cases experience no excess mortality with SMR = 1.0 (low) or up to 30% excess background mortality with SMR = 1.3 (high) among non-simple steatosis F0 cases. Model NAFLD-related liver deaths were calculated as a progression rate among prevalent primary liver cancer and decompensated cirrhosis cases.1,27–29 New nonalcoholic fatty liver disease cases. In order to estimate relative changes in the number of prevalent NAFLD cases, BMI data were used as a surrogate. While other factors are more strongly predictive of advanced NAFLD-related disease, data for changes in the prevalence of adults in different BMI
+classes are available for long periods of time, allowing for the estimation of long-term trends. The growth in NAFLD prevalence was assumed to occur simultaneous to changes in the prevalence of adults classified as obese. Because of variations in cutoff levels for obesity by race/ethnicity,30 the prevalence of obesity was calculated as a weighted average using a BMI cutoff of ≥ 25 kg/m2 for the population classified in the Australian Census as SouthEast Asian, North-East Asian, and Southern and Central Asian and a BMI ≥ 30 kg/m2 for the remaining population. The population with an obesity cutoff of ≥ 25 kg/m2 was estimated at 7.5% of the total Australian population in 2006, increasing to 12.9% in 2016. Extrapolating this trend linearly, the selected Asian populations would comprise 20.3% of the Australian population by 2030, meaning that the average BMI cutoff level for adult obesity will continue to decrease over time.
+
+Temporal changes in adult obesity were estimated by trending prevalence data from both the Australian National Health Survey5 and NCD Risk Factor Collaboration meta-analysis for Australia.31 Using the weighted average of adult obesity at different cutoff levels, the National Health Survey reported obesity prevalence at 21.6% in 1995, increasing to 31.8% prevalence in 2015. The NCD Risk Factor Collaboration adjusted obesity was estimated at 11.4% in 1975, increasing to 32.0% in 2014. Trends based on both data sources were considered for uncertainty analysis.5
+
+## Nonalcoholic Fatty Liver Disease Prevalence. Among
+
+individuals aged ≥ 15 years in 2015, there was an assumed NAFLD
+prevalence rate of 25% [uncertainty range: 20–30%]. A range of reported NAFLD prevalence exists for adults,32 and expert consensus was used to estimate the likeliest prevalence among adults and a conceivable high/low range of prevalence. Adjusting for lower prevalence among persons aged < 15 years, prevalence among all ages was estimated at 20.6% in 2015. The age and gender distribution of prevalent NAFLD cases was based on data from general population studies and is higher in men and those of advanced age.33–35 Prevalence among younger people (aged ≤ 18 years) is generally not estimated in large general population-based studies33,36 and was assumed to decline with decreasing age. Because of elevated competing mortality risk among NAFLD cases,8 it was also assumed that prevalence would naturally decline among the oldest age groups (≥ 80 years), with peak prevalence occurring in late middle age.
+
+## Nonalcoholic Steatohepatitis Prevalence. Prevalence
+
+of NASH was calculated based on the distribution of NAFLD cases by fibrosis stage given the total NAFLD population, with rates that varied by sex and age group. NASH-related fibrosis can regress in NAFLD patients7; however, there is considerable uncertainty around the presence and staging of NASH due to limitations of liver biopsy results.37 The model assumed that 5% of NAFLD cases without NASH could have previously experienced NASH with subsequent regression, including a portion with fibrotic changes. Increasing fibrosis stage was assumed to result in lower probability of experiencing regressed NASH, with each increased fibrosis stage resulting in an exponential decrease in regressed NASH, and the overall number of regressed NASH cases limited to 5%. Overall, 2000 ≥ F2 cases were classified as non-NASH NAFLD in 2019, or 0.47% of total NAFLD cases in 2019.
+
+![2_image_0.png](2_image_0.png)
+
+![2_image_1.png](2_image_1.png)
+
+![2_image_2.png](2_image_2.png)
+
+Liver transplants. Total annual liver transplants were reported by the Australia and New Zealand Organ Donation Registry.38 Based on expert input and analysis of diagnostic categories for transplant recipients, it was estimated that approximately 15%
+of current liver transplants are attributable to NAFLD/NASH. Analysis of liver transplant data from Australia and New Zealand has shown that NASH as an indicator grew from 2.0% in 2003 to 10.9% in 2017, making it the third leading indicator for liver transplants.39 Given the uncertainties around transplant demand and availability, it was assumed that the annual number of transplants would remain constant through 2030. However, this was a conservative estimate, as data already suggest that the proportion of NAFLD-related transplants is increasing in Western countries and that some portion of transplants indicated for cryptogenic or idiopathic cirrhosis are likely related to NAFLD.40 In addition, there are overlapping indications for transplant, as alcoholic liver disease and chronic viral hepatitis can coexist with NAFLD.41 Model validation. Primary liver cancer surveillance data were used to validate the results of the model. The Australian Institute of Health and Welfare estimates that incident primary liver cancer increased from 1076 in 2005 to 2215 in 2018.42 These estimates were further adjusted for underreporting, cancer morphology, and the proportion of cancers that could be NAFLD related.
+
+For underreporting, it was assumed that 25% of cancers may not be reported to the registry, but based on a Melbourne study, underreporting could historically be as high as 50%.4 For cancer morphology, an estimated 90% of incident primary liver cancer were assumed to be classified as HCC. A study of incident HCC
+cases in the Victorian Cancer Registry from 2012 to 2013 reported risk factors of fatty liver disease (14%), other/unknown (6%), and more than one risk factor (27%).4 For modeling purposes, a range of 4.0% to 34.8% was considered for the proportion of HCC that could be NAFLD related.43,44 This wide range was utilized because of uncertainty and changes over time in the etiology of liver cancer, with viral hepatitis expected to contribute relatively fewer cases in the future. Cholangiocarcinoma data were incorporated in the validation, with 5% of total primary liver cancers assumed to be classified as cholangiocarcinoma and an estimated 45% of cases potentially NAFLD related. The outcomes of this analysis were compared with model-predicted incident primary liver cancer cases to ensure that the model was predictive based on surveillance data.
+
+## Results
+
+Nonalcoholic fatty liver disease population. Between 2019 and 2030, NAFLD cases are expected to increase 25% from 5 556 000 (4 754 000–6 312 000) to 7 026 000 (5 842 000–7 890 000) (Fig. 1). Likewise, F0/F1 NAFLD cases are also projected to increase 25% from 5 124 000 (4 212 000–
+5 994 000) to 6 323 000 (4 946 000–7 393 000). F2 cases are expected to increase more (50%) during the same timespan, from 228 000 (142 000–345 000) cases in 2019 to 347 000
+
+![3_image_0.png](3_image_0.png)
+
+(218 000–524 000) cases in 2030. The F3 population is predicted to increase by 70% between 2019 and 2030, from 133 000
+(79 100–193 000) to 223 000 (134 000–322 000) cases. Compensated cirrhotic cases were forecasted to increase 85% from 62 900
+(37 500–105 000) cases in 2019 to 115 000 (68 700–190 000)
+cases in 2030. Prevalent cases of decompensated cirrhosis, primary liver cancer and liver transplants, are expected to increase concurrently from a combined 8500 (5600–14 500) to 16 000
+(11 000–25 700) cases, an increase of 85% during 2019–2030.
+
+The prevalence of NAFLD in all ages is predicted to increase from 2.0% (18.8–25.0%) in 2019 to 23.6% (19.6–26.5%) by 2030.
+
+Prevalent NAFLD cases by age group and gender were compared with the distribution of the non-NAFLD Australian population
+(Fig. 2). In 2019, the largest prevalent NAFLD age group was aged 55–59 years, with 595 000 NAFLD cases. By 2030, peak cases (687 000 cases) were observed in persons aged 60–64 years.
+
+## Nonalcoholic Fatty Liver Population.  The Nafl Popu-
+
+lation was assumed to be cases with simple steatosis that never progressed to NASH, with a relatively small number of cases that were formerly NASH and experienced disease regression. In 2019, the NAFL population is estimated to be 4 239 000 (3 714 000– 4 690 000) cases, or 76.3% of all NAFLD cases. By 2030, the
+
+| Table 1                                                                                                     | Model estimates of NAFLD burden—Australia, 2015–2030 Year 2015    | 2020                                                                     | 2025                   | 2030                  |
+|-------------------------------------------------------------------------------------------------------------|-------------------------------------------------------------------|--------------------------------------------------------------------------|------------------------|-----------------------|
+| Country population                                                                                          | 23 816 000                                                        | 25 710 000                                                               | 27 794 000             | 29 747 000            |
+| Prevalent cases NAFLD cases                                                                                 | 4 915 000 (4 220 000–                                             | 5 710 000 (4 879 000–                                                    | 6 424 000 (5 387 000–  | 7 026 000 (5 842 000– |
+| 5 605 000)                                                                                                  | 6 483 000)                                                        | 7 253 000)                                                               | 7 890 000)             |                       |
+| NAFLD prevalence rate (all ages)                                                                            | 20.6% (17.7–23.5%)                                                | 22.2% (19.0–25.2%)                                                       | 23.1% (19.4–26.1%)     | 23.6% (19.6–26.5%)    |
+| F0                                                                                                          | 4 211 000 (3 541 000–                                             | 4 818 000 (4 009 000–                                                    | 5 337 000 (4 334 000–  | 5 741 000 (4 557 000– |
+| 4 840 000)                                                                                                  | 5 515 000)                                                        | 6 087 000)                                                               | 6 581 000)             |                       |
+| F1                                                                                                          | 360 000 (244 000–                                                 | 438 000 (295 000–                                                        | 513 000 (344 000–      | 582 000 (389 000–     |
+| 509 000)                                                                                                    | 619 000)                                                          | 724 000)                                                                 | 812 000)               |                       |
+| F2                                                                                                          | 186 000 (116 000–                                                 | 238 000 (149 000–                                                        | 293 000 (184 000–      | 347 000 (218 000–     |
+| 282 000)                                                                                                    | 361 000)                                                          | 443 000)                                                                 | 524 000)               |                       |
+| F3                                                                                                          | 105 000 (62 000–153 000)140 000 (83 600–204 000)180 000 (108 000– | 223 000 (134 000–                                                        |                        |                       |
+| 261 000)                                                                                                    | 322 000)                                                          |                                                                          |                        |                       |
+| Compensated cirrhosis                                                                                       | 47 900 (28 600–80 200)                                            | 67 000 (39 900–111 000) 89 400 (53 200–148 000) 115 000 (68 700–190 000) |                        |                       |
+| 6400 (4100–11 000)                                                                                          | 9100 (6000–15 500)                                                | 12 200 (8300–20 100)                                                     | 16 000 (11 000–25 700) |                       |
+| Decompensated cirrhosis, HCC, and liver                                                                     |                                                                   |                                                                          |                        |                       |
+| transplant NASH cases                                                                                       | 1 119 000 (886 000–                                               | 1 366 000 (1 078 000–                                                    | 1 612 000 (1 264 000–  | 1 848 000 (1 439 000– |
+| 1 380 000)                                                                                                  | 1 681 000)                                                        | 1 974 000)                                                               | 2 256 000)             |                       |
+| NASH prevalence rate (all ages)                                                                             | 4.7% (3.7–5.8%)                                                   | 5.3% (4.2–6.5%)                                                          | 5.8% (4.5–7.1%)        | 6.2% (4.8–7.6%)       |
+| Incident cases Decompensated cirrhosis                                                                      | 1600 (920–2900)                                                   | 2300 (1300–4000)                                                         | 3000 (1800–5400)       | 3900 (2300–6900)      |
+| HCC                                                                                                         | 330 (220–520)                                                     | 440 (300–700)                                                            | 580 (380–910)          | 730 (480–1100)        |
+| Liver death                                                                                                 | 1300 (760–2300)                                                   | 1800 (1100–3200)                                                         | 2500 (1500–4400)       | 3200 (1900–5700)      |
+| HCC, hepatocellular carcinoma; NAFLD, nonalcoholic fatty liver disease; NASH, nonalcoholic steatohepatitis. |                                                                   |                                                                          |                        |                       |
+
+Figure 3 Reported range and model-estimated incident nonalcoholic fatty liver disease
+(NAFLD)-related primary liver cancer cases— Australia, 2005–2015. , reported range of incident NAFLD-related primary liver cancer cases; , model incident primary liver cancer cases.
+
+NAFL population is estimated to grow 20% to 5 178 000
+
+![4_image_0.png](4_image_0.png)
+
+(4 403 000–5 634 000) cases (73.7% of total). NAFL cases classi-fied as ≥ F2 fibrosis were also estimated to increase from 2000 cases in 2019 to 3200 cases in 2030.
+
+Nonalcoholic steatohepatitis population. The number of prevalent NASH cases was projected to increase 40% from 1 317 000 (1 040 000–1 622 000) to 1 848 000 (1 439 000–
+2 256 000) cases during the 2019–2030 timeframe (Fig. 1). NASH
+cases were projected to comprise 23.7% of all NAFLD cases in 2019, increasing to 26.3% of cases in 2030. NASH prevalence in the general population (all ages) was estimated as 5.2% (4.1– 6.4%) in 2019 and is expected to increase to 6.2% (4.8–7.6%) in 2030 (Table 1).
+
+Among NASH cases in 2019, 204 000 were estimated to have F3/F4 fibrosis or advanced liver disease (decompensated cirrhosis, liver cancer, or liver transplant), encompassing 15.5% of all NASH cases and 0.8% of the total population (all ages). By 2030, this number was expected to increase 75% to 354 000 cases, accounting for 19.1% of all NASH cases and 1.2% of the total Australian population.
+
+Nonalcoholic fatty liver disease-related decompensated cirrhosis and primary liver cancer. Incident decompensated cirrhosis cases were projected to increase 85%
+from 2100 (1100–3800) cases in 2019 to 3900 (2300–6900)
+cases in 2030 (Fig. 1). Cumulative incidence of decompensated cirrhosis during the same time period was estimated to be 35 800 (20 800–63 200) cases. Cases of incident primary liver cancer were forecasted to increase by 75% from 420 (280–
+660) cases in 2019 to 730 (480–1100) cases in 2030; cumulative incident cases of primary liver cancer between 2019 and 2030 were estimated to be 6800 (4500–10 700). Modeled incident liver cancer was compared with reported estimates for 2005–2015, for which the most reliable data were available
+(Fig. 3). During this timespan, model incident liver cancer cases were within the expected range.
+
+Mortality. In the NAFLD population, annual liver-related deaths are estimated to increase 90% from 1700 (1000–3000)
+to 3200 (1900–5700) cases during 2019–2030 (Fig. 1). Cumulative liver deaths during the same time period were estimated to be 29 300 (17 300–51 500). Total deaths in the NAFLD population in 2019 are estimated at 54 800 deaths increasing 55% to 85 500 deaths in 2030. In 2019, modeled liver mortality accounted for 3.1% of annual deaths in Australia's NAFLD population, increasing to 3.8% of deaths in 2030. Among the NASH population, annual deaths are estimated to be 19 800 in 2019, increasing 75% to 34 800 deaths in 2030. Modeled liver deaths in the NASH population were estimated to comprise 8.7% (1700 deaths) of total deaths in 2019, increasing to 9.3% (3200 deaths) in 2030.
+
+## Discussion
+
+The results of NAFLD modeling suggest that NAFLD presents an expanding burden such that the Australian population22 is expected to experience substantial increases in NAFLD-related disease burden in the coming decades. In the coming decade, NASH may become a leading indication for liver transplantation in Australia, in tandem with a reduced burden of viral hepatitis.
+
+The current analysis utilized both literature review and expert interviews to design the model and validate model outputs. Longitudinal trends in adult obesity levels, including estimates from both the Australian National Health Survey and NCD Risk Factor Collaboration, were used.5,31 Trending of obesity estimates from both data sources shows that the period of fastest growth in obesity has passed, while future growth rates in obesity remain uncertain.
+
+Even if obesity prevalence in Australia stabilizes, NAFLDrelated morbidity and mortality are projected to rise. The Australian population aged ≥ 65 years is projected to increase by over 1.4 million persons between 2019 and 2030.22 With increasing average age, the population will experience greater risk for advanced liver disease.7,15 The number of primary liver cancer cases identified as NAFLD-related has already been increasing over time1; however, patients with NAFLD face high rates of non-surveillance for liver cancer.45 Our results further confirm the continued growth in NAFLD-related liver cancer in Australia and the pressing need to better identify NAFLD cases, especially persons with significant fibrosis. Persons with diabetes represent a substantial portion of the NASH population,6 and physicians should consider diabetics a high-risk group. There were 1.2 million diagnosed diabetics in Australia in 2015,46 and approximately 20% of cases may be undiagnosed.
+
+By 2030, the diabetic population is projected to grow to 2.2–
+3.0 million cases.47 Modeling projected disease burden is subject to multiple limitations. Some limitations apply to all disease models, such as uncertainties around the future growth of the total Australian population21 and the impact of immigration. Other limitations are present when modeling the growth in chronic lifestyle conditions. Trends projecting growth in the prevalence of obesity, diabetes, and other facets of the metabolic syndrome are informed by current and historical data, but such trends may change in the future.
+
+Rates of childhood/adolescent obesity are relatively high in Australia14 but may be stabilizing.48 In the future, a larger portion of NAFLD patients will have experienced a longer duration of obesity and a potentially earlier onset of NAFLD with disease progression occurring at younger ages.49 In contrast, another uncertainty is the potential availability of new therapies targeted at different facets of metabolic syndrome (e.g. NASH, diabetes, and cardiovascular disease) that would impact the natural history of disease by reducing the rate of disease progression.
+
+This analysis differs from previous work,23 in that assumptions for model inputs, as well as low and high ranges for sensitivity analysis, varied. This analysis considered the impact of changing obesity at two different cutoff levels (≥ 25 and ≥ 30 kg/m2) to account for changes in demographics of the population and the impact on NAFLD prevalence. In addition, this analysis included assumptions for excess background mortality rates that were adjusted for the proportion of non-NASH F0 cases, assuming that these cases did not experience elevated mortality. Given the long natural history of the metabolic syndrome and NASH, the impact of competing mortality will play a large role in future disease burden (Fig. S3).
+
+The current analysis was calibrated and validated using surveillance data for advanced liver disease, primarily NAFLDrelated liver cancer. The historical incidence of liver cancer may be underreported to a greater degree than assumed in this analysis.4 The relative contribution of NAFLD to liver cancer changes over time as competing risk factors for liver cancer (e.g. viral hepatitis) vary greatly over time, and others such as alcoholic liver disease remain relatively constant.
+
+Results of analyses demonstrate growing disease burden associated with NAFLD and NASH, following the trajectory of increasing obesity in Australia.5 Over one quarter of Australians aged 5–17 years are overweight or obese. This may translate to increasing rates of NAFLD in younger age groups and continued high levels of NAFLD-related disease burden in the coming decades. Intervention is needed to slow the growth in obesity and metabolic syndrome. Both lifestyle modifications and other therapeutic options50 must be considered to avert the coming epidemic of NAFLD-related liver disease.
+
+## References
+
+1 Younossi ZM, Otgonsuren M, Henry L et al. Association of nonalcoholic fatty liver disease (NAFLD) with hepatocellular carcinoma (HCC) in the United States from 2004 to 2009. Hepatology 2015; 62: 1723–30.
+
+2 Sanyal A, Poklepovic A, Moyneur E, Barghout V. Population-based risk factors and resource utilization for HCC: US perspective. Curr.
+
+Med. Res. Opin. 2010; 26: 2183–91.
+
+3 Loomba R, Sanyal AJ. The global NAFLD epidemic. Nat. Rev.
+
+Gastroenterol. Hepatol. 2013; 10: 686–90.
+
+4 Hong TP, Gow P, Fink M et al. Novel population-based study finding higher than reported hepatocellular carcinoma incidence suggests an updated approach is needed. Hepatology 2016; 63: 1205–12.
+
+5 Australian Institute of Health and Welfare. Overweight & obesity 2018
+[Available from: https://www.aihw.gov.au/reports-statistics/behavioursrisk-factors/overweight-obesity/data].
+
+6 Wong VW, Chan WK, Chitturi S et al. Asia–Pacific Working Party on Non-alcoholic Fatty Liver Disease guidelines 2017—part 1: definition, risk factors and assessment. J. Gastroenterol. Hepatol. 2018; 33: 70–85.
+
+7 Singh S, Allen AM, Wang Z, Prokop LJ, Murad MH, Loomba R.
+
+Fibrosis progression in nonalcoholic fatty liver vs nonalcoholic steatohepatitis: a systematic review and meta-analysis of paired-biopsy studies. Clin. Gastroenterol. Hepatol. 2015; 13: 643–54 e1–9; quiz e39–40.
+
+8 Dulai PS, Singh S, Patel J et al. Increased risk of mortality by fibrosis stage in nonalcoholic fatty liver disease: systematic review and metaanalysis. Hepatology 2017; 65: 1557–65.
+
+9 McPherson S, Hardy T, Henderson E, Burt AD, Day CP, Anstee QM.
+
+Evidence of NAFLD progression from steatosis to fibrosingsteatohepatitis using paired biopsies: implications for prognosis and clinical management. J. Hepatol. 2015; 62: 1148–55.
+
+10 White DL, Kanwal F, El-Serag HB. Association between nonalcoholic fatty liver disease and risk for hepatocellular cancer, based on systematic review. Clin. Gastroenterol. Hepatol. 2012; 10: 1342–59.e2.
+
+11 Younossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L, Wymer M.
+
+Global epidemiology of non-alcoholic fatty liver disease—metaanalytic assessment of prevalence, incidence and outcomes.
+
+Hepatology. 2015.
+
+12 Estes C, Anstee QM, Arias-Loste MT et al. Modeling NAFLD disease burden in China, France, Germany, Italy, Japan, Spain, United Kingdom, and United States for the period 2016–2030. J. Hepatol. 2018; 69: 896–904.
+
+13 Estes C, Razavi H, Loomba R, Younossi Z, Sanyal AJ. Modeling the epidemic of nonalcoholic fatty liver disease demonstrates an exponential increase in burden of disease. Hepatology. 2017.
+
+14 Worldwide trends in body-mass index, underweight, overweight, and obesity from 1975 to 2016: a pooled analysis of 2416 population-based measurement studies in 128.9 million children, adolescents, and adults.
+
+Lancet 2017; 390: 2627–42.
+
+15 Angulo P, Hui JM, Marchesini G et al. The NAFLD fibrosis score: a noninvasive system that identifies liver fibrosis in patients with NAFLD. Hepatology 2007; 45: 846–54.
+
+16 Blach S, Zeuzem S, Manns M et al. Global prevalence and genotype distribution of hepatitis C virus infection in 2015: a modelling study.
+
+Lancet Gastroenterol. Hepatol. 2017; 2: 161–76.
+
+17 Harris RJ, Thomas B, Griffiths J et al. Increased uptake and new therapies are needed to avert rising hepatitis C-related end stage liver disease in England: modelling the predicted impact of treatment under different scenarios. J. Hepatol. 2014; 61: 530–7.
+
+18 Thein HH, Yi Q, Dore GJ, Krahn MD. Natural history of hepatitis C
+virus infection in HIV-infected individuals and the impact of HIV in the era of highly active antiretroviral therapy: a meta-analysis. AIDS 2008; 22: 1979–91.
+
+19 Surveillance, Epidemiology, and End Results (SEER) Program research data (1973–2013) [Internet]. National Cancer Institute. 2016
+[cited August 10th 2016]. Available from: www.seer.cancer.gov.
+
+20 Australian Bureau of Statistics. 3105.0.65.001—Australian historical population statistics, 2016, 2019 [Available from: https://www.abs.gov. au/AUSSTATS/abs@.nsf/DetailsPage/3105.0.65.0012016? OpenDocument].
+
+21 Australian Bureau of Statistics. 3222.0—population projections, Australia, 2017 (base)—2066, 2019 [Available from: https://www.abs.
+
+gov.au/AUSSTATS/abs@.nsf/Lookup/3222.0Main+Features12017% 20(base)%20-%202066?OpenDocument].
+
+22 United Nations, Department of Economic Social Affairs Population Division. World Population Prospects: The 2017 Revision. New York: United Nations, 2018.
+
+23 Stepanova M, Rafiq N, Makhlouf H et al. Predictors of all-cause mortality and liver-related mortality in patients with non-alcoholic fatty liver disease (NAFLD). Dig. Dis. Sci. 2013; 58: 3017–23.
+
+24 Harding JL, Shaw JE, Anstey KJ et al. Comparison of anthropometric measures as predictors of cancer incidence: a pooled collaborative analysis of 11 Australian cohorts. Int. J. Cancer 2015; 137: 1699–708.
+
+25 Vilar-Gomez E, Calzadilla-Bertot L, Wai-Sun Wong V et al. Fibrosis severity as a determinant of cause-specific mortality in patients with advanced nonalcoholic fatty liver disease: a multi-national cohort study. Gastroenterology 2018; 155: 443–57.e17.
+
+26 Hagstrom H, Nasr P, Ekstedt M et al. Fibrosis stage but not NASH
+predicts mortality and time to development of severe liver disease in biopsy-proven NAFLD. J. Hepatol. 2017; 67: 1265–73.
+
+27 Sanyal AJ, Banas C, Sargeant C et al. Similarities and differences in outcomes of cirrhosis due to nonalcoholic steatohepatitis and hepatitis C. Hepatology 2006; 43: 682–9.
+
+28 Rahman RN, Ibdah JA. Nonalcoholic fatty liver disease without cirrhosis is an emergent and independent risk factor of hepatocellular carcinoma: a population based study. Hepatology 2012; 56: 241A.
+
+29 Ries L, Young G, Keel G, Eisner M, Lin Y, Horner M. SEER Survival Monograph: Cancer Survival among Adults: U.S. SEER Program, 1988–2001, Patient and Tumor Characteristics. National Cancer Institute, SEER Program: Bethesda, MD, 2007.
+
+30 Deurenberg P, Yap M, van Staveren WA. Body mass index and percent body fat: a meta analysis among different ethnic groups. Int. J. Obes.
+
+Relat. Metab. Disord. 1998; 22: 1164–71.
+
+31 Trends in adult body-mass index in 200 countries from 1975 to 2014: a pooled analysis of 1698 population-based measurement studies with 19.2 million participants. Lancet 2016; 387: 1377–96.
+
+32 Younossi Z, Anstee QM, Marietti M et al. Global burden of NAFLD
+and NASH: trends, predictions, risk factors and prevention. Nat. Rev.
+
+Gastroenterol. Hepatol. 2018; 15: 11–20.
+
+33 Lazo M, Hernaez R, Eberhardt MS et al. Prevalence of nonalcoholic fatty liver disease in the United States: the Third National Health and Nutrition Examination Survey, 1988–1994. Am. J. Epidemiol. 2013; 178: 38–45.
+
+34 Caballeria L, Pera G, Auladell MA et al. Prevalence and factors associated with the presence of nonalcoholic fatty liver disease in an adult population in Spain. Eur. J Gastroenterol. Hepatol. 2010; 22: 24–32.
+
+35 Fan JG, Farrell GC. Epidemiology of non-alcoholic fatty liver disease in China. J. Hepatol. 2009; 50: 204–10.
+
+36 Choi YJ, Lee DH, Han KD et al. Is nonalcoholic fatty liver disease associated with the development of prostate cancer? A nationwide study with 10,516,985 Korean men. PLoS ONE 2018; 13: e0201308.
+
+37 Ratziu V, Charlotte F, Heurtier A et al. Sampling variability of liver biopsy in nonalcoholic fatty liver disease. Gastroenterology 2005; 128:
+1898–906.
+
+38 Australia and New Zealand Organ Donation (ANZOD) Registry. Annual report of the Australia and New Zealand Organ Donation Registry
+(ANZOD). 2018.
+
+39 Calzadilla-Bertot L, Jeffrey GP, Jacques B et al. Increasing incidence of nonalcoholic steatohepatitis as an indication for liver transplantation in Australia and New Zealand. Liver Transpl. 2019; 25: 25–34.
+
+40 Wong RJ, Cheung R, Ahmed A. Nonalcoholic steatohepatitis is the most rapidly growing indication for liver transplantation in patients with hepatocellular carcinoma in the U.S. Hepatology 2014; 59:
+2188–95.
+
+41 Thurnheer MC, Schulz TR, Nguyen T, MacLachlan J, Sasadeusz J.
+
+Regional challenges: evaluation of a hepatitis outreach programme using transient elastography (FibroScan) in Victoria. Intern. Med. J.
+
+2016; 46: 273–81.
+
+42 Australian Institute of Health and Welfare. Cancer compendium:
+information and trends by cancer type 2018 [Available from: https://
+www.aihw.gov.au/reports/cancer/cancer-compendium-informationtrends-by-cancer/report-contents/summary].
+
+43 Weinmann A, Alt Y, Koch S et al. Treatment and survival of nonalcoholic steatohepatitis associated hepatocellular carcinoma. BMC
+Cancer 2015; 15: 210.
+
+44 Dyson J, Jaques B, Chattopadyhay D et al. Hepatocellular cancer: the impact of obesity, type 2 diabetes and a multidisciplinary team.
+
+J. Hepatol. 2014; 60: 110–7.
+
+45 Huang Y, Wallace MC, Adams LA et al. Rate of nonsurveillance and advanced hepatocellular carcinoma at diagnosis in chronic liver disease. J. Clin. Gastroenterol. 2018; 52: 551–6.
+
+46 Australian Institute of Health and Welfare. Diabetes snapshot 2018
+[Available from: https://www.aihw.gov.au/reports/diabetes/diabetessnapshot/contents/how-many-australians-have-diabetes].
+
+47 Shaw J, Tanamas S. Diabetes: The Silent Pandemic and Its Impact on Australia. Diabetes Australia: Canberra, 2012.
+
+48 Hardy LL, Mihrshahi S, Gale J, Drayton BA, Bauman A, Mitchell J.
+
+30-year trends in overweight, obesity and waist-to-height ratio by socioeconomic status in Australian children, 1985 to 2015. Int. J. Obes.
+
+(Lond) 2017; 41: 76–82.
+
+49 Ratziu V, Marchesini G. When the journey from obesity to cirrhosis takes an early start. J. Hepatol. 2016; 65: 249–51.
+
+50 Chitturi S, Wong VW, Chan WK et al. The Asia–Pacific Working Party on Non-alcoholic Fatty Liver Disease guidelines 2017—part 2:
+management and special groups. J. Gastroenterol. Hepatol. 2018; 33:
+86–98.
+
+## Supporting Information
+
+Additional supporting information may be found online in the Supporting Information section at the end of the article.
+
+Data S1. Supplementary Information. Table S1. Fibrosis Transition Probabilities by Disease Stage, Sex and Age Group.
+
+Table S2. Delphi Process. Figure S1. NAFLD Disease Progression Model.
+
+Figure S2. Reported Prevalence of Adult Obesity - Australia, 1975–2015.
+
+Figure S3. Key Drivers of Uncertainty for Prevalent NAFLD and NASH Cases - Australia, 2030.

medical/md/PMC7645358.md

@@ -0,0 +1,192 @@
+Journal of International Medical Research
+
+![0_image_0.png](0_image_0.png)
+
+48(4) 1–8
+! The Author(s) 2019 Article reuse guidelines:
+sagepub.com/journals-permissions DOI: 10.1177/0300060519893852 journals.sagepub.com/home/imr
+
+# Association Between Hla-Drb1* Allele
+
+polymorphism and caries susceptibility in Han Chinese children and adolescents in the Xinjiang Uygur Autonomous Region Liping Wang1, Boqi Li1, Xiaomin Tie1, Tao Liu2,3, Shutao Zheng2,3 and Yishan Liu1
+
+## Abstract
+
+Objective: The rate of caries and the mean number of decayed, missing, or filled teeth were reported to be significantly higher in children in the Xinjiang Uygur Autonomous Region than in children in eastern China. Little is known regarding the genetic basis of caries among residents of the Xinjiang Uygur Autonomous Region. This study investigated the association between HLADRB1 alleles and caries susceptibility in Han Chinese children and adolescents in the Xinjiang Uygur Autonomous Region. Methods: HLA-DRB1 allele frequency was assessed in DNA samples from buccal swabs of 42 patients with caries and 123 healthy control participants using a polymerase chain reaction method with sequence-specific primers. The chi-squared test or Fisher's exact test, followed by Bonferroni correction, was used to calculate differences in allele frequencies between groups.
+
+Results: Compared with the healthy controls, the allele frequency of HLA-DRB1*13 was significantly higher in patients with caries in the Xinjiang Uygur Autonomous Region (35.71% vs.
+
+18.70%). The allele frequency of HLA-DRB1*09 was significantly lower in patients with caries than in healthy controls (4.76% vs. 25.20%).
+
+| 1 Department of Pediatric Dentistry, First Affiliated Hospital of Xinjiang Medical University, Xinjiang Uygur Autonomous Region, Urumqi, PR China 2 Clinical Medical Research Institute, First Affiliated Hospital of Xinjiang Medical University, Xinjiang Uygur Autonomous Region, Urumqi, PR China   |
+|---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+
+3State Key Lab Incubation Base of Xinjiang Major Diseases Research, First Affiliated Hospital of Xinjiang Medical University, Xinjiang Uygur Autonomous Region, Urumqi, PR China Corresponding author: Yishan Liu, Department of Pediatric Dentistry, First Affiliated Hospital of Xinjiang Medical University, Xinjiang Uygur Autonomous Region, Urumqi 830054, PR China. Email: LYS-tree@126.com Creative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).
+
+Conclusions: HLA-DRB1*13 alleles could confer greater caries susceptibility, whereas HLADRB1*09 could be protective against caries pathogenesis, in Han Chinese children in the Xinjiang Uygur Autonomous Region.
+
+## Keywords
+
+HLA-DRB1, Dental Caries, Xinjiang, Polymerase Chain Reaction, Adolescent, Child, Gene Frequency, China, Han Chinese Date received: 17 May 2019; accepted: 19 November 2019
+
+## Introduction
+
+Dental caries in permanent teeth is the second most common human disease.1 With advances in oral medicine, the incidence of caries has significantly decreased worldwide.2 However, caries continues to impact the quality of life of a large number of school-aged children and adults.3 Notably, the rate of untreated dental caries in 5-year-old children in China was 97.1% in 2005.4 The rate of caries and the mean number of decayed, missing, or filled teeth were reported to be significantly higher in children in the Xinjiang Uygur Autonomous Region than in children in eastern China.5 Therefore, potential causes for this increased incidence and severity must be investigated.
+
+Thus far, extensive studies have elucidated the roles of genetic factors in the etiology of caries.6–8 Four major factors—host, dental plaque, food, and time—are reportedly associated with the pathogenesis of caries.9 Genes encoding the major histocompatibility complex (MHC) could modulate host immune responses against typical cariogenic bacteria, bacterial adhesion to dental surfaces, and dental surface colonization, as well as enamel development.10,11 Variations in MHC class II-DR antigens are presumed to influence caries susceptibility.12 MHC
+polymorphisms are crucial for immune responses to colonization by oral microorganisms, thereby influencing individual variations in caries susceptibility. The human leukocyte antigen (HLA) II-DRB1 gene has been associated with the onset of oral diseases.7,13 Lehner et al.14 reported that individuals with the HLA-DRB1*04 allele exhibited greater caries susceptibility. Moreover, the HLA-DRB1*04 allele was positively associated with the number of pathogenic Streptococcus mutans bacteria in the oral cavity.
+
+In 2014, Mauramo et al.15 reported an association between HLA alleles and susceptibility to caries in Caucasian adults; HLA-DRB1*01, HLA-DRB1*04, HLADRB1*07, and HLA-DRB1*13 alleles were more frequently detected in patients with caries. Additional HLA alleles have been associated with the onset of other oral diseases. For example, HLA-B15 and HLADRB1*12 alleles were associated with periodontal diseases, whereas the HLA-A32 allele was associated with temporomandibular dysfunction.16 Recently, Opal et al.8 proposed that the HLA-DRB1*04 and HLA-DQB1 alleles may confer caries susceptibility. These prior studies suggest an association between HLA alleles and caries formation.
+
+To the best of our knowledge, little is known regarding the genetic basis of caries among residents of the Xinjiang Uygur Autonomous Region. In this study, we investigated the association between MHC (HLA-DRB1) alleles and caries susceptibility in Han Chinese children and adolescents in the Xinjiang Uygur Autonomous Region.
+
+## Materials And Methods Participants
+
+Adolescent and pediatric patients with caries who presented for outpatient consultations in the Department of Pediatric Dentistry in the First Affiliated Hospital of Xinjiang Medical University in 2015 were recruited for this study. The inclusion criteria were as follows: (i) patients with at least 10 caries; (ii) patients aged 6 to 12 years; (iii) patients from Han Chinese families living in the Xinjiang Uygur Autonomous Region for more than two generations who were not related to other participants in this study; (iv) patients without systemic, immune, or hereditary diseases; (v) patients with similar lifestyle, eating habits, and oral hygiene habits; and (vi) patients without orthodontic devices in the mouth. The exclusion criteria were as follows: (i) patients with enamel hypoplasia or incomplete enamel mineralization; (ii) patients with tooth loss from other causes;
+(iii) patients who underwent caries prevention using a sealant or fluoride. The caries severity was evaluated using the World Health Organization scale for decayed/ missing/filled teeth: 0.0 to 1.1, very low; 1.2 to 2.6, low; 2.7 to 4.4, moderate; 4.5 to 6.5, high; and >6.6, very high. Han Chinese children with a value of 0 on the decayed/missing/filled teeth scale, who were randomly selected from data in the Blood Transfusion Department of the First Affiliated Hospital of Xinjiang Medical University, served as healthy controls; all other inclusion criteria were identical to those used for the patients in this study.
+
+## Ethics Statement
+
+Informed consent was obtained from all participants. The study protocol was approved by the Ethics Review Committee of the First Affiliated Hospital of Xinjiang Medical University.
+
+## Sample Collection And Dna Preparation
+
+All participants rinsed their mouths to remove any food remnants. Then, buccal swabs were obtained using one sterile cotton swab for each participant. The swab was allowed to dry naturally and then suspended in 5% Chelex-100 (SigmaAldrich, St. Louis, MO, USA); this was followed by the addition of 4 lL Proteinase K
+(20 mg/mL; Bio-Rad, Hercules, CA, USA) and vortexing of the sample tube. The tube containing the swab in solution was incubated in a water bath for 3 hours at 55C,
+then incubated in an ice bath for 3 minutes. The sample tube was centrifuged at 17,000  g for 2 minutes, using a centrifuge supplied by Sigma-Aldrich, and the supernatant was collected. Subsequently, the DNA product was purified using phenolchloroform extraction. DNA purity was determined using a NanoDrop Spectrophotometer ND-100 (Thermo Fisher Scientific Inc., Rockford, IL, USA);
+DNA was then preserved at –80C until further analysis.
+
+## Hla-Drb Allele Analysis
+
+HLA alleles were measured using the commercial HLA-DRB1* cyclerplate reagent kit (Cat. No. 200 030; Protrans, Hockenheim, Germany) for polymerase chain reaction (PCR) with sequencespecific primers, in accordance with the manufacturer's instructions. In brief, DNA samples (2.025–3.375 ng) were added to each well of the plate, and genotyping was performed for 23 genetic loci:
+DRB1 (i.e., DR1, DR103, DR15, DR16, DR17, DR18þ, DR4, DR7, DR8, DR9, DR10, DR11, DR12, DR13.1, DR13.3, DR13.4, DR14.1, DR14.2, DR14.3, and DR14.4), DRB3, DRB4, and DRB5. PCR reaction mixtures were prepared containing Pre Master Mix (70 lL Buffer R, 140 lL
+Buffer Y, and 1.6 lL of 5 U/lL Taq polymerase) and 50 mL DNA template. PCR
+amplifications were performed on the G-Storm PCR instrument (Agilegene Technologies, Ltd., Somerset, UK) under the following conditions: denaturation for 1 minute at 96C; five amplification cycles at 96C for 25 seconds, 70C for 50 seconds, and 72C for 45 seconds; 21 amplification cycles of 96C for 25 seconds, 65C for 50 seconds, and 72C for 45 seconds; four amplification cycles of 96C for 25 seconds and 55C for 60 seconds; and final extension at 72C for 2 minutes. PCR products were subjected to 1.5% agarose gel electrophoresis (GELDOC XR170-8170, Bio-Rad) followed by ethidium bromide staining. The results were visualized using the GelDoc XR system (BioRad). The frequencies of HLA alleles were calculated in patients with caries and healthy controls using the direct calculation method: (individual number of a given allele/total sample number)100%.
+
+## Statistical Analysis
+
+Statistical analysis was conducted using the IBM SPSS Statistics for Windows, version 19.0 (IBM Corp., Armonk, NY, USA). The chi-squared test or Fisher's exact test, followed by Bonferroni correction, was used to calculate differences in allele frequencies between groups. Differences with P<0.05 were considered to be statistically significant.
+
+## Results
+
+This study included 42 patients with caries and 123 healthy controls. Genotyping was performed for 23 genetic loci of DRB1, DRB3, DRB4, and DRB5. Thirteen DRB1 alleles were assessed for single nucleotide polymorphisms: DRB1*010x, DRB1*15, DRB1*160x, DRB1*03, DRB1*04, DRB1*070x, DRB1*08, DRB1*0901/02, DRB1*1001, DRB1*11, DRB1*120x, and DRB1*13. The DRB1 serotypes assessed were as follows: DRB1-DR1, DR103, DR15, DR16, DR17, DR18þ, DR4, DR7, DR8, DR9, DR10, DR11, DR12, DR13.1, DR13.3, DR13.4, DR14.1, DR14.2, DR14.3, and DR14.4.
+
+The allele frequencies of HLA-DRB1* for patients with caries and healthy controls are shown in Table 1 and Figure 1. The allele frequency of HLA-DRB1*13 was significantly higher in patients with caries than in healthy controls (P ¼ 0.024), while the allele frequency of HLA-DRB1*09 was significantly lower in patients with caries than in healthy controls (P ¼ 0.004).
+
+Among the healthy controls, the most frequent HLA-DRB1 alleles were DRB1*15, DRB1*09, DRB1*12, DRB1*04, DRB1*13, DRB1*07, DRB1*08, DRB1*14, DRB1*01, DRB1*11, DRB1*03, DRB1*10, and DRB1*16.
+
+## Discussion
+
+Caries prevalence varies among populations and the potential mechanisms remain unclear. Further studies are needed to identify the underlying etiological factors. The familial aggregation of caries indicates a degree of genetic susceptibility.17 In this study, we focused on caries-related susceptibility genes among Han Chinese children to improve our understanding of the pathophysiological processes of caries formation, which may aid in early diagnosis, prevention, and treatment of caries.
+
+Genetic contributions to the development of caries have been recognized since the 1920s. A comparison of dental
+
+| Healthy controls (N ¼ 123)   | Patients with caries (N ¼ 42)   |               |    |               |       |
+|------------------------------|---------------------------------|---------------|----|---------------|-------|
+| Allele                       | n                               | Frequency (%) | n  | Frequency (%) | P     |
+| DRB1*01                      | 14                              | 11.38         | 3  | 7.14          | 0.564 |
+| DRB1*03                      | 11                              | 8.94          | 7  | 16.67         | 0.249 |
+| DRB1*04                      | 28                              | 22.76         | 14 | 33.33         | 0.175 |
+| DRB1*07                      | 17                              | 13.82         | 5  | 11.90         | 0.752 |
+| DRB1*08                      | 15                              | 12.20         | 3  | 7.14          | 0.567 |
+| DRB1*09                      | 31                              | 25.20         | 2  | 4.76          | 0.004 |
+| DRB1*10                      | 7                               | 5.69          | 3  | 7.14          | 0.716 |
+| DRB1*11                      | 12                              | 9.76          | 8  | 19.05         | 0.111 |
+| DRB1*12                      | 28                              | 22.76         | 8  | 19.05         | 0.615 |
+| DRB1*13                      | 23                              | 18.70         | 15 | 35.71         | 0.024 |
+| DRB1*14                      | 15                              | 12.20         | 7  | 16.67         | 0.462 |
+| DRB1*15                      | 38                              | 30.89         | 13 | 30.95         | 0.994 |
+| DRB1*16                      | 6                               | 4.88          | 6  | 14.29         | 0.077 |
+
+![4_image_0.png](4_image_0.png)
+
+Figure 1. HLA-DRB* allele frequencies in patients with caries and healthy controls, as demonstrated by electrophoresis of PCR products. Positive bright bands are present in the following lanes (numbers shown in red), indicated with the corresponding HLA allele: 1 (DRB1*01), 3 (DRB1*15 and DRB1*16), 4 (DRB1*16), 7 (DRB1*03, DRB1*13, and DRB1*14), 8 (DRB1*04), 9 (DRB1*03), 11 (DRB1*09), 12 (DRB1*10), 13 (DRB1*11), 18 (DRB1*13, DRB1*14, DRB1*08, and DRB1*12), 20 (DRB1*13 and DRB1*14), 21 (DRB5*), and 22 (DRB3*). Lane 24 contains the blank control.
+
+characteristics in pairs of identical and fraternal twins revealed that the prevalence of similar characteristics was greater in monozygotic twins than in dizygotic twins, and that differences in characteristics were greater in dizygotic twins of different sexes.18 In a previous study, Gustafsson et al.19 reported that some participants were able to maintain a caries-free oral cavity despite the ingestion of a large amount of highly cariogenic foods. Thus, an individual's susceptibility or resistance to caries is affected by their genotype.
+
+Ozawa et al.20 investigated the genetic predisposition of individuals to the accumulation of oral microorganisms, together with the associations of HLA-DQA1, HLA-DQB1, and HLA-DRB1 alleles with the numbers of salivary Streptococcus mutans and Lactobacillus bacteria in young Japanese adults. They found that HLA-DQA1*0102, HLA-DQB1*0604, HLA-DRB1*0802, and HLA-DRB1*1302 were weakly associated with the numbers of Lactobacillus bacteria in saliva samples, while HLA-DQB1*0601 was associated with the numbers of S. mutans bacteria in saliva samples. Moreover, Bagherian et al.21 found that the allele frequency of HLA-DRB1*04 was 10-fold greater in children with caries than in caries-free children, which suggested that the HLA-DRB1*04 allele might confer susceptibility to caries.
+
+Valarini et al.22 performed a comparative analysis of 15- to 19-year-old students with or without caries; their findings confirmed a close relationship between HLA
+genes and caries. In particular, the HLADQ gene was more frequently found in students with caries. Similarly, McCarlie et al.23 reported that patients without the HLA-DRB1*04 allele exhibited reduced reactivity to S. mutans antigens, along with reduced secretory immunoglobulin A and total immunoglobulin A activities.
+
+The primary loci in residents of northern China were DRB1*15, DRB1*09, DRB1*04, DRB1*12, and DRB1*07; in contrast, the primary loci in residents of southern China were DRB1*09, DRB1*15, DRB1*12, DRB1*04, and DRB1*08.
+
+24 The most frequent HLA-DRB1 alleles of the healthy controls in our study represented a combination of the major alleles of DRB1 observed in Han individuals from the northern and southern regions of China. This genetic trend reflects the complex north-south migration of the Han Chinese population in the Xinjiang Uygur Autonomous Region and the influences of specific environmental features in this region. The relatively high incidence of caries in the Han Chinese population in the Xinjiang Uygur Autonomous Region presumably results from the combination of various environmental factors under this specific genetic background, and children at higher risk for caries appeared to have distinct genotypes. Specifically, higher frequencies of alleles conferring greater susceptibility to infectious factors can cause altered immune responses to infectious factors, thereby affecting caries susceptibility. Our results suggested that the risk of caries may be increased in children and adolescents carrying the DRB1*13 allele. Conversely, the DRB1*09 allele was expressed at a relatively lower frequency in patients with caries than in healthy controls, which indicated that this allele may be protective against caries. Wallengren et al.24 and Yildiz et al.25 independently reported an association between the DRB1*04 allele and caries development.
+
+In the present study, the allele frequency of DRB1*04 was higher in patients with caries than in healthy controls; however, the difference was not statistically significant. Our results differed from those of the studies by Valarini et al. and McCarlie et al.,22,23 possibly because of the following factors: (i) There are nationality, regional, and ethnic influences that affect the relationship between dental caries and HLA
+alleles. (ii) Variations in sample size may impact the study results. (iii) There might be differences in the HLA-DRB1 alleles between adolescents and adults at high risk of caries, which lead to differences in dominant cariogenic bacteria in saliva.
+
+There were some limitations in this study: our sample size was small and we could not identify the specific gene or allele responsible for caries susceptibility in the Han Chinese population in the Xinjiang Uygur Autonomous Region. Our future studies will address these aspects.
+
+In conclusion, we highlighted a potential association between HLA alleles and caries susceptibility. Importantly, we found allele associations in the Han Chinese population in the Xinjiang Uygur Autonomous Region that differed from associations found in Han Chinese populations in other parts of China. This finding suggests that the pathogenesis of caries is not induced in a simple manner by one or more genetic factors, and that it may involve the interactions of multiple genes within a specific environmental context.
+
+## Declaration Of Conflicting Interest
+
+The authors declare that there is no conflict of interest.
+
+## Funding
+
+This work is supported by the National Natural Science Foundation of China [grant number 81560178].
+
+## Orcid Id
+
+Yishan Liu https://orcid.org/0000-0001-82528578
+
+## References
+
+1. GBD 2016 Disease and Injury Incidence and Prevalence Collaborators. Global, regional, and national incidence, prevalence, and years lived with disability for 328 diseases and injuries for 195 countries, 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016. Lancet 2017; 390:
+1211–1259. doi: 10.1016/s0140-6736(17) 32154-2 2. Zhou X. The status and thinking of caries research in China. Chinese J Stomatol 2011; 46: 710–713.
+
+3. Petersen PE. The World Oral Health Report 2003: continuous improvement of oral health in the 21st century–the approach of the WHO Global Oral Health Programme. Community Dent Oral Epidemiol 2013; 31: 3–23.
+
+4. Ge L. Pediatric Dentistry. Beijing: People's Medical Publishing House, 2012, pp.1–4.
+
+5. Qi X. The Third National Sampling Survey on Oral Health Epidemiology. Beijing:
+People's Medical Publishing House, 2008, pp.10–20.
+
+6. Werneck RI, Mira MT and Trevilatto PC. A
+critical review: an overview of genetic influence on dental caries. Oral Dis 2012; 16:
+613–623. doi: 10.1111/j.1601-0825.2010. 01675.x 7. Sippert EA, de Oliveira e Silva C, Ayo CM,
+et al. HLA haplotypes and genotypes frequencies in Brazilian chronic periodontitis patients. Mediators Inflamm 2015; 2015: 481656. doi: 10.1155/2015/481656 8. Opal S, Garg S, Jain J, et al. Genetic factors affecting dental caries risk. Aust Dent J 2015; 60: 2–11. doi: 10.1111/adj.12262 9. Southam JC and Soames JV. Dental caries.
+
+In: Oral Pathology. 2nd ed. Oxford: Oxford University Press, 1993, pp.65–68.
+
+10. Lehner T. Immunization against dental caries. Vaccine 1985; 3: 65–68.
+
+11. Couve E, Osorio R and Schmachtenberg O.
+
+Reactionary dentinogenesis and neuroimmune response in dental caries. J Dent Res 2014; 93: 788–793. doi: 10.1177/
+0022034514539507 12. Tan J, Zhou Y and Tang X. Tissue Typing Techniques and Clinical Application. Beijing: People's Medical Publishing House, 2002, pp.500–533.
+
+13. Demmitt BA, Corley RP, Huibregtse BM,
+et al. Genetic influences on the human oral microbiome. BMC Genomics 2017; 18: 659. doi: 10.1186/s12864-017-4008-8 14. Lehner T, Lamb JR, Welsh KL, et al.
+
+Association between HLA-DR antigens and helper cell activity in the control of dental caries. Nature 1981; 292: 770–772.
+
+15. Mauramo M, Ramseier AM, Buser A, et al.
+
+Associations of HLA-A, -B and -DRB1 types with oral diseases in Swiss adults. PLoS One 2014; 9: e103527. doi: 10.1371/ journal.pone.0103527 16. Matti M, Markus RA, Andreas B, et al.
+
+Associations of HLA-A, -B and -DRB1 types with oral diseases in Swiss adults. PLoS ONE 2014; 9: e103527.
+
+17. Gustafsson BE, Quensel CE, Lanke LS,
+et al. The Vipeholm dental caries study; the effect of different levels of carbohydrate intake on caries activity in 436 individuals observed for five years. Acta Odontol Scand 1954; 11: 232–264.
+
+18. Lovelina FD, Shastri SM, Kumar PD.
+
+Assessment of the oral health status of monozygotic and dizygotic twins - a comparative study. Oral Health Prev Dent 2012; 10: 135–139.
+
+19. Ozawa Y, Chiba J and Sakamoto S. HLA
+class II alleles and salivary numbers of mutans streptococci and lactobacilli among young adults in Japan. Oral Microbiol Immunol 2001; 16: 353–357.
+
+20. Bagherian A, Nematollahi H, Afshari JT,
+et al. Comparison of allele frequency for HLA-DR and HLA-DQ between patients with ECC and caries-free children. J Indian Soc Pedod Prev Dent 2008; 26: 18–21.
+
+21. Valarini N, Maciel SM, Moura SK, et al.
+
+Association of dental caries with HLA Class II allele in Brazilian adolescents. Caries Res 2012; 46: 530–535. doi: 10.1159/ 000341188 22. McCarlie VW, Hartsfield JK Jr, Blum JS,
+et al. Total IgA and IgA reactivity to antigen I/II epitopes in HLA-DRB1*04 positive subjects. Open J Immunol 2013; 3: 82–92. doi:
+10.4236/oji.2013.33012 23. Tsuha Y, Hanada N, Asano T, et al. Role of peptide antigen for induction of inhibitory antibodies to Streptococcus mutans in human oral cavity. Clin Exp Immunol 2004; 137: 393–401. doi: 10.1111/j.1365-2249. 2004.02548.x 24. Wallengren ML, Hamberg K, Ericson D,
+et al. Low salivary IgA activity to cellsurface antigens of mutans streptococci related to HLA-DRB1*04. Oral Microbiol Immunol 2005; 20: 73–81. doi: 10.1111/
+j.1399-302X.2004.00192.x 25. Yildiz M, Pirim I, Bayindir YZ, et al. The association of HLA class I and II antigens in teenagers with caries experience. Eurasian J
+Med 2009; 41: 146–148.

medical/md/PMC8141336.md

@@ -0,0 +1,196 @@
+Received: 2021.01.16
+
+![0_image_0.png](0_image_0.png)
+
+![0_image_1.png](0_image_1.png)
+
+![0_image_2.png](0_image_2.png)
+
+Accepted: 2021.03.04 Available online: 2021.04.13 Published: 2021.05.17 Authors' Contribution: 
+Study Design A
+ Data Collection B
+ Statistical Analysis C
+Data Interpretation D
+ Manuscript Preparation E
+ Literature Search F
+Funds Collection G
+
+# Anti-N-Methyl-D-Aspartate Receptor Encephalitis With Serum Anti-Thyroid Antibodies: A Case Report And Literature Review
+
+| Authors' Contribution:  Study Design A  Data Collection B  Statistical Analysis C Data Interpretation D   |                                                                                         |                                                                                                                                                                                                                    |
+|-----------------------------------------------------------------------------------------------------------|-----------------------------------------------------------------------------------------|--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+| Manuscript Preparation E  Literature Search F Funds Collection G                                          | ADEF 1                                                                                  | Emilia Matera                                                                                                                                                                                                      |
+| BF 1                                                                                                      | Alessandra Gabellone                                                                    |                                                                                                                                                                                                                    |
+| D 2                                                                                                       | Maria Giuseppina Petruzzelli                                                            |                                                                                                                                                                                                                    |
+| F 1                                                                                                       | Lucia Marzulli                                                                          |                                                                                                                                                                                                                    |
+| DF 1                                                                                                      | Flora Furente                                                                           |                                                                                                                                                                                                                    |
+| A 1                                                                                                       | Lucia Margari                                                                           | 1 Department of Biomedical Sciences and Human Oncology, University Hospital of  Bari, Bari, Italy 2 Department of Basic Medical Sciences Neurosciences and Sense Organs,  University Hospital of Bari, Bari, Italy |
+| Corresponding Author:                                                                                     | Emilia Matera, e-mail: emilia.matera.ba@icloud.com                                      |                                                                                                                                                                                                                    |
+| Conflict of interest:                                                                                     | None declared                                                                           |                                                                                                                                                                                                                    |
+| Patient:                                                                                                  | Female, 16-year-old                                                                     |                                                                                                                                                                                                                    |
+| Final Diagnosis:                                                                                          | Anti NMDA receptor encephalitis                                                         |                                                                                                                                                                                                                    |
+| Symptoms:                                                                                                 | Epilectic seizure - irritability - memory decline - psychomotor retardation - psychosis |                                                                                                                                                                                                                    |
+| Medication:                                                                                               | -                                                                                       |                                                                                                                                                                                                                    |
+| Clinical Procedure:                                                                                       | -                                                                                       |                                                                                                                                                                                                                    |
+| Specialty:                                                                                                | Neurology                                                                               |                                                                                                                                                                                                                    |
+| Objective:                                                                                                | Rare disease                                                                            |                                                                                                                                                                                                                    |
+| Background:                                                                                               | Anti-N methyl D-aspartate receptor encephalitis (anti-NMDArE) is a disorder in which triggers such as infectious agents or neoplastic disease can lead to an autoimmune response against the nervous system, although  this disorder is usually idiopathic. Some patients with anti-NMDArE have evidence of other autoimmune alterations. Here, we present a case of non-paraneoplastic anti-NMDArE with elevation of serum anti-thyroid antibodies and a literature review of this association.                                                                                         |                                                                                                                                                                                                                    |
+| Case Report:                                                                                              | A 16-year-old girl was admitted in the University Hospital of Bari for a new onset of tonic-clonic seizures.  Progressively, the patient manifested also psychomotor agitation, language difficulties, memory impairment,  psychotic symptoms, autonomic dysfunction, and psychomotor retardation. Blood evaluation revealed the  presence of anti-thyroglobulin, anti-thyroperoxidase, and anti-NMDAr antibodies. Cerebrospinal fluid analysis  confirmed the diagnosis of anti-NMDArE. No tumors were found. Treatment with intravenous immunoglobulin, steroids, and plasma exchange relieved symptoms and decreased levels of serum anti-NMDAr antibodies.  After 12 months, the patient had full recovery of communicative capacity, with the persistence of slight difficulty of memory and mild tendency to irritability. Blood exams shown persistence of anti-NMDAr positivity and  absence of anti-thyroid antibodies.                                                                                         |                                                                                                                                                                                                                    |
+| Conclusions:                                                                                              | We report a rare case in which an autoimmune involvement of thyroid gland was concurrent with an antiNMDArE. It would be useful for clinical practice to clarify whether the presence of anti-thyroid antibody an characterize the clinical course, prognosis, and response to treatment of the idiopathic type of anti-NMDArE.                                                                                         |                                                                                                                                                                                                                    |
+| Keywords:                                                                                                 | Thyroiditis - Anti-N-Methyl-D-Aspartate Receptor Encephalitis - Adolescent              |                                                                                                                                                                                                                    |
+| Full-text PDF:                                                                                            | https://www.amjcaserep.com/abstract/index/idArt/931104 2338 1 - 39                      |                                                                                                                                                                                                                    |
+
+e-ISSN 1941-5923
+© Am J Case Rep, 2021; 22: e931104 DOI: 10.12659/AJCR.931104 e931104-1 Indexed in: [PMC] [PubMed] [Emerging Sources Citation Index (ESCI)]
+
+![0_image_3.png](0_image_3.png)
+
+## Background
+
+Anti-N-methyl-D-aspartate receptor encephalitis (anti-NMDArE), 
+first described by Dr. Josep Dalmau and colleagues at the University of Pennsylvania in 2007 [1], is an autoimmune disorder with a wide spectrum of neuropsychiatric symptoms. This disorder usually occurs in young women [2-4] with a femaleto-male ratio of approximately 4: 1 [5]. It is the second most common autoimmune encephalitis in children and adolescents following acute disseminated encephalomyelitis (ADEM) [6]. The NMDA receptor is ligand-gated cationic channel mainly located in the forebrain and hippocampus and activated by glutamate. It is involved in synaptic transmission and neuronal plasticity, and has a role in learning, judgment, perception of reality, memory, and autonomic functions [7]. In the antiNMDArE, the immune system produces immunoglobulins, with the prevalence of G1 subclass, against the GluN1/NR1 subunit of the NMDA receptor [8,9].
+
+These antibodies (Abs) are produced in response to an autoimmune reaction, but the cause of this process is not entirely understood. Previous infections from other agents, such as Herpes Simplex Virus (HSV), Epstein-Barr Virus (EBV) and neoplastic disease with ectopic expression of neuronal proteins are thought to trigger a misdirected immune response against the nervous system [10]. The anti-NMDArE associated with a tumor is identified as a paraneoplastic encephalitis. The most common tumor associated with anti-NMDArE is ovarian teratoma [11], which is diagnosed in 6-50% of female patients with paraneoplastic encephalitis [12], while testicular germ cell tumors, lung cancer, thyroid cancer, breast cancer, colon tumors, mediastinal teratoma, neuroblastoma and Hodgkin's lymphoma are less frequent [13-16]. Nevertheless, most cases of anti-NMDArE are idiopathic [7]. Possible risk factors for idiopathic anti-NMDArE are viral comorbidities, a family history for autoimmunity, and possible genetic and ethnic predisposition [10].
+
+Several studies showed that patients with autoimmune encephalitis have contemporary evidence of other autoimmune alterations and syndromes (eg, anti-nuclear Abs (ANA), thyroid peroxidase (TPO) Abs, Graves' disease, neuromyelitis optica, type I diabetes) [17-20], according to the hypothesis that an autoimmune disorder increases the risk of an additional autoimmune disorder [21]. Over the past decade, several authors have pointed out the coexistence of anti-thyroid (Thy) 
+Abs in non-paraneoplastic anti-NMDArE [21], but the clinical and pathogenetic significance of this association needs to be further explored. In the context of this ongoing debate, we present the present case report of an adolescent girl affected by a non-paraneoplastic anti-NMDArE associated with positive anti-TPO and anti-thyroglobulin (TG) circulating Abs; then, we discuss this finding together with other case reports selected through a brief review of the literature on the association between anti-NMDArE and serum anti-Thy Abs.
+
+## Case Report
+
+A 16-year-old girl was admitted in the Child Neuropsychiatric Unit of the University Hospital of Bari for the onset, during the previous week, of 3 tonic-clonic seizures, with loss of consciousness followed by falling and characterized by severe tonic muscle spasms, upward rolling of the eyes, loss of saliva from the mouth, bluish/gray face, wheezing sounds, and jerky movements of the face, arms, and legs, which gradually disappeared after 1-5 minutes. She had no personal history for previous medical conditions, but had a family history for Hashimoto's thyroiditis. The first neurologic examination was positive for inconstant gait and balance abnormalities. Moreover, the patient reported paresthesia of the left side her body.
+
+During the first 24 hours following admission, we performed blood exams (blood count, electrolytes, creatinine, urea, glucose, bilirubin, aspartate aminotransferase, alanine aminotransferase, gamma glutamyl transpeptidase, albumin, cholesterol, triglycerides, lactate dehydrogenase, creatine phosphokinase, fibrinogen, thyrotropin, free thyroxin, free triiodothyronine, C 
+reactive protein), showing normal values. An electroencephalogram (EEG) showed alpha waves with anterior spreading and discontinuous sharp waves in the parietal and temporal regions on the right side of the brain. Brain magnetic resonance imaging (MRI) results were normal.
+
+Our first hypothesis was epilepsy, so we started treatment with carbamazepine (20 mg/kg/day), with a partial intensity and frequency reduction of the seizures.
+
+At 2 weeks after admission, the patient presented psychotic symptoms characterized by psychomotor agitation, fearfulness, and auditory/visual hallucinations with an intermittent course during the day. In addition, other clinical manifestations appeared, such as discuss autonomic disorders (lability of blood pressure, cold extremities, and pale skin), night insomnia, cognitive deterioration, and worsening of motor and language abilities, so the patient had prolonged bed rest. In this phase, a neurological examination showed mild dysmetria, dysdiadochokinesia, and dysfunctions of dynamic postural control and balance. Furthermore, epileptic seizures increased again in frequency, occurring as focal impaired awareness, focal motor movements, and/or generalized tonic-clonic seizures. 
+
+Carbamazepine was suspended on the 19th day of hospitalization due to the onset of thrombocytopenia and leukopenia and was changed to levetiracetam (17 mg/kg/day).
+
+Matera E. Et al:
+Autoimmune encephalitis and thyroid
+© Am J Case Rep, 2021; 22: e931104 e931104-2 Indexed in: [PMC] [PubMed] [Emerging Sources Citation Index (ESCI)]
+
+According to the modification of the patient's clinical conditions and the presence of epileptic seizures, psychomotor agitation and psychotic symptoms, an encephalitis syndrome was suspected. Microbiological [Herpes Simplex Virus (HSV) 1/2, Epstein-Barr Virus (EBV), Human Herpes Virus (HHV) 6, Rubella Virus, Cytomegalovirus (CMV), Varicella Zoster Virus (VZV), Measles Virus Immunoglobulins] and immunological blood evaluations [anti-nuclear Abs (ANA), anti-neutrophil cytoplasmic Abs (ANCA), extractable nuclear antigens (ENA) Abs, Rheumatoid Factor (RF), LG11 and CASPR2 potassium channels Abs, myelin-associated glycoprotein (MAG) Abs, gamma-amino butyric acid (GABA) receptor Abs] were performed. Based on the young age of the patient, the acute onset of the disease, and the anamnestic data, we did not perform tests searching for viral and bacterial agents responsible for encephalitis in advanced stage of infection such as HIV virus and Treponema pallidum. All listed blood investigation results were within normal ranges, except for anti-NMDAr Abs (titer 1: 3200), antiTG (110 IU/mL, normal range 15-60 UI/mL), and anti-TPO (203 IU/mL, normal range 28-60 UI/mL). Thy function was normal. 
+
+Cerebrospinal fluid (CSF) analysis revealed normal protein concentration, but the presence anti-NMDAr Abs. The diagnosis of anti-NMDArE was confirmed on the 18th day of hospitalization.
+
+Further blood and radiological exams were performed to exclude the paraneoplastic etiology of encephalitis: serum dosage of cancer antigen (CA)-125, carcino embryonic antigen (CEA), 
+a-fetoprotein and tissue polypeptide antigen (TPA), abdominopelvic, lymph nodes and thyroid ultrasound, positron emission tomography with fluorine-18 fluorodeoxyglucose (FDG 
+PET) of total body without evidence of tumors.
+
+According to the positivity for anti-NMDAr Abs in both the serum and CSF, the patient received intravenous immunoglobulin (IVIG, 
+0.4 g/kg/day) for 5 days, followed by high-dose methylprednisolone (1 g/day for 7 days, and then 0.5 g/day for 3 days), with no significant clinical improvement. A slow alleviation of encephalitis symptoms started only after she underwent the third session of plasma exchange (PLEX) (2 cycles with 5 sessions per cycle, on alternate days). At the same time, a decrease of serum level of anti-NMDAr Abs was found (titer 1: 320). At the time of hospital discharge, the patient showed only occasional language difficulties (comprehension and formulation of complete sentences), short memory impairment, and some buccal automatisms [modified Rankin Scale (mRS) [22] score passed from 4 to 2]. The anti-epileptic therapy with levetiracetam was confirmed.
+
+Later, the patient was followed up through close outpatient check-ups. After 12 months, she was admitted to the same hospital to re-perform clinical and instrumental tests. She showed full recovery of communicative and expressive ability, mild short-term memory difficulties, and a slight tendency to irritability. The neurologic examination revealed no focal signs.
+
+Blood exams still showed positivity for anti-NMDAr Abs (weak reactivity to titer 1.10) and decrease of anti-Thy Abs serum levels (TG Ab 12 IU/mL, TPO Ab < 9 IU/mL). Brain MRI, chest X-ray, abdominopelvic, and lymph nodes ultrasound were free of pathological signs. An EEG study showed slight excess of slow activity in the left temporal side of brain. Anti-epileptic therapy was confirmed.
+
+## Review Of Anti-Nmdare With Serum Anti-Thy Abs
+
+An electronic literature search was conducted for all articles published up to April 2020, with a range of databases searched including PubMed, Scopus, and Web of Science. The following combinations of keywords were used: "NMDAr/NMDA encephalitis", "Thyroid", "Thyroid Peroxidase/TPO", "Thyroglobulin/
+TG". Research articles, case reports, and reviews in free fulltext format and in English language were included.
+
+We identified 35 records through the database search; after removing duplicates, there were 24 records. As inclusion criteria, papers needed to provide enough information about thyroid involvement in non-paraneoplastic anti-NMDArE cases, so 6 publications were selected for inclusion in this review.
+
+## Discussion
+
+We described the case of an adolescent girl with a definite diagnosis of non-paraneoplastic anti-NMDArE and the coexistence of anti-TPO and anti-TG circulating Abs. The acute onset of epileptic seizures, psychotic symptoms, and abnormal speech and behavior and the progressive clinical worsening despite treatment with anti-epileptic and anti-psychotic drugs justified the Abs testing on CSF, confirming the diagnosis of anti-NMDArE. We observed good results with immunomodulatory therapy, with progressive improvement of clinical conditions and no episode of relapse over a 12-month follow-up.
+
+To our knowledge, this is one of the few cases reported in the literature of an autoimmune involvement of the thyroid gland concurrent with an anti-NMDArE. We know that Thy Abs are found in 10-12% of healthy populations [23], with different ranges according to age and sex [24], so the detection of anti-Thy Abs in patients with anti-NMDArE could be considered as an occasional finding. A recent retrospective cohort study of 517 patients with different types of antibody-positive autoimmune encephalitis (AE) showed that Hashimoto's thyroiditis was the most commonly diagnosed autoimmune comorbidity, with a frequency of 5.42%, opposed to 1% in the general population [25]. This finding supported the hypothesis, previously suggested by Tuzun et al [26], that patients with Thy Abs are inclined to develop anti-neuronal-immune response and acute idiopathic encephalitis. A literature search of patients e931104-3 Indexed in: [PMC] [PubMed] [Emerging Sources Citation Index (ESCI)]
+
+| Patients                                                                                                                 |               |                        |                                                                                                                                                                  |                                                                                           |                                                                    |
+|--------------------------------------------------------------------------------------------------------------------------|---------------|------------------------|------------------------------------------------------------------------------------------------------------------------------------------------------------------|-------------------------------------------------------------------------------------------|--------------------------------------------------------------------|
+| Authors                                                                                                                  | Type of       | Abs (type and          |                                                                                                                                                                  |                                                                                           |                                                                    |
+| (Number, sex,                                                                                                            | serum level)  | Therapy                | Outcome                                                                                                                                                          |                                                                                           |                                                                    |
+| study                                                                                                                    | age in years) |                        |                                                                                                                                                                  |                                                                                           |                                                                    |
+| Tuzun E et al                                                                                                            | Research      | 2, F,                  | TPO and TG                                                                                                                                                       | Steroids+ IVIG                                                                            |                                                                    |
+| (2011) [26]                                                                                                              | article       | 37 and 53              | >200 IU/mL                                                                                                                                                       | or PLEX or  Cyclophosphamide                                                              | Neurological improvement with return to  work and daily activities |
+| De Leu N et al                                                                                                           | Case          | 1, F, 16               | TPO >600 IU/mL                                                                                                                                                   | Methylprednisolone+                                                                       | After 3 days of corticoid administration,                          |
+| (2012) [27]                                                                                                              | report        | thyroidectomy          | gradual and complete neurological  relapse                                                                                                                       |                                                                                           |                                                                    |
+| Lu J et al                                                                                                               | Case          | 1, F, 36               | TPO 585 IU/mL                                                                                                                                                    | Methylprednisolone+                                                                       | Improvement of psychosis and                                       |
+| (2015) [28]                                                                                                              | report        | prednisone + PLEX      | hypersexuality. At about 5 months,  recurrence of Graves' disease (treated  with Methimazole and radioactive  iodine ablation) and subjective memory  impairment |                                                                                           |                                                                    |
+| Jung Y et al                                                                                                             | Case          | 1, F, 70               | TPO >3000 IU/mL                                                                                                                                                  | Steroids+ IVIG+                                                                           | Gradual improvement of confusional                                 |
+| (2016) [29]                                                                                                              | report        | TG 92.52 IU/mL         | Rituximab                                                                                                                                                        | mentality and psychiatric symptoms.  After 12 months complete resolution of  the symptoms |                                                                    |
+| Zhang W et al                                                                                                            | Research      | 1, F, 18               | TPO 58.43 IU/mL                                                                                                                                                  | Methylprednisolone+                                                                       | Partial recovery of psychological and                              |
+| (2017) [30]                                                                                                              | article       | TG 920.33 IU/mL        | IVIG                                                                                                                                                             | behavioral disorders (mRS score: 4) after  10 months                                      |                                                                    |
+| Wang X et al                                                                                                             | Case          | 1, F, 20               | TPO and TG (no                                                                                                                                                   |                                                                                           |                                                                    |
+| (2018) [31]                                                                                                              | report        | data on serum  levels) | Steroids+ IVIG                                                                                                                                                   | Marked improvement of mental status  without motor or behavioral abnormality              |                                                                    |
+| F - Female patient; TPO - thyroperoxidase antibodies; TG - thyroglobulin antibodies; IVIG - intravenous immunoglobulins; |               |                        |                                                                                                                                                                  |                                                                                           |                                                                    |
+
+F - Female patient; TPO - thyroperoxidase antibodies; TG - thyroglobulin antibodies; IVIG - intravenous immunoglobulins; PLEX - plasmapheresis.
+
+Table 1. Literature review on anti-NMDArE cases with serum anti-Thy Abs.
+
+with the co-occurrence of anti-NMDArE and increased level of serum anti-Thy Abs is presented in **Table 1** [26-31]. In particular, De Leu et al [27] and Lu J et al [28] described 2 patients with Graves' disease; the remaining 5 patients had variable and different titers for Anti-Thy Abs, ranging from 58 IU/mL to 3000 IU/mL for TPO and from 92 IU/mL to 920 IU/mL for TG. In addition, our patient had a family history of Hashimoto's thyroiditis.
+
+It should be noted that each anti-NMDArE case considered was the non-paraneoplastic form, as was the case we described. 
+
+Although anti-NMDArE is often categorized as a paraneoplastic syndrome, more frequently it is a non-paraneoplastic condition, especially in children [7]. The co-occurrence of both anti-NMDAr-Abs and Anti-TPO/Anti-TgG Abs in idiopathic forms of anti-NMDArE could suggest that T cell activation and the loss of immune self-tolerance, probably as a consequence of a complex interaction between genetic and environmental factors, could contribute to development of autoimmune disorders [25]. Juvenile age and female sex could be considered 2 adjunctive factors which increase the risk of auto-Abs production against both Thy and the brain.
+
+Our patient and the cases listed in the table were young women, with a mean age of 33.2 years. The high frequency of anti-NMDArE and autoimmune thyroiditis reported in reproductive age woman suggested that sex hormones could act as factors increasing risk to develop both of these autoimmune disorders [7,32].
+
+In addition, the pathogenetic role of anti-Thy Abs in AE, which has already been established for Hashimoto's encephalitis (HE), 
+should be considered. It would be better to classify HE as a probable AE [33], because the underlying pathogenetic mechanism of HE is currently not clear. In fact, the theory that selfAbs against neural antigens cross-reacts with Thy antigens as the pathogenetic basis of HE needs further investigation. The following pathogenetic mechanisms have been suggested: a) 
+a shared target antigen between the thyroid gland and central nervous system; b) a neurotoxic effect of Thy hormones and Abs interference on neurotransmission; c) an effect of other Abs as enolases, dimethylargininase-I, aldehyde reductase-I, myelin-oligodendrocyte glycoprotein, gangliosides, and a few onco-neuronal antigens; and d) a consequence of vasculitic processes, primary demyelination, and immune complex-mediated processes [34]. Because of these considerations, we are not e931104-4 Indexed in: [PMC] [PubMed] [Emerging Sources Citation Index (ESCI)]
+
+able to exclude a direct effect of anti-Thy Abs on the brain or a second autoimmune mechanism in some patients with presumed HE. According to the diagnostic criteria for AE, if antiThy Abs and anti-neuronal Abs exist simultaneously, AE should be diagnosed with priority. Otherwise, before diagnosing HE, anti-neuronal Abs should be detected to avoid misdiagnosis. In line with these considerations, the case we reported had a definite diagnosis of anti-NMDArE with associated detection of anti-Thy Abs of unclear significance. The hypothesis that the association between anti-NMDAr and anti-Thy Abs could be suggestive of a co-shared pathogenetic mechanism of autoimmune encephalitis needs more intensive investigation.
+
+We know of no specific clinical phenotype to discriminate NMDArE with serum anti-Thy Abs from no-serum Thy Abs ones. Guan et al [35], studying the clinical NMDArE evolution in several female patients, explored the hypothesis that the presence of serum anti-Thy Abs and their titers could predict a shorter disease duration and a better treatment response [36-38]. Because very little is known about this topic, further studies are required to determine the utility of anti-Thy Abs titers predicting clinical manifestations, prognosis, and eventual relapses [39]. Anti-NMDArE is certainly a severe disease in which the prognosis remains obscure, but early diagnosis and intervention could reduce the incidence of complications and relapses.
+
+## Conclusions
+
+The case we reported showed a classic presentation of antiNMDArE, but with the presence of anti-Thy Abs. To date, the coexistence of anti-NMDAr Abs and anti-Thy Abs is still unclear. The detection of high titers of anti-TG and anti-TPO in an adolescent female with anti-NMDArE and a positive family history for Hashimoto's thyroiditis we described, together with previous evidence reported by other authors, suggests the hypothesis that this association cannot be just occasional. 
+
+Further studies about these mechanisms are needed to determine if anti-Thy Abs has a pathogenetic role in the context of idiopathic anti-NMDArE. Moreover, it would be useful for clinical practice to clarify, through longitudinal studies on a larger number of patients, whether the presence of anti-thyroid antibody can characterize the clinical course, prognosis, and response to treatment of the idiopathic type of anti-NMDArE.
+
+## Acknowledgments
+
+The authors would like to thank the patient and her family.
+
+## Department And Institution Where Work Was Done
+
+Child Neuropsychiatric Unit, Department of Basic Medical Sciences Neurosciences and Sense Organs, University Hospital of Bari, Italy.
+
+## Conflict Of Interests
+
+None.
+
+e931104-5 Indexed in: [PMC] [PubMed] [Emerging Sources Citation Index (ESCI)]
+
+## References:
+
+1. Dalmau J, Tuzun E, Wu H, et al. Paraneoplastic anti-N-methyl-D-aspartate receptor encephalitis associated with ovarian teratoma. Ann Neurol. 
+
+2007;61(1):25-36 2. Dalmau J, Lancaster E, Martinez-Hernandez E, et al. Clinical experience and laboratory investigations in patients with anti-NMDAR encephalitis. Lancet Neurol. 2011;10(1):63-74 3. Florance NR, Davis RL, Lam C, et al. Anti-N-methyl-D-aspartate receptor (NMDAR) encephalitis in children and adolescents. Ann Neurol. 
+
+2009;66(1):11-18 4. Granerod J, Ambrose HE, Davies NWS, et al. Causes of encephalitis and differences in their clinical presentations in England: A multicentre, population-based prospective study. Lancet Infect Dis. 2010;10(12):835-44 5. Shi YC, Chen XJ, Zhang HM, et al. Anti-N-methyl-D-aspartate receptor 
+(NMDAR) encephalitis during pregnancy: Clinical analysis of reported cases. Taiwan J Obstet Gynecol. 2017;56(3):315-19 6. Gurrera RJ. Recognizing psychiatric presentations of anti-NMDA receptor encephalitis in children and adolescents: A synthesis of published reports. Psychiatry Clin Neurosci. 2019;73(5):262-68 7. Lazar-Molnar E, Tebo AE. Autoimmune NMDA receptor encephalitis. Clin Chim Acta. 2015;438:90-97 8. Graus F, Titulaer MJ, Balu R, et al. A clinical approach to diagnosis of autoimmune encephalitis. Lancet Neurol. 2016;15(4):391-404 9. Dalmau J, Gleichman AJ, Hughes EG, et al. Anti-NMDA-receptor encephalitis: Case series and analysis of the effects of antibodies. Lancet Neurol. 
+
+2008;7(12):1091-98 10. Scheer S, John RM. Anti-N-methyl-D-aspartate receptor encephalitis in children and adolescents. J Pediatr Heal Care. 2016;30(4):347-58 11. Leypoldt F, Titulaer MJ, Aguilar E, et al. Clinical/Scientific Notes: Herpes simplex virus-1 encephalitis can trigger anti-nmda receptor encephalitis: Case report. Neurology. 2013;81(18):1637-39 12. Armangue T, Titulaer MJ, Málaga I, et al. Pediatric anti-N-methyl-D-aspartate receptor encephalitis - Clinical analysis and novel findings in a series of 20 patients. J Pediatr. 2013;162(4):850-56 13. Dabner M, McCluggage WG, Bundell C, et al. Ovarian teratoma associated with anti-n-methyl D-aspartate receptor encephalitis: A report of 5 cases documenting prominent intratumoral lymphoid infiltrates. Int J Gynecol Pathol. 2012;31(5):429-37 14. Zandi MS, Irani SR, Follows G, et al. Limbic encephalitis associated with antibodies to the nmda receptor in hodgkin lymphoma. Neurology. 
+
+2009;73(23):2039-40 15. Padma S, Sundaram PS, Marmattom BV. PET/CT in the evaluation of antiNMDA-receptor encephalitis: What we need to know as a NM physician. 
+
+Indian J Nucl Med. 2011;26(2):99-101 16. Eker A, Saka E, Dalmau J, et al. Testicular teratoma and anti-N-methyl-Daspartate receptor-associated encephalitis. J Neurol Neurosurg Psychiatry. 
+
+2008;79(9):1082-83 17. Leypoldt F, Armangue T, Dalmau J. Autoimmune encephalopathies. Ann NY 
+Acad Sci. 2015;1338(1):94-114 18. Frunza-Stefan S, Whitlatch HB, Rao GG, Malek R. Unusual case of anti-Nmethyl-D-aspartic acid-receptor (NMDA-R) encephalitis and autoimmune polyglandular syndrome (APS). BMJ Case Rep. 2018;2018:bcr2018224821 19. Lai M, Hughes EG, Peng X, et al. AMPA receptor antibodies in limbic encephalitis alter synaptic receptor location. Ann Neurol. 2009;65(4):424-34 20. Lancaster E, Lai M, Peng X, et al. Antibodies to the GABAB receptor in limbic encephalitis with seizures: case series and characterisation of the antigen. Lancet Neurol. 2010;9(1):67-76 21. Khoodoruth MAS, Chut-kai Khoodoruth WN, Alshawwaf MKM. Anti-Nmethyl-D-aspartate receptor encephalitis in a young female with subclinical hypothyroidism associated with anti-thyroid peroxidase and anti-thyroglobulin antibodies: A case report. SAGE Open Med Case Reports. 
+
+2020;8:2050313X20949780 22. Rankin J. Cerebral vascular accidents in patients over the age of 60. I. General considerations. Scott Med J. 1957;2(4):127-36 23. Vanderpump MPJ. The epidemiology of thyroid disease. Br Med Bull. 
+
+2011;99:39-51 24. Zöphel K, Saller B, Wunderlich G, et al. Autoantibodies to thyroperoxidase 
+(TPOAb) in a large population of euthyroid subjects: Implications for the definition of TPOAb reference intervals. Clin Lab. 2003;49(11-12):591-600 25. Zhao J, Wang C, Xu X, et al. Coexistence of autoimmune encephalitis and other systemic autoimmune diseases. Front Neurol. 2019;10:1142 26. Tüzün E, Erdağ E, Durmuş H, et al. Autoantibodies to neuronal surface antigens in thyroid antibody-positive and-negative limbic encephalitis. Neurol India. 2011;59(1):47-50 27. De Leu N, Unuane D, Poppe K, Velkeniers B. Seizures and postictal stupor in a patient with uncontrolled Graves' hyperthyroidism. BMJ Case Rep. 2012;2012: bcr0220125929 28. Lu J, Samson S, Kass J, Ram N. Acute psychosis in a pregnant patient with Graves' hyperthyroidism and anti-NMDA receptor encephalitis. BMJ Case Rep. 2015; 2015: bcr2014208052 29. Jung Y, Park S, Son H-J, et al. Thyroid autoantibody positive anti-N-methyl-D-aspartate receptor encephalitis. Dement Neurocognitive Disord. 
+
+2016;15(1):24-27 30. Zhang W, Yan L, Jiao J. Repeated misdiagnosis of a relapsed atypical anti-NMDA receptor encephalitis without an associated ovarian teratoma. 
+
+Neurosci Lett. 2017;638:135-38 31. Wang X, Lai Y, Li P, Zhou K, Che G. Massive idiopathic spontaneous hemothorax complicating anti-N-methyl-d-aspartate receptor encephalitis: A case report. Medicine (Baltimore). 2018;97(45):e13188 32. Ministero della salute. Patologie al femminile/Malattie autoimmuni. c2016 
+[cited 2016 Apr 21]. *https://salute.gov.it/home/Argomenti-Patologie al* femminile/Malattie autoimmune [in Italian]
+33. Walikonis JE, Lennon VA. Radioimmunoassay for glutamic acid decarboxylase (GAD65) autoantibodies as a diagnostic aid for stiff-man syndrome and a correlate of susceptibility to type 1 diabetes mellitus. Mayo Clin Proc. 1998;73(12):1161-66 34. Churilov LP, Sobolevskaia PA, Stroev YI. Thyroid gland and brain: Enigma of Hashimoto's encephalopathy. Best Pract Res Clin Endocrinol Metab. 2019;33(6):101364 35. Guan W, Fu Z, Zhang H, et al. Non-tumor-associated anti-N-methyl-d-aspartate (NMDA) receptor encephalitis in Chinese girls with positive antithyroid antibodies. J Child Neurol. 2015;30(12):1582-85 36. Schiess N, Pardo CA. Hashimoto's encephalopathy. Ann NY Acad Sci. 
+
+2008;1142:254-65 37. Chong JY, Rowland RDU. Hashimoto encephalopathy: Syndrome or myth? 
+
+Arch Neurol. 2003;60(2):164-71 38. Litmeier S, Prüss H, Witsch E, Witsch J. Initial serum thyroid peroxidase antibodies and long-term outcomes in SREAT. Acta Neurol Scand. 
+
+2016;134(6):452-57 39. Lee J, Yu HJ, Lee J. Hashimoto encephalopathy in pediatric patients: 
+Homogeneity in clinical presentation and heterogeneity in antibody titers. Brain Dev. 2018;40(1):42-48 e931104-6 Indexed in: [PMC] [PubMed] [Emerging Sources Citation Index (ESCI)]

medical/md/PMC8201929.md

@@ -0,0 +1,262 @@
+# Mitochondrial Apoptotic Priming Is A Key Determinant Of Cell Fate Upon P53 Restoration
+
+Francisco J. Sánchez-Riveraa,b,1,2, Jeremy Ryanc,2, Yadira M. Soto-Felicianoa,b,3, Mary Clare Beytagha,b, Lucius Xuana, David M. Feldserd, Michael T. Hemanna,b, Jesse Zamudioe, Nadya Dimitrovaf, Anthony Letaic,g,h,4, and Tyler Jacksa,b,i,4 aDavid H. Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02142; bDepartment of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142; cDana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02215; dDepartment of Cancer Biology, Abramson Family Cancer Research Institute, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104; eDepartment of Molecular, Cell, and Developmental Biology, University of California, Los Angeles, CA 90095; fDepartment of Molecular, Cellular, and Developmental Biology, Yale University, New Haven, CT 06511; gLaboratory of Systems Pharmacology, Harvard Medical School, Boston, MA 02115; hBroad Institute, Cambridge, MA 02115; and iHHMI, Massachusetts Institute of Technology, Cambridge, MA 02139 Contributed by Tyler Jacks, April 23, 2021 (sent for review September 19, 2020; reviewed by Laura D. Attardi and Karen H. Vousden)
+Reactivation of p53 in established tumors typically results in one of two cell fates, cell cycle arrest or apoptosis, but it remains unclear how this cell fate is determined. We hypothesized that high mitochondrial priming prior to p53 reactivation would lead to apoptosis, while low priming would lead to survival and cell cycle arrest. Using a panel of Kras-driven, p53 restorable cell lines derived from genetically engineered mouse models of lung adenocarcinoma and sarcoma (both of which undergo cell cycle arrest upon p53 restoration), as well as lymphoma (which instead undergo apoptosis), we show that the level of mitochondrial apoptotic priming is a critical determinant of p53 reactivation outcome.
+
+Cells with high initial priming (e.g., lymphomas) lacked sufficient reserve antiapoptotic capacity and underwent apoptosis after p53 restoration. Forced BCL-2 or BCL-XL expression reduced priming and resulted in survival and cell cycle arrest. Cells with low initial priming (e.g., lung adenocarcinoma and sarcoma) survived and proceeded to arrest in the cell cycle. When primed by inhibition of their antiapoptotic proteins using genetic (BCL-2 or BCL-XL deletion or BAD overexpression) or pharmacologic (navitoclax) means, apoptosis resulted upon p53 restoration in vitro and in vivo. These data demonstrate that mitochondrial apoptotic priming is a key determining factor of cell fate upon p53 activation. Moreover, it is possible to enforce apoptotic cell fate following p53 activation in less primed cells using p53-independent drugs that increase apoptotic priming, including BH3 mimetic drugs.
+
+p53 | apoptosis | cell cycle arrest | cell fate The most commonly mutated tumor-suppressor gene is TP53, with ∼50% of human cancers harboring mutations in this locus
+(1). The remaining 50% of human cancers typically harbor mutations that inactivate the p53 pathway, usually through down-regulation or mutation of its main upstream activator p14Arf (p19Arf in mice),
+or genomic amplification or overexpression of its main negative regulator Mdm2 (2). As a consequence, great effort has been placed on elucidating p53's properties in tumor suppression and drug response.
+
+Upon activation by a variety of stress signals, such as DNA
+damage, oncogenic stress, and hypoxia, p53 transcriptionally activates a large repertoire of genes. This can lead to a variety of outcomes, ranging from cell cycle arrest, senescence, or apoptosis, to changes in metabolism and autophagy, among others (3–5).
+
+Due to the prevalence of inactivating mutations in p53, recent efforts have focused on strategies to pharmacologically reactivate mutant p53 as a possible option for treating human cancers that harbor p53 mutations (6). This concept has been supported by experiments in genetically engineered mouse models (GEMMs) of cancer (7–10). We previously employed a GEMM with temporal control of p53 expression in established, autochthonous tumors.
+
+This mouse model expresses a Lox-STOP-Lox (LSL)-p53 allele in the germline (9). Homozygous mutant mice (p53LSL/LSL)
+
+![0_image_0.png](0_image_0.png)
+
+are phenotypically identical to homozygous knockout mice
+(p53−/−) (11, 12). However, upon induction of Cre recombinase
+[which in this case is expressed from the ubiquitously expressed Rosa26 locus (13) as an estrogen receptor fusion protein called Cre-ERT2]
+and excision of the LSL cassette, p53 transcription is restored.
+
+Utilizing this immunocompetent mouse model, our group demonstrated
+
+## Significance
+
+It has long been observed that activation of p53 can yield two main cell fates: either apoptotic cell death or cell cycle arrest.
+
+However, what determines this cell fate remains to be fully elucidated. Here we show that the state of mitochondrial priming prior to activation of p53 can determine cell fate. Highly primed cells commit to apoptosis, while less-primed cells commit to cell cycle arrest. We show that modulation of priming in either direction can alter cell fate; increasing priming in poorly primed cells yields apoptosis, while decreasing priming in highly primed cells yields arrest. Drugs that increase priming enforce an apoptotic fate, suggesting a p53-independent strategy for augmenting efficacy of cancer chemotherapy drugs that kill via p53.
+
+Author contributions: F.J.S.-R., J.R., A.L., and T.J. designed research; F.J.S.-R., J.R., Y.M.S.-F.,
+M.C.B., and L.X. performed research; F.J.S.-R., J.R., D.M.F., M.T.H., J.Z., and N.D. contributed new reagents/analytic tools; F.J.S.-R., J.R., J.Z., N.D., and T.J. analyzed data; and F.J.S.-R., J.R., A.L., and T.J. wrote the paper. Reviewers: L.D.A., Stanford University; and K.H.V., Francis Crick Institute.
+
+Competing interest statement: A.L. discloses consulting and sponsored research agreements with AbbVie, Novartis, and Astra-Zeneca. He serves on the Scientific Advisory Board of Flash Therapeutics, Dialectic Therapeutics, and Zentalis Pharmaceuticals. The following are US Patents regarding BH3 profiling owned by Dana-Farber: 10,393,733; 9,902,759; 9, 856,303; 9,540,674; 8,221,966; and 7,868,133. A.L. and J.R. are inventors on patent applications US20180128813A1 and US20180120297A1 held/submitted by the Dana-Farber Cancer Institute that covers high-throughput BH3 profiling. T.J. is a member of the Board of Directors of Amgen and Thermo Fisher Scientific. He is also a cofounder of Dragonfly Therapeutics and T2 Biosystems. T.J. serves on the Scientific Advisory Board of Dragonfly Therapeutics, SQZ Biotech, and Skyhawk Therapeutics. None of these affiliations represent a conflict of interest with respect to the design or execution of this study or interpretation of data presented in this report. T.J.'s laboratory currently also receives funding from the Johnson & Johnson Lung Cancer Initiative and The Lustgarten Foundation for Pancreatic Cancer Research, but this funding did not support the research described in this report.
+
+This open access article is distributed under Creative Commons Attribution-NonCommercialNoDerivatives License 4.0 (CC BY-NC-ND).
+
+1Present address: Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, New York, NY 10065.
+
+2F.J.S.-R. and J.R. contributed equally to this work.
+
+3Present address: Laboratory of Chromatin Biology & Epigenetics, The Rockefeller University, New York, NY 10065.
+
+4To whom correspondence may be addressed. Email: anthony_letai@dfci.harvard.edu or tjacks@mit.edu.
+
+This article contains supporting information online at https://www.pnas.org/lookup/suppl/
+doi:10.1073/pnas.2019740118/-/DCSupplemental.
+
+Published May 31, 2021.
+
+![1_image_0.png](1_image_0.png) 
+that established tumors that spontaneously arise in the context of p53 deficiency (mostly soft tissue sarcomas and lymphomas) (11, 12) remain exquisitely sensitive to the reactivation of p53 (9).
+
+Notably, two contemporary studies by Evan and colleagues (8)
+and Lowe and colleagues (10) reached the same conclusion using estrogen receptor-regulatable systems and inducible-reversible RNAi technologies, respectively.
+
+In a subsequent study, our group crossed the p53 restorable mouse to the KrasLA2 mouse model, which bears a latent allele of oncogenic KrasG12D that gets spontaneously activated in vivo
+(14), for the purposes of studying the effects of p53 reactivation in established lung tumors (7). Surprisingly, we found that the tumor-suppressive effects of p53 reactivation in established lung tumors growing in immunocompetent mice are stage-specific, whereby p53 triggers the elimination of highly advanced lesions but spares low-grade lesions. Mechanistically, high-grade lesions harbor hyperactive MAPK signaling, which in turn leads to potent induction of the p19Arf tumor-suppressor gene, leading to stabilization and activation of the p53 tumor suppressor (7). A
+contemporaneous study by Evan and colleagues (15) using an estrogen receptor-regulatable allele of p53 reached the same conclusion. More recently, Lowe and colleagues (16) demonstrated that p53 reactivation in advanced pancreatic ductal adenocarcinoma tumors leads to a combination of cell cycle arrest, senescence, and differentiation. Collectively, these GEMM-based studies have convincingly demonstrated that p53 can mediate different tumor-suppressive responses in different tumor types and even at different stages of tumor progression, and lend strong support to efforts aimed at pharmacologically reactivating p53 as a possible cancer therapeutic strategy (6).
+
+Despite the fact that p53 has been extensively studied for over 30 y, the molecular mechanisms behind its highly context-specific tumor-suppressive responses remain widely unknown (17). Many models have focused on the quality, quantity, and dynamics of the p53 transcriptional response as determinants of cell fate (18).
+
+In these models, increased intensity of p53 activation and transcription induction promotes apoptotic cell fate.
+
+Pretreatment mitochondrial apoptotic priming can determine cell fate in response to a number of drugs, including those that can kill in a p53-dependent fashion (19–21). This prompted us to ask whether the level of mitochondrial apoptotic priming in a cell dictates whether p53 reactivation promotes cell death or cell cycle arrest. To answer this question, we made use of the restorable p53 allele that we have used previously in GEMMs to give a uniform p53 signal in the setting of different levels of mitochondrial apoptotic priming. Our results support a model in which the level of mitochondrial apoptotic priming is a critical cell-autonomous determinant of cell fate upon p53 restoration.
+
+## Results
+
+Tumor-Specific Responses to p53 Restoration. We hypothesized that tumor-specific responses to p53 restoration could be explained at least in part by the level of mitochondrial priming on each specific tumor type. Based on our model, we predicted that highly primed cells would readily undergo apoptosis upon p53 restoration, but poorly primed cells would instead undergo cell cycle arrest. To test this, we derived cell lines from three different tumor types
+
+![2_image_0.png](2_image_0.png)
+
+(lung adenocarcinoma, sarcoma, and lymphoma) that arose spontaneously in KrasLA2/+;Trp53LSL/LSL;Rosa26CreERT2/CreERT2 mice
+(7). These mice harbor a KrasLA2 allele, which leads to spontaneous expression of the KrasG12D oncogene (14), as well as two LSL p53 alleles (9), which prevent expression of endogenous p53 and phenocopy p53-deficient mice. Cell lines derived from these tumors also express CreERT2, which allows for inducible Cre activity upon the addition of 4-hydroxytamoxifen (4-OHT), leading to excision of the STOP cassette upstream of Trp53, thereby restoring wild-type p53 expression (Fig. 1A). Although they all share the same genetic background, these cells experience two nonoverlapping cell fates upon p53 restoration (Fig. 1 B–J). Lung adenocarcinoma and sarcoma cell lines predominantly undergo cell cycle arrest, as shown by: 1) robust induction of p21 expression (Fig. 1 B and E), 2)
+significant accumulation of p53-restored cells in the G0/G1 stage of the cell cycle (Fig. 1 C and F), 3) pronounced tumor stasis upon restoration of p53 in established tumors in vivo (Fig. 1 D and G),
+and 4) marked absence of cleaved caspase 3 (CC3), even after prolonged restoration of p53 for 72 h (Fig. 1 B and E). Remarkably, lymphoma cells also exhibit robust and stable up-regulation of p21 upon p53 restoration (Fig. 1H) but fail to undergo cell cycle arrest. Instead, p53 restoration in lymphoma cells leads to robust apoptosis, as indicated by induction of CC3, annexin V staining, and propidium iodide staining over time (Fig. 1 H–J). These data demonstrate that the initiation of cell cycle arrest signaling does not prevent the induction of apoptosis, as all three cell types are fully capable of initiating cell cycle arrest signaling upon p53 restoration, but only lymphoma cells undergo apoptosis. We next asked, what determines whether apoptosis will or will not occur upon p53 restoration?
+
+The Level of Mitochondrial Apoptotic Priming Explains Tumor-Specific Responses. It is known that both normal and malignant tissues have different propensities toward apoptosis and sensitivity to chemotherapy based on their mitochondrial apoptotic priming
+(20, 22). Therefore, we asked whether differences in mitochondrial apoptotic priming could account for the differences in cell fate upon p53 restoration. We first measured the degree of mitochondrial priming in the cell lines before p53 restoration. To do this, we used BH3 profiling, a technique that interrogates the mitochondria using synthetic peptides based on proapoptotic BH3-only proteins (23–25). The degree of mitochondrial apoptotic priming is inversely related to the quantity of BH3 peptide required to exceed the threshold for mitochondrial outer membrane permeabilization (MOMP). When the apoptotic threshold is exceeded, proteins BAX and BAK can oligomerize to form pores on the outer mitochondrial membrane, leading to MOMP. BH3 profiling employs surrogate markers, including cytochrome c release or mitochondrial potential, to measure MOMP. The less peptide needed to cause MOMP, the more primed the cells are for apoptosis.
+
+BH3 profiling of multiple cell lines per tissue of origin demonstrated a clear difference between those cell lines fated to cell cycle arrest and those that undergo apoptosis. Sarcoma and lung adenocarcinoma cell lines showed far lower priming across all peptides (Fig. 2A). Using the broadly interacting BIM peptide as a global measure of priming (23), sarcoma and lung adenocarcinoma cell lines were not significantly different from each other, but both were significantly less primed than lymphoma cell lines
+(Fig. 2B). We hypothesized that while lung adenocarcinoma and sarcoma cell lines survive following p53 induction, they nonetheless were able to initiate apoptotic signaling. To test this, we examined mitochondrial priming in the lung adenocarcinoma and sarcoma cell lines during p53 restoration. Regardless of tissue of origin, priming increased in a time-dependent manner upon p53 restoration (Fig. 2 C and D and SI Appendix, Fig. S1).
+
+This suggests that increased priming is a general effect of p53 restoration, but that only cells with high enough initial priming are forced to commit to apoptosis by such signaling. Cells that begin with low priming would still experience p53-dependent increased priming, but because priming levels stay below a critical threshold, cell cycle arrest dominates over apoptosis. If this were true, modification of priming would be expected to alter cell fate upon p53 restoration.
+
+Increasing Priming Is Sufficient to Switch Lung Adenocarcinoma and Sarcoma Cell Fate to Apoptosis. If basal priming levels determine whether cells can survive the increase in priming caused by p53 restoration, then increasing the priming of lung adenocarcinoma and sarcoma cells should change their fate from cell cycle arrest to apoptosis. We used multiple experimental approaches to test this hypothesis. First, we genetically ablated the antiapoptotic CELL BIOLOGY
+
+![3_image_0.png](3_image_0.png)
+
+protein BCL-XL in lung adenocarcinoma cells using CRISPRCas9 (26) to test whether its deletion would increase the basal level of mitochondrial apoptotic priming in these poorly primed cells. Indeed, BH3 profiling of cells lacking BCL-XL (Fig. 3A) demonstrated a clear increase in global priming (Fig. 3 B and C).
+
+Restoration of p53 led to a robust increase in CC3 and a decrease in cell viability in cells lacking BCL-XL but not in the parental line (Fig. 3 D and E and SI Appendix, Fig. S2). Similarly, CRISPR-mediated deletion of BCL-XL in sarcoma cells resulted in increased priming levels comparable to those observed in lung adenocarcinoma (SI Appendix, Fig. S3 A–C), and knockdown of either BCL-2 or BCL-XL was sufficient for p53 restored cells to show cleavage of caspase 3, indicating they were undergoing apoptosis (SI Appendix, Fig. S3D). Thus, increasing initial mitochondrial apoptotic priming was sufficient to bias cells toward apoptosis upon additional apoptotic priming due to p53 restoration.
+
+Although a useful proof-of-concept, genetic ablation of antiapoptotic proteins cannot be applied to a patient. However, small-molecule BH3-mimetic drugs are now available, including ABT-263 (navitoclax), which is a dual BCL-2/BCL-XL antagonist that binds in the BH3-binding pocket of these antiapoptotic proteins and competes for binding with proapoptotic BCL-2 family members (27). Addition of ABT-263 to lung adenocarcinoma and sarcoma cell lines increased their priming (Fig. 4 A, B, D, and E)
+in a similar manner to deletion of BCL-XL. While ABT-263 by itself was unable to induce apoptosis, restoring p53 in the presence of ABT-263 resulted in robust induction of apoptosis, as measured by nuclear fragmentation and an increase in the sub-G1 fraction
+(Fig. 4 C and F). Therefore, the addition of BH3 mimetics to therapeutic p53 reactivation or induction strategies may sensitize tumors that would otherwise undergo cell cycle arrest, raising the possibility that combining these pharmacological agents with drugs like MDM2 inhibitors in cases of wild-type p53 tumors might increase tumor apoptosis.
+
+To test this hypothesis in vivo, we engineered sarcoma cells to overexpress the BH3-only sensitizer protein Bad (Fig. 5A) (28).
+
+We confirmed that while Bad overexpression by itself was insufficient to cause cell death (SI Appendix, Fig. S4), it nonetheless led to a measurable increase in the levels of mitochondrial apoptotic priming prior to p53 restoration (Fig. 5B). We then injected these cells subcutaneously into immunodeficient (nude)
+mice and after 2 wk of growth restored of p53 function (Fig. 5C).
+
+Remarkably, restoration of p53 in established sarcomas resulted in robust cell death as gauged by a substantial increase in the number of cleaved caspase 3+ cells compared to nonrestored cells or cells expressing empty vector (Fig. 5D). Collectively, these data demonstrate that altering the levels of mitochondrial apoptotic priming in tumors is sufficient to alter the fate of tumor cells in vivo upon p53 reactivation.
+
+Reduction of Priming in Lymphoma Is Sufficient to Bias Cells Away from Apoptosis and toward Cell Cycle Arrest. If our hypothesis were correct and the fate of cells upon p53 restoration depends on the initial level of mitochondrial priming, then it might be possible to change the fate of lymphoma cells by reducing their priming so that priming is more like that of adenocarcinoma and sarcoma.
+
+To test this, we engineered lymphoma cells to overexpress the antiapoptotic protein BCL-XL (Fig. 6A). Expression of BCL-XL
+was sufficient to reduce mitochondrial priming in lymphoma cells
+(Fig. 6 B and C). This decrease in mitochondrial apoptotic priming
+
+![4_image_0.png](4_image_0.png)
+
+was sufficient to switch the fate of lymphoma cells upon p53 restoration, as demonstrated by the absence of CC3 (Fig. 6A) and a significant decrease in the percentage of annexin V+ cells to levels comparable to p53-null cells (Fig. 6D). These cells were now able to survive p53 restoration and demonstrated a statistically significant smaller S-phase population and a build-up of cells in G0/G1 (Fig. 6E), suggesting that the cell cycle arrest program is functionally engaged upon p53 restoration and only becomes apparent when apoptosis is no longer eliminating the cells.
+
+## Discussion
+
+Using a set of defined GEMM-derived p53 restorable lung adenocarcinoma, sarcoma, and lymphoma cell lines in combination with BH3 profiling, we have demonstrated that the level of mitochondrial apoptotic priming is a critical determinant of cell fate in the context of p53 restoration in vitro and in vivo. We further show that modulation of mitochondrial apoptotic priming via genetic or pharmacological means is sufficient to change cell fate upon p53 restoration: increasing priming enforces an apoptotic cell fate, whereas decreasing priming enforces cell cycle arrest.
+
+In considering the adoption of cell fates after p53 activation, one can consider whether commitment to cell cycle arrest or apoptosis is first adjudicated. If arrest were adjudicated first, then manipulation of apoptotic signaling would not affect the proportion of cells undergoing cell cycle arrest. However, our data show that we can affect the proportion of cells that undergo cell cycle arrest simply by manipulating apoptotic signaling (Fig. 7A). Specifically, we show that increasing priming can decrease the proportion of cells that undergo cell cycle arrest, whereas decreasing priming can increase this proportion. Therefore, our data suggest that one could in principle order the adjudication of fates, with apoptosis first being adjudicated followed by cell cycle arrest.
+
+The issue of apoptotic priming and cell fate after p53 activation has previously arisen in a different context. Bowen et al. (18)
+used BH3 profiling to show that two different cell types, human neural crest cells (hNCC) and early smooth muscle cells, exhibited similar mitochondrial apoptotic priming. Nonetheless, when p53 was activated, either with Nutlin 3A or with doxorubicin, hNCCs exhibited a greater propensity to adopt an apoptotic cell fate. They went on to show that this was related to a significantly greater transcriptional induction of p53-driven genes in the case of the apoptosis-driven hNCC cells. Thus, in this case, the different cell fates seemed better attributed to differential magnitude of p53 activation rather than differential priming, which has also been observed in other contexts (29).
+
+In our experiments, we instead compared cells with different priming and very similar postactivation p53 levels and signaling intensity as gauged by protein levels of p21 (encoded by the Cdkn1a gene) and gene-expression levels of several direct and indirect p53 targets (SI Appendix, Figs. S5 and S6). We do not consider our results incompatible with those of Bowen et al. (18).
+
+Instead, a parsimonious model would take into account both preactivation apoptotic priming, as well as the intensity of the p53 signal that follows induction. That is, one can imagine two cells with similar priming adopting different cell fates if they are exposed to different magnitudes of p53 proapoptotic transcription induction, with the cell enduring more signaling more likely to adopt an apoptotic cell fate. Similarly, two cells enduring similar magnitudes of p53 proapoptotic transcription induction would adopt different cell fates if their preactivation apoptotic priming were different, with the more primed cell more likely to adopt an apoptotic cell fate. We note, in fact, that in a developmental context, cell fate following the p53-dependent response to DNAdamaging agents has been related to differential apoptotic priming (21). The relation among cell fate (F), priming (P), and p53 activation (A) might hence be considered analogous to the equation CELL BIOLOGY
+
+![5_image_0.png](5_image_0.png)
+
+(5′-G CCCAGCTTCACATAACCCCA-3′), where the G in bold was added for ensuring appropriate U6 transcription. Bcl-2 and Bcl-xL knockdown cell lines were generated using MSCV-LTR-MIR30-SV40-GFP (MLS) retroviral vectors (33) expressing potent validated short-hairpin RNA (34, 35). BclxL and Bad overexpressing cell lines were generated using pMIG-Bcl-XL
+(Addgene, \#8790) and pMIG-Bad (Addgene, \#8787) retroviral constructs, respectively (28). The pMIG-Empty retroviral construct (Addgene, \#9044)
+was used as control. Retroviral particles were generated and packaged using Phoenix cell system (G. Nolan, Stanford University, Stanford, CA).
+
+![6_image_0.png](6_image_0.png)
+
+Fig. 7. The fate of p53 restored cells depends on mitochondrial apoptotic priming. (A) Model depicting a scenario in which increasing mitochondrial apoptotic priming decreases the proportion of cells that undergo cell cycle arrest, whereas decreasing priming would increase this proportion. Diagram created with BioRender.com. (B) Pharmacological priming of cancer cells is sufficient to switch cell fate upon p53 restoration: I, Poorly primed sarcoma and lung adenocarcinoma cells increase mitochondrial priming in response to p53 restoration but do not reach the threshold of apoptosis; II, dual inhibition of BCL-XL and BCL-2 by navitoclax increases mitochondrial priming such that additional priming by p53 restoration crosses the apoptotic threshold; III, lymphoma cells have higher basal mitochondrial priming, and additional p53 induced priming is sufficient to cross the apoptotic threshold; IV, reduction of basal mitochondrial priming by expression of an antiapoptotic protein is sufficient to block p53-restored cells from crossing the apoptotic threshold and instead leads to cell cycle arrest and senescence.
+
+Cells were maintained in DMEM (lung adenocarcinoma and sarcoma cell lines) or IMDM (lymphoma cell lines) supplemented with 10% fetal bovine serum and gentamicin. For p53 restoration experiments, 4-hydroxy-tamoxifen
+(Sigma) was added at a final concentration of 250 to 500 nM for a total of 72 h. Antibodies. The following antibodies were used for Western blotting experiments:
+anti–Bcl-xL (CST, \#2764; 1:1,000), anti-p53 (Novocastra, NCL-p53-505; 1:1,000),
+anti-Hsp90 (BD, 610418; 1:10,000 to 1:15,000), anticleaved caspase 3 (CST, \#9661; 1:1,000), anti-Bad (CST, \#9292; 1:1,000), and anti-p21 (Santa Cruz, sc-6246).
+
+Western Blotting. Cells were lysed with RIPA buffer (BP-115, Boston BioProducts)
+supplemented with 1× protease inhibitor solution (cOmplete EDTA-free, 11873580001, Roche). Protein concentration of cell lysates was determined by Pierce BCA protein assay (23225, Thermo Fisher Scientific). Total protein (50 μg)
+was separated on 4 to 12% Bis-Tris gradient SDS-PAGE gels (Life Technologies) and then transferred to PVDF membranes (IPVH00010, EMD Millipore) for blotting.
+
+Cell Cycle Analysis. For cell cycle analysis, we used a FITC BrdU Flow Kit
+(559619, BD Biosciences). Briefly, 1 million cells were plated in triplicate with or without p53 restoration for a total of 72 h. Cells were then labeled with 10 μM BrdU for 30 to 60 min, and subsequently fixed and stained with antiBrdU and 7-AAD and analyzed by flow cytometry.
+
+Annexin V–7-AAD Analysis. Cells were cultured identically as described for cell cycle experiments. Seventy-two hours after p53 restoration, cells were analyzed using the BioLegend assay kit (640919) following the manufacturer's guidelines. Standard BH3 Profiling. BH3 profiling was performed essentially as described in Ryan and Letai (24). Cells were harvested, by trypsinization for lung adenocarcinoma and sarcoma cell lines, and washed once in PBS before being suspended in MEB buffer (150 mM mannitol, 50 mM KCl, 0.02 mM EDTA,
+0.02 mM EGTA, 0.1% protease free BSA, 5 mM succinate, 10 mM Hepes, final pH 7.5) at 6.5 × 105 cells/mL. Fifteen microliters of cell suspension was added to each well of a black 384 well plate containing 2× mixtures of each peptide in MEB supplemented with 2 μM JC-1 dye, 0.005% digitonin, 20 μg/mL oligomycin, 10 mM 2-mercaptoethanol. Mitochondrial potential measurements were taken every 5 min for 3 h using a Tecan Safire2 plate reader exciting at 545 nm and reading the red fluorescence of JC-1 at 590 nM with bandwidth of 20 nm on excitations and emission at 30 °C. The area under each curve was normalized to the areas under the DMSO and FCCP
+curves as follows: % depolarization = 1 − [(Sample - FCCP)/(DMSO - FCCP)].
+
+iBH3 Profiling. Lymphoma cells were collected after 24 h of p53 restoration and washed once in PBS before being resuspended MEB2P25 buffer (150 mM
+Mannitol, 150 mM KCl, 5 mM succinate, 1 mM EDTA, 1 mM EGTA, 0.1% BSA,
+2.5g/L Polaxamer 188, 10 mM Hepes pH 7.4) and added to assay plates containing MEB2P25 with 0.002% (wt/vol) digitonin and peptides at 2× final concentration. Cells were exposed to peptides and digitonin for 1 h, fixed for 10 min by the addition of formaldehyde to a final concentration of 1%,
+and neutralized by adding a volume of 3 M Tris base equal to half that of the formaldehyde. Retained cytochrome c was stained by adding clone 6H2.B4 in 10× BD perm buffer to a final dilution of 1:400 overnight. Cells were analyzed on an Intellicyt iQue Screener Plus, gated on cells with intact nuclei (G1-M-G2), and cytochrome c quantified as the median fluorescence intensity (MFI) of the cytochrome c antibody. MFI values were normalized to Buffer (full stain) and no antibody (no stain) controls and expressed as percent release as follows:
+
+$\%$cytochrome $c$ release $=1-\left(\frac{MFI_{\text{Sarmalo}}-MFI_{\text{No.Astribodory}}}{MFI_{\text{BothforAlone}}-MFI_{\text{No.Astribodory}}}\right)$
+Animal Experiments. All animal studies described in this study were approved by the Massachusetts Institute of Technology Institutional Animal Care and Use Committee. A total of 500,000 sarcoma cells were injected subcutaneously into n = 5 Nude mice from Taconic at the age of 6 to 8 wk. Tamoxifen
+(Sigma) was dissolved in corn oil (Sigma) and a single injection was administered intraperitoneally at 200 μg per gram of total body weight, as in Feldser et al. (7).
+
+Immunohistochemistry. All immunohistochemistry procedures were performed essentially as described in Sánchez-Rivera et al. (36). Mice were killed by carbon dioxide asphyxiation. Sarcoma tumors were fixed with 4% paraformaldehyde
+(PFA) overnight, transferred to 70% ethanol, and subsequently embedded in paraffin. Sections were cut at a thickness of four micrometers and stained with H&E for routine pathological examination. Immunohistochemistry was performed on a Thermo Autostainer 360 machine. Slides were antigenretrieved using Thermo citrate buffer, pH 6.0 in the pretreatment module. Sections were treated with Biocare rodent block, primary antibody, and antiMouse (Biocare) or anti-rabbit (Vector Labs) HRP-polymer. The slides were developed with Thermo Ultra DAB and counterstained with hematoxylin in a Thermo Gemini stainer and coverslipped using the Thermo Consul coverslipper. Cleaved caspase 3 was detected using anticleaved caspase 3 (CST, \#9661; 1:1,000).
+
+All pictures were obtained using a Nikon 80i microscope with a DS-U3 camera and NIS-elements software.
+
+Statistical Analyses. All statistical analyses and plots were produced using Prism 8
+(GraphPad). Error bars represent SD, unless otherwise noted. We used Student's t test (unpaired, two-tailed) to assess significance between treatment and control groups, and to calculate P values. P < 0.05 was considered statistically significant.
+
+Data Availability. All study data are included in the article and SI Appendix. ACKNOWLEDGMENTS. We thank members of the T.J., A.L., and M.T.H. laboratories, as well as Edward R. Kastenhuber (Weill Cornell Medicine) and 1. S. Polager, D. Ginsberg, p53 and E2f: Partners in life and death. Nat. Rev. Cancer 9, 738–748 (2009).
+
+2. J. Momand, D. Jung, S. Wilczynski, J. Niland, The MDM2 gene amplification database.
+
+Nucleic Acids Res. 26, 3453–3459 (1998).
+
+3. D. Lane, A. Levine, p53 Research: The past thirty years and the next thirty years. Cold Spring Harb. Perspect. Biol. 2, a000893 (2010).
+
+4. X. Lu, Tied up in loops: Positive and negative autoregulation of p53. Cold Spring Harb.
+
+Perspect. Biol. 2, a000984 (2010).
+
+5. E. R. Kastenhuber, S. W. Lowe, Putting p53 in context. Cell 170, 1062–1078 (2017).
+
+6. K. H. Khoo, C. S. Verma, D. P. Lane, Drugging the p53 pathway: Understanding the route to clinical efficacy. Nat. Rev. Drug Discov. 13, 217–236 (2014).
+
+7. D. M. Feldser et al., Stage-specific sensitivity to p53 restoration during lung cancer progression. Nature 468, 572–575 (2010).
+
+8. C. P. Martins, L. Brown-Swigart, G. I. Evan, Modeling the therapeutic efficacy of p53 restoration in tumors. Cell 127, 1323–1334 (2006).
+
+9. A. Ventura et al., Restoration of p53 function leads to tumour regression in vivo.
+
+Nature 445, 661–665 (2007).
+
+10. W. Xue et al., Senescence and tumour clearance is triggered by p53 restoration in murine liver carcinomas. Nature 445, 656–660 (2007).
+
+11. L. A. Donehower et al., Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356, 215–221 (1992).
+
+12. T. Jacks et al., Tumor spectrum analysis in p53-mutant mice. Curr. Biol. 4, 1–7 (1994).
+
+13. B. P. Zambrowicz et al., Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proc. Natl. Acad. Sci. U.S.A. 94, 3789–3794 (1997).
+
+14. L. Johnson et al., Somatic activation of the K-ras oncogene causes early onset lung cancer in mice. Nature 410, 1111–1116 (2001).
+
+15. M. R. Junttila et al., Selective activation of p53-mediated tumour suppression in highgrade tumours. Nature 468, 567–571 (2010).
+
+16. J. P. Morris 4th et al., α-Ketoglutarate links p53 to cell fate during tumour suppression. Nature 573, 595–599 (2019).
+
+17. J. G. Jackson, S. M. Post, G. Lozano, Regulation of tissue- and stimulus-specific cell fate decisions by p53 in vivo. J. Pathol. 223, 127–136 (2011).
+
+18. M. E. Bowen et al., The spatiotemporal pattern and intensity of p53 activation dictates phenotypic diversity in p53-driven developmental syndromes. Dev. Cell 50, 212–228.e6 (2019).
+
+19. A. G. Letai, Diagnosing and exploiting cancer's addiction to blocks in apoptosis. Nat.
+
+Rev. Cancer 8, 121–132 (2008).
+
+José Reyes (Memorial Sloan Kettering Cancer Center) for scientific discussions; K. Cormier and C. Condon from the Hope Babette Tang (1983) Histology Facility for technical support; and G. Paradis, M. Griffin, M. Jennings, and M. Saturno-Condón for flow cytometry and FACS support. This work was supported by the HHMI, by National Cancer Institute (NCI) R35CA242427, and in part by Cancer Center Support (core) Grant P30-CA14051 from the NCI. F.J.S.-R. was supported by a Repligen Corporation KIICR Graduate Fellowship and the Massachusetts Institute of Technology (MIT) Biology NIH
+Pre-Doctoral Training Grant T32GM007287. Y.M.S.-F. was supported by the NCI of the NIH under Award F31-CA183405 and the MIT Biology NIH PreDoctoral Training Grant T32GM007287. M.T.H. is the Eisen and Chang Associate Professor of Biology. T.J. is a HHMI Investigator, the David H. Koch Professor of Biology, and a Daniel K. Ludwig Scholar.
+
+20. T. Ni Chonghaile et al., Pretreatment mitochondrial priming correlates with clinical response to cytotoxic chemotherapy. Science 334, 1129–1133 (2011).
+
+21. J. C. Liu et al., High mitochondrial priming sensitizes hESCs to DNA-damage-induced apoptosis. Cell Stem Cell 13, 483–491 (2013).
+
+22. K. A. Sarosiek et al., Developmental regulation of mitochondrial apoptosis by c-Myc governs age- and tissue-specific sensitivity to cancer therapeutics. Cancer Cell 31, 142–156 (2017).
+
+23. M. Certo et al., Mitochondria primed by death signals determine cellular addiction to antiapoptotic BCL-2 family members. Cancer Cell 9, 351–365 (2006).
+
+24. J. Ryan, A. Letai, BH3 profiling in whole cells by fluorimeter or FACS. Methods 61, 156–164 (2013).
+
+25. J. Ryan, J. Montero, J. Rocco, A. Letai, iBH3: Simple, fixable BH3 profiling to determine apoptotic priming in primary tissue by flow cytometry. Biol. Chem. 397, 671–678
+(2016).
+
+26. F. J. Sánchez-Rivera, T. Jacks, Applications of the CRISPR-Cas9 system in cancer biology. Nat. Rev. Cancer 15, 387–395 (2015).
+
+27. C. Tse et al., ABT-263: A potent and orally bioavailable Bcl-2 family inhibitor. Cancer Res. 68, 3421–3428 (2008).
+
+28. E. H. Y. A. Cheng et al., BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-mediated mitochondrial apoptosis. Mol. Cell 8, 705–711
+(2001).
+
+29. J. Le Pen et al., Constitutive p53 heightens mitochondrial apoptotic priming and favors cell death induction by BH3 mimetic inhibitors of BCL-xL. Cell Death Dis. 7, e2083
+(2016).
+
+30. P. D. Bhola et al., High-throughput dynamic BH3 profiling may quickly and accurately predict effective therapies in solid tumors. Sci. Signal. 13, eaay1451 (2020).
+
+31. J. Montero et al., Drug-induced death signaling strategy rapidly predicts cancer response to chemotherapy. Cell 160, 977–989 (2015).
+
+32. F. A. Ran et al., Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281–2308 (2013).
+
+33. R. A. Dickins et al., Probing tumor phenotypes using stable and regulated synthetic microRNA precursors. Nat. Genet. 37, 1289–1295 (2005).
+
+34. H. Jiang, J. R. Pritchard, R. T. Williams, D. A. Lauffenburger, M. T. Hemann, A mammalian functional-genetic approach to characterizing cancer therapeutics. Nat. Chem.
+
+Biol. 7, 92–100 (2011).
+
+35. J. R. Pritchard et al., Defining principles of combination drug mechanisms of action.
+
+Proc. Natl. Acad. Sci. U.S.A. 110, E170–E179 (2013).
+
+36. F. J. Sánchez-Rivera et al., Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Nature 516, 428–431 (2014).

medical/md/PMC8216393.md

@@ -0,0 +1,99 @@
+# Coronavirus Related Mortality In The Geriatrics Ambulatory Practice Claudene J. George1 And Alice Guo1
+
+Volume 12: 1–4 © The Author(s) 2021 Article reuse guidelines: sagepub.com/journals-permissions DOI: 10.1177/21501327211025385 journals.sagepub.com/home/jpc https://doi.org/10.1177/21501327211025385
+
+## Abstract
+
+Background: Older adults often have atypical presentations of common diseases and COVID-19 is no exception. Presentations range from asymptomatic to overwhelming symptoms that result in hospitalization, intubation, or death. The number of COVID-19 related deaths among older adults in the outpatient practice during the peak of the pandemic is unclear. **Methods:** The objective is to describe the COVID-19 status and clinical characteristics of patients in a Geriatrics Ambulatory Practice who died during the peak of the COVID-19 pandemic. Design: Retrospective chart review Participants: 54 adults age 65years and older. Methods: COVID-19 status defined by positive test result and presumed COVID-19 status based upon clinical presentation. **Results:** Out of 1200 active patients in the Geriatrics Ambulatory Practice, 54 (4.5%) died between January 1st, 2020 and June 30th, 2020. The study sample was 63% female, 33% Hispanic/Latino, 27% Black/ African American, and 22% white. The mean (SD) age was 86(8.6) years, range (72-107 years). The most prevalent medical comorbidities in decreasing order of frequency were hypertension (88.9%), diabetes (51.9%), and cognitive impairment (51.9%). Nineteen (35%) were COVID-19 positive and 8 had presumed COVID-19. There were no statistically significant differences in age, gender, race/ethnicity, and medical comorbidities between the COVID-19 or presumed COVID-19 group compared to those with No COVID-19. **Conclusion:** Approximately 35% of Geriatric patients who died during the first 6months of 2020 had confirmed COVID-19 and an additional 15% had presumed COVID-19. The actual number of COVID-19 related deaths among older adults in the ambulatory practice during the peak of the pandemic is difficult to estimate and likely underestimated.
+
+## Keywords
+
+COVID-19, geriatrics, mortality, ambulatory practice, health outcomes Dates received: 16 March 2021; revised: 26 May 2021; accepted: 27 May 2021.
+
+## Introduction
+
+Older adults and those with chronic medical conditions are particularly susceptible to the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or COVID-19. According to the Centers for Disease Control (CDC) 8 out of 10 COVID-19 related deaths in the United States are among individuals 65 years and older.1 Symptoms of COVID-19 can appear 2 to 14 days after exposure and can range from fever and chills, cough, shortness of breath, fatigue, muscle aches, headache, new loss of taste or smell, sore throat, congestion or runny nose, nausea or vomiting, and diarrhea.2 Older adults often have atypical presentations of common diseases and COVID-19 is no exception. Patients can be asymptomatic, have vague symptoms that are not respiratory in origin, or have an overwhelming presentation that requires hospitalization, intubation, or can lead to death.3 Patients with dementia may simply have a change in behavior such as increased agitation or confusion,4 making it challenging for caregivers and physicians to determine how aggressively to investigate or triage such patients for further evaluation. It is unclear if presentations that were consistent with COVID-19 were deemed to be unrelated early in the pandemic. The number of COVID-19 related deaths among older adults in the outpatient practice during the peak of the pandemic is unclear and perhaps underestimated. Therefore, the objectives of the present study are to describe the COVID-19 status of patients in a Geriatrics Ambulatory Practice who died during the first 6-month period of the COVID-19 pandemic, and to compare the clinical characteristics of patients who died of COVID-19 1Albert Einstein College of Medicine, Bronx, NY, USA
+Corresponding Author: Claudene J. George, Montefiore Medical Center, Division of Geriatrics, Albert Einstein College of Medicine, 111 East 210th Street, Bronx, NY 10467, USA. Email: Clgeorge@montefiore.org Creative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).
+
+to patients whose deaths were not COVID-19 related. A better understanding of the characteristics and presentations of patients who died from COVID-19 could help clinicians to consider COVID-19 in the differential diagnosis even when patients present with symptoms that may not be respiratory in origin.
+
+## Methods
+
+This retrospective chart review was conducted at the Geriatrics Ambulatory Practice of an Academic Institution. The practice serves a diverse group of approximately 1200 community dwelling older adults who are 65 years or older. Approval was obtained from the Institutional Review Board. Providers were asked to identify patients in their panels who died of any cause between January 1st, 2020 to June 30th, 2020. This 6-month period was chosen in order to include deaths that were unrelated to the pandemic, to ensure that COVID-19 cases would not be missed and to allow for a comparison group of non-COVID-19 related deaths. Furthermore, the 6-month interval allowed for an estimate of the number of deaths that occurred in the months prior the start of the pandemic. In order to capture additional patients who might not have been captured by the primary care provider, a query was also performed in the Electronic Health Record (EHR) to identify all patients who were seen for a home visit or at the Geriatrics Ambulatory Practice within the last year who were documented as deceased. Furthermore, after July 2020, a second request was made to physicians to review their patient panels to determine if they were notified of patient deaths occurring between January 1st and June 30th that were not previously reported. Patients who were seen for a consult visit were not included. One investigator (CJG) examined the medical records to identify COVID-19 status, clinical characteristics, and reported symptoms just prior to death. The main outcome measure was COVID-19 status categorized as positive or negative based upon SARS-CoV-2 PCR or antibody testing. The chart was further examined for the presence of both pulmonary and extrapulmonary symptoms consistent with COVID-19 including fever, chills, cough, shortness of breath, fatigue, muscle aches, headache, new loss of taste or smell, sore throat, congestion or runny nose, nausea or vomiting, and diarrhea, in order to capture patients with presumed COVID-19. Patients who were not tested for COVID-19, and had symptoms consistent with COVID-19 were categorized as "presumed COVID-19." Presumed COVID-19 cases were likely true COVID-19 cases based upon symptomology, but these patients did not receive SARS-CoV-2 PCR or antibody testing. Both confirmed COVID-19 positive patients (by testing) and "presumed COVID-19" patients were compared to the No COVID-19 category of patients in Table 1. Patients who died during the months of January or February were excluded from the "presumed COVID-19"categorization given that the first reported case of COVID-19 in New York City was March 1st, 2020.4 Additional data abstracted from the medical records included sociodemographic characteristics (age, gender, race/ethnicity) and clinical characteristics such as presence of diabetes, hypertension, cognitive impairment, chronic kidney disease, and lung disease. Characteristics of participants were compared using descriptive statistics; two-sample T-test for continuous variables and Chi Square test for categorical variables. Model assumptions were examined and met. All tests are two-sided with significance level .05. Data Analysis was performed using SPSS version 25.
+
+## Results
+
+Out of 1200 active patients in the Geriatrics outpatient practice, 54 (4.5%) died between January 1st, 2020 to June 30th, 2020. Table 1 lists the demographic and clinical characteristics of the sample. The mean (SD) age was 86(8.6) years, range (72-107 years). The prevalence of specific medical comorbidities in decreasing order of frequency was hypertension (88.9%), diabetes (51.9%), cognitive impairment (51.9%), chronic kidney disease (40.7%), congestive heart failure (22.2%), and chronic obstructive pulmonary disease or asthma (18.5%). Three participants (5.6%) had end stage renal disease and 17 (31.5%) had a diagnosis of dementia. Eight percent of patients were part of the Geriatrics home visiting program. The location of death for most patients was the hospital 
+(66.7%) and 31.5% died at home (Table 1). The peak number of deaths occurred in April (n = 23), then fewer amounts during other months: May (n = 9), February (n = 6), March (n = 5), January (n = 5), and June (n = 3).There were 3 patients whose month of death was unclear since they died at some point between the months of March to April (n = 2) and January to February (n = 1).
+
+Among the 54 patients who died, 19 (35%) were COVID19 positive confirmed by testing. An additional 8 were not tested for COVID-19 but had symptoms or exposures suggestive of a COVID-19 illness (respiratory symptoms 
+[n=4], new malaise, weakness and poor oral intake without obvious source [n=3], and cardio pulmonary arrest when found by emergency medical services [n=1]) and were categorized as presumed COVID-19 positive. The remaining 27 patients were categorized as having No COVID-19. The clinical characteristics of patients categorized as COVID19 or presumed COVID-9 compared to those with No COVID-19 is shown in Table 1. There were no statistically significant differences between the two groups.
+
+## Discussion
+
+Though 35% of Geriatric patients who died during the first 6months of 2020 had confirmed COVID-19, the actual number of COVID-19 related deaths is closer to 50% when 
+
+| Table 1. Baseline Characteristics of COVID-19 and Non-COVID-19 Patients Who Died. Total COVID-19*   | No Covid-19   |           |           |      |
+|-----------------------------------------------------------------------------------------------------|---------------|-----------|-----------|------|
+| N=54                                                                                                | N=27          | N=27      | P value   |      |
+| Age, years                                                                                          | 86±8.6        | 84±8.0    | 87±9.0    | .278 |
+| Gender Female (n, %)                                                                                | 34 (63.0)     | 14 (51.9) | 20 (74.1) | .158 |
+| Race/ethnicity (n, %)                                                                               | .214          |           |           |      |
+| Black                                                                                               | 15 (27.8)     | 7 (25.9)  | 8 (29.6)  |      |
+| Hispanic                                                                                            | 18 (33.3)     | 10 (37.0) | 8 (29.6)  |      |
+| Asian                                                                                               | 3 (5.6)       | 3 (11.1)  | 0 (00.0)  |      |
+| White                                                                                               | 12 (22.2)     | 4 (14.8)  | 8 (29.6)  |      |
+| Not reported                                                                                        | 6 (11.1)      | 3 (11.1)  | 3 (11.1)  |      |
+| Comorbidities (n, %) Hypertension                                                                   | 48 (88.9)     | 25 (92.6) | 23 (85.2) | .669 |
+| Diabetes                                                                                            | 28 (51.9)     | 14 (51.9) | 14 (51.9) | 1    |
+| Cognitive Impairment                                                                                | 28 (51.9)     | 14 (51.9) | 14 (51.9) | .607 |
+| Chronic Kidney Disease                                                                              | 22 (40.7)     | 10 (54.5) | 12 (44.4) | .782 |
+| Congestive Heart Failure                                                                            | 12 (22.2)     | 3 (11.1)  | 9 (33.3)  | .099 |
+| Chronic obstructive pulmonary disease/asthma                                                        | 10 (18.5)     | 6 (22.2)  | 4 (14.8)  | .728 |
+| Stroke                                                                                              | 7 (13.0)      | 4 (14.8)  | 3 (11.1)  | .5   |
+| Home visit (n, %)                                                                                   | 8 (14.8)      | 3 (11)    | 5 (18.5)  | .704 |
+| Location of death (n, %)                                                                            | .307          |           |           |      |
+| Hospital death                                                                                      | 36 (66.7)     | 20 (74.1) | 16 (44.4) |      |
+| Home                                                                                                | 17 (31.5)     | 7 (25.9)  | 10 (37)   |      |
+| Unknown                                                                                             | 1 (1.9)       | 0 (0.0)   | 1 (3.7)   |      |
+| *Includes confirmed COVID-19 positive (n=19) and presumed COVID-19 positive (n=8).                  |               |           |           |      |
+
+one considers both presumed and confirmed cases of COVID-19. This highlights the significant impact of the pandemic on the geriatric outpatient sample. During the peak of the pandemic in New York City,4 there was an excess of 18 deaths during the month of April in comparison to an average of 5 deaths in the preceding month.
+
+It was hypothesized that those who died of a COVID-19 related illness would be of more advanced age and that the prevalence of certain conditions such as diabetes and hypertension would be higher among those who died of presumed or confirmed COVID-19 than those who died of other causes. This was not the case. Geriatrics patients who died with COVID-19 or presumed COVID-19 were not significantly different with respect to medical comorbidities, age, gender, and race/ethnicity when compared to those who died of other causes. This was an unexpected finding. It is likely that the patients' clinical characteristics had more of an impact on their deaths than the presence or absence of a COVID-19 infection. The patients were vulnerable, and while COVID-19 could have accelerated the onset their deaths, it is also likely that another illness could have also resulted in their deaths. This is important to note because clinicians wondered if they could have prevented the deaths of their patients by making note of the clinical characteristics of those who died of COVID-19 compared to those who died of other causes.
+
+Estimating the true prevalence of deaths from COVID19 in the outpatient setting is challenging for a number of reasons. Approximately 30% of patients in this sample died at home. Many patients who died at home were not tested for COVID-19 and were treated symptomatically for presumed COVID-19 based upon the presence of respiratory symptoms.
+
+During the early months of the pandemic, it was not known that extrapulmonary symptoms could be related to COVID-19. The retrospective nature of this study allowed for consideration of extrapulmonary symptoms in the designation of the "presumed COVID-19" category. More recent publications have highlighted extrapulmonary symptoms such as myalgia and fatigue, anorexia, diarrhea, acute kidney injury, thromboembolism, myocardial ischemia, and rashes unrelated to recent drug exposure as presenting symptoms or complications of COVID-19.5 The healthcare system was overwhelmed and healthcare resources such as emergency department and hospital beds, personal protective equipment, and ventilators were limited. Many outpatient sites were closed for in-person visits. 
+
+Many patients with new symptoms did not present to the emergency department, urgent care or to the outpatient practice for evaluation or testing. In most cases, telephonic visits were provided, and symptoms were managed at home. Patients with any illness had limited direct interaction with the healthcare system thereby prohibiting investigation and treatment of reversible conditions unrelated to COVID-19. It would be reasonable to consider an additional category called "COVID-19 associated deaths" for patients without COVID-19 who could not efficiently engage with the health care system and were casualties during the peak of the pandemic. A recent analysis reported that only 65% of excess deaths reported in the US between March 1st, 2020 and April 25th, 2020 were linked to COVID-19.6 This study has a number of limitations. As with most retrospective chart reviews, there was a high reliance on physician documentation in the medical chart. It is possible that there was misclassification of presumed COVID19 and No COVID-19, but efforts were made to be as conservative as possibly. Patients may have sought care outside of the primary care provider's hospital network thereby limiting access to information about death or cause of death for patients who were hospitalized. Deaths occurring at home could have been missed, however this was less likely since primary care providers receive notification of deaths at home so that a death certificate can be completed.
+
+## Conclusions And Implications
+
+The actual number of COVID-19 related deaths among older adults in the ambulatory practice during the peak of the pandemic is difficult to estimate and likely underestimated. 
+
+Given the similarities in clinical characteristics and medical comorbidities among those who died of COVID-19 and those who died of other causes, as well as the limitation in accessing available healthcare resources; it is unclear if further evaluation in the outpatient setting or urgent care setting would have changed patient outcomes during the peak of the pandemic. Clinicians should broaden their differential diagnosis early to include the possibility of a COVID-19 related illness. Since all participants in this sample had an outcome of death, further investigation to compare the COVID-19 and presumed COVID-19 patients to those who survived the illness would be helpful in further identifying risk factors for death. Early identification of patients who are at risk could lead to more thorough discussions of the goals of care and expectations and allow clinicians to make more informed decisions about resource allocation.
+
+## Acknowledgments
+
+We thank the patients and their families and the physicians who responded to questions and provided care to the patients. CG contributed in conceptualization, data entry and analysis, and manuscript writing and editing. AG contributed to manuscript writing and editing.
+
+## Declaration Of Conflicting Interests
+
+The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
+
+## Funding
+
+The author(s) received no financial support for the research, authorship, and/or publication of this article.
+
+## Orcid Id
+
+Claudene J. George https://orcid.org/0000-0002-0710-027X
+
+## References
+
+1. Center for Disease Control and Prevention. Your health. 
+
+Coronavirus disease 2019(COVID-19). Published 2021. Accessed June 9, 2021. https://www.cdc.gov/coronavirus/2019 -ncov/need-extra-precautions/older-adults.html 2. Center for Disease Control and Prevention. Symptoms of Coronavirus. Coronavirus disease 2019(COVID-19). Published 2021. Accessed June 9, 2021. https://www.cdc. gov/coronavirus/2019-ncov/symptoms-testing/symptoms. html 3. CDC COVID-19 Response Team. Severe outcomes among patients with Coronavirus disease 2019(COVID-19)-United States, February 12–March 16, 2020. Morbidity and Mortality Weekly Report(MMWR). Center for Disease Control and Prevention. 2020. Accessed October 16, 2020. https://www. cdc.gov/mmwr/volumes/69/wr/mm6912e2.htm 4. Johns Hopkins Coronavirus Resource Center. America is reopening. But have we flattened the curve? Published 2021. 
+
+Accessed June 8, 2021. https://coronavirus.jhu.edu/data/newcases-50-states/new-york 5. Gupta A, Madhavan MV, Sehgal K, et al. Extrapulmonary manifestations of COVID-19. *Nat Med*. 2020;26:1017-1032. doi:10.1038/s41591-020-0968-3 6. Woolf SH, Chapman DA, Sabo RT, Weinberger DM, Hill L. Excess deaths from COVID-19 and other causes, MarchApril 2020. *JAMA*. 2020;324:510-513.

medical/md/PMC8524690.md

@@ -0,0 +1,425 @@
+# Online Learning Performances Of Children And Adolescents With Attention Deficit Hyperactivity Disorder During The Covid-19 Pandemic
+
+INQUIRY: The Journal of Health Care Organization, Provision, and Financing Volume 58: 1–11 © The Author(s) 2021 Article reuse guidelines: sagepub.com/journals-permissions DOI: 10.1177/00469580211049065 journals.sagepub.com/home/inq Shan He, MD1,2, Lan Shuai, PhD1,2, Zhouye Wang, MD1,2, Meihui Qiu, MD1,2, Amanda Wilson, PhD3, Weiping Xia, MD1,2, Xuan Cao, MD1, Lu Lu, MD1, and Jinsong Zhang, PhD, MD1,2
+
+## Abstract
+
+To investigate attention deficit hyperactivity disorder (ADHD) core symptoms that impair executive function (EF), emotional state, learning motivation, and the family and parenting environment of children and adolescents with ADHD, both with and without severe difficulties. This will be explored within an online learning environment during the period of COVID-19 pandemic. A total of 183 ADHD children diagnosed using DSM-V criteria were selected and divided into 2 groups high difficulties during online learning (HDOL) and low difficulties during online learning (LDOL) according to the answer of Home Quarantine Investigation of the Pandemic (HQIP). The participants filled out a set of questionnaires to assess their emotional state and learning motivation, and their parents also filled out the questionnaires about ADHD core symptoms, EF, and family and parenting environment. Compared with ADHD children in the LDOL group, the children in the HDOL group had significant symptoms of inattention, hyperactivity, oppositional defiant, behavioral and emotional problems according to the Swanson, Nolan, and Pelham Rating Scale (SNAP). They also had more severely impaired EF according to the Behavior Rating Inventory of Executive Function (BRIEF), more difficulties and disturbances in the family by the Chinese version of Family Environment Scale (FES-CV), and lower parenting efficacy and satisfaction by Parenting Sense of Competence (PSOC). With regard to the self-rating questionnaires of children and adolescents, the HDOL group reported lower learning motivation according to the Students Learning Motivation Scale (SLMS). By Screening for Child Anxiety-Related Emotional Disorders and Depression Self-Rating Scale for Children (DSRSC), those in HDOL presented more negative emotions. The HDOL group spent significantly more time on both video games and social software per day and significantly less time on multiple activities per week, when compared to those in the LDOL group. This study demonstrated that ADHD children and adolescents with HDOL had more inattention-related behaviors, more severe emotional problems and EF impairment, weaker learning motivation, and poorer family and parenting environment. Meanwhile, digital media use should be supervised and appropriate extracurricular activities should be encouraged by parents and schools.
+
+## Keywords
+
+ADHD, COVID-19, online learning performance, children, adolescents Corresponding Author:
+Jinsong Zhang, Department of Medical Psychology, Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, 1665 Kongjiang Road, Shanghai 200092, China.
+
+Email: zhangjinsong@xinhuamed.com.cn
+
+| 1 Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, China 2 Ministry of Education-Shanghai Key Laboratory of Children's Environmental Health, Shanghai, China 3 Division of Psychology, Faculty of Health and Life Sciences, De Montfort University, Leicester, United Kingdom Received 29 June 2021; revised manuscript accepted 8 September 2021   |
+|------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+
+Creative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).
+
+## What Do We Already Know About This Topic?
+
+Some conclusions of related research have been published by our team before. The COVID-19 epidemic has caused obvious mental and psychological effects on children with ADHD, including emotional problems and executive function. In addition, ADHD
+children study online during this period, and at the same time, they also tend to have some problems with Internet use that worsened their behavior.
+
+## How Does Your Research Contribute To The Field?
+
+A comprehensive description of the home life and learning performance of ADHD children under stressful event, as well as a series of mental and psychological evaluations. Provide a medical reference for the treatment guidance of ADHD children under stressful event.
+
+## What Are Your Research'S Implications Toward Theory, Practice, Or Policy?
+
+It is of great guiding significance not only for professionals in the field of children's psychology, but also for families of ADHD children worldwide. To help them better understand the online learning performance of children under such stressful event and the various mental and psychological conditions associated, so as to help ADHD children to better spend their lives under quarantine.
+
+## Introduction
+
+Since the beginning of 2020, novel coronavirus disease
+(COVID-19) has caused persistent and widespread psychosocial problems globally. Research has found that preexisting symptoms among psychiatric patients can deteriorate or re-occur during this period.1 Similarly, children with pre-existing psychiatric disorders, such as attention deficit hyperactivity disorder (ADHD), were adversely influenced under these condition.2 ADHD is a common neurodevelopmental disorder that is characterized by age-inappropriate features of inattention, hyperactivity and impulsivity. The prevalence of ADHD among Chinese children and adolescents was found to be 6.26% in a recent meta-analysis.3 In this group of children, not only was there a presence of ADHD-related symptoms but there were also emotional problems that deteriorated during the COVID-19 epidemic.4 These problems caused difficulties in everyday life as well as interrupted the learning of children with ADHD and their families. Meanwhile, as an emergency response to the COVID-19 pandemic, all the primary and secondary schools in China have delayed the return date to school, and most of the schools have suggested home-based education or online learning for children as well as adolescents due to the implementation of home quarantining by the Chinese government. Thanks to the massive efforts put forwarded by schools and teachers at all levels, online courses were created and delivered remotely online within a short time period.5 In recent years, the pedagogy of online learning and remote education has been rapidly developed to support the promotion of learning processes in several different fields and aimed at different levels of knowledge.6 There is still a heated debate with regard to the pros and cons of online learning.
+
+Few researchers have believed that online learning results in learning progressing among students. During the COVID-19 epidemic, the children who studied online had a better academic performance than those who studied offline.7 In addition, online courses use internet and media-based technology to enhance interest in the courses, increase the online interaction between teachers and students, and also improve the quality life of the students.8,9 However, many parents of young children are still worried about the physical harm caused by online learning, such as obesity and impairment of eyesight,10,11 making it difficult for parents to manage the use of this additional screen time effectively.12 Although online learning has been widely used in the majority of the schools in China, and showed a positive impact on students' educational performance during the COVID-19 epidemic,7 many parents still held negative beliefs and attitudes toward this approach because of the behavioral problems of their children during the online learning sessions.13 When it comes to ADHD, a study showed that children and adolescents with ADHD had more difficulties with online learning during the COVID-19 pandemic, due to academic impairment, and difficulties in managing online learning and home-school communication when compared to those without ADHD.14 In addition, another study reported that the increased screen time with online learning was related to the relief of core symptoms of ADHD, but causality had yet to be explained.4 Though the situations were quite different between learning in the classroom and learning online from home, the learning outcome and effective factors are somewhat different. For children with ADHD, they display more difficulties learning at school,15 but little was known of their state during online learning at home. There are few studies on the online learning performance of children with and adolescents with ADHD during the COVID-19 pandemic. Nevertheless, previous studies have shown that the difficulties in learning among general children and adolescents were related to ADHD symptoms, emotional problems,16 impaired executive function (EF),17 parenting environment,18 learning motivation,19 media digital use,20 and physical exercises.21 In this study, the focus is on children with ADHD to better understand their state during online learning and the related factors discussed above. It was hypothesized that online learning performance children and adolescents with ADHD
+during the COVID-19 epidemic will correlate with ADHD core symptoms, emotional status, EF, learning motivation, family and parenting environment, media digital usage and extracurricular activity. It was further hypothesized that those with high levels of ADHD will have more difficulties with online learning than those with low levels of ADHD.
+
+Therefore, of the results will explain which children with ADHD are considered suitable for participating in online learning, and how parents and schools can create a healthy psychosocial environment for their children to flourish.
+
+## Participants And Procedures
+
+This study included 183 Chinese schooling children with an age range of 8 years 0 months to 15 years 11 months from the medical psychological outpatient clinic of a general hospital in Shanghai, Recruitment occurred from April to May 2020, which was during the outbreak of COVID-19. All participants were confirmed with ADHD through diagnosis by a psychiatrists using the Clinical Diagnostic Interviewing Scale22,23 based on DSM-V criteria. Children with intellectual disability, affective disorders, and a history of brain damage, epilepsy, and autism spectrum disorder were excluded. A total of 208 parents with children who used the clinic were informed of this study, and 183 (88.0%) agreed to participate and completed the survey. This study protocol was reviewed and approved by the ethics committee of Shanghai Xinhua Hospital, and informed consent forms were obtained from the parents, with the children and adolescents providing assent. Also, some of the participants in this study were included in another study conducted by the research team.
+
+According to the self-designed Online Learning Performance Investigation (OLPI), the ADHD children were divided into 2 groups. Children with ADHD who demonstrated a worse performance in online learning evaluated by their parents were include in high difficulties during online learning (HDOL) group, and those who demonstrated a normal or better performance in online learning were included in the low difficulties during online learning (LDOL)
+group. The demographic and clinical data of the children and adolescents were also obtained from their parents.
+
+## Measures
+
+Swanson, Nolan, and Pelham Rating Scale (SNAP): Parents rate each core and related symptom of ADHD on a 4-point Likert scale (0 = not at all, 1 = just a little, 2 = quite a bit, 3 =
+very much), including 5 factors: attention deficit, hyperactivity, oppositional defiant, conduct problem, and emotional problem. The reliability and validity of the Chinese version of the SNAP-IV rating scale-parent form are satisfactory for use among schooler children and adolescents in China.24 Raw scores of each factor are calculated in this study, and the higher the score, the worse the symptoms.
+
+Behavior Rating Inventory of Executive Function (BRIEF)
+is an 88-item behavior rating scale for parents to assesses performance in daily life reflecting the EF in school-aged children.25 Items are rated 1(never), 2 (sometimes), or 3
+(often), respectively. And there is a total score called global executive composite (GEC), indicating general EF. The higher the raw score is, the more severe the impairment of their EF. This scale has shown adequate reliability and validity in Chinese children.26 The Chinese Version of Family Environment Scale (FESCV) is a 90-item, dual-choice ("yes" or "no") scale with 10 subscales, that include: cohesion, expression, conflict, independence, achievement, intellectual-cultural orientation, active-recreational orientation, morality, organization and control, which measure the social-environmental characteristics of families. A higher score reflects a better family status and environment. The Chinese version of FES (FES-CV),
+translated and revised by Chinese scholars, has shown acceptable internal consistency and retest reliability.27,28 Parenting Sense of Competence (PSOC) is a 17-item, selfreport instrument that is rated on a 6-point Likert scale including the 2 dimensions of parenting efficacy and parenting satisfaction that the parent can use to assess their skill set.29 The higher the score is, the better the competence of the individual's parenting. The scale has been used in previous research and the Chinese version of PSOC was suitable for conducting clinical research in China.30 Students Learning Motivation Scale (SLMC) is a widely used scale with Chinese student groups, which includes 20 items. Each item is evaluated using a dual-choice ("yes" or "no"), that are rates with 1 point and 0 points, respectively.
+
+This scale contains 4 subscales: initiative, awareness, interesting, and goal. The higher the raw score is, the more problems there are in the answers to the corresponding subscales.31 Depression Self-Rating Scale for Children (DSRSC) was developed by Birleson and includes 18 items to assess the depression status of children. Each of items is scored on a 3point Likert scale (1 = none, 2 = sometimes, 3 = often). The higher the raw score, the more severer the depressive emotion.32 Chinese scholars developed the DSRSC for urban children in China, and the reliability and validity of this adapted scale meets the requirements of psychometrics.33 The Screen for Child Anxiety-Related Emotional Disorders (SCARED) is a brief instrument to assess anxious emotions in children, which is rated by the children themselves.34 The Chinese version of the SCARED scale has 41 items that are rated on 3 levels and shows satisfactory reliability and validity. A higher raw score indicates a greater level of anxiety.35 Online Learning Performance Investigation (OLPI) is a self-designed scale based on the distance learning difficulty
+
+| Table 1. Demographic and Clinical Characteristics of Children and Adolescents with ADHD in the HDOL and LDOL Groups. Characteristics ADHD with HDOL (n = 99) ADHD with LDOL (n = 84) Statistical Values   | P              |                |             |       |
+|-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|----------------|----------------|-------------|-------|
+| Age (months) mean ± SD                                                                                                                                                                                    | 133.11 ± 24.55 | 130.86 ± 26.84 | t = .589    | .56   |
+| Average living area (m2 ) mean ± SD                                                                                                                                                                       | 30.66 ± 24.95  | 29.49 ± 17.06  | Z = .375    | .71   |
+| Sex, n (%) Female                                                                                                                                                                                         | 33 (33.3)      | 15 (17.9)      | χ2 = 5.625  | .02   |
+| Male                                                                                                                                                                                                      | 66 (66.7)      | 69 (82.1)      |             |       |
+| ADHD subtypes, n (%) Inattentive                                                                                                                                                                          | 75 (75.8)      | 64 (76.2)      | χ2 = .588   | .75   |
+| Hyperactive-impulsive                                                                                                                                                                                     | 1 (1.0)        | 2 (2.4)        |             |       |
+| Combined                                                                                                                                                                                                  | 23 (23.2)      | 18 (21.4)      |             |       |
+| Treatment, n (%) With medication                                                                                                                                                                          | 36 (36.4)      | 57 (67.9)      | χ2 = 18.034 | <.001 |
+| Comorbidity, n (%) ODD                                                                                                                                                                                    | 57 (57.6)      | 15 (17.9)      | χ2 = 30.040 | <.001 |
+| TICS                                                                                                                                                                                                      | 36 (36.4)      | 15 (17.9)      | χ2 = 7.742  | .01   |
+| ADHD, attention deficit hyperactivity disorder; HDOL, High Difficulties in Online Learning; LDOL, Low Difficulties in Online Learning; ODD, oppositional                                                  |                |                |             |       |
+
+ADHD, attention deficit hyperactivity disorder; HDOL, High Difficulties in Online Learning; LDOL, Low Difficulties in Online Learning; ODD, oppositional defiant disorder; TICS, tic disorder.
+
+questionnaire compiled before, to investigate the situation of online learning amongst children and adolescents during the COVID-19 pandemic.36 It contains 8 items. Questions 1-7 investigated whether the children have obvious problems in multiple aspects compared with the traditional learning before the outbreak of COVID-19, such as attention, homework accuracy and social interaction during online learning. The 3 options included "Better than before," "Same as before," and "Worse than before." Question 8 required parents to directly evaluate whether their children have significant difficulties in online learning than before, and this question used as a basis of grouping. This investigation is also used in our other research.4 Home Quarantine Investigation of the Pandemic (HQIP)
+is a self-designed scale to collect information from children with ADHD about their different digital media usage and arrangement of extracurricular activity at home during the COVID-19 epidemic. The specific questions of this scale are as follows:
+
+Q1. The average hours spent on TV, movie, and video including short videos (eg, TikTok) per day; Q2. The average hours spent on video games including both computer and mobile games per day; Q3. The average hours spent on social software (eg, WeChat and QQ) per day; Q4. The average number of days of physical exercise per week; Q5. The average number of days of artistic and musicbased activities (eg, painting, singing, playing a musical instrument, and dancing) per week; Q6. The average number of days spent doing science and cultural activities (eg, reading, science experiment, and study) per week; Q7. The average number of days of pursuing other hobbies and interests per week;
+
+## Data Analysis
+
+Statistical analyses were carried out using SPSS version 19.0 and a P value of <.05 was considered to be statistically significant. The demographic differences between continuous and categorical data of the 2 groups were assessed using paired sample t-tests and Chi-square tests. This study compared the differences in ADHD symptoms and psychosocial behaviors between ADHD children in the HDOL and LDOL
+groups by using multivariate analysis of covariance (MANCOVA), in which age was used as a covariate. The effect size (η2 p) of the differences was calculated using the partial eta-squared, and analyzed based on the effect sizes, wherein .01-.05 represents a low effect size; .05-.14 represents a medium effect size; and >.14 represents a large effect size.37
+
+## Results
+
+The total sample size consisted of 183 ADHD children. The demographic and clinical characteristics of the 2 groups are presented in Table 1. There were no significant differences between the 2 groups with regard to age (t = .589, P = .56),
+average living area (Z = .375, P = .71), and ADHD subtypes
+(χ2= .588, P = .75). However, there were significant differences between the 2 groups regarding gender (χ2 = 5.625, P = .02), treatment of medication (χ2 = 1 8.034, P < .001),
+comorbidity of oppositional defiant disorder (ODD, χ2 =
+30.040, P < .001), and Tics (χ2 = 7.742, P = .01).
+
+The outcomes of scales rated by parents, children, and adolescents are shown in Table 2. Those with ADHD in the He et al. 5
+
+| Table 2. ADHD Symptoms and Psychosocial Behaviors of ADHD Children and Adolescents in the HDOL and LDOL Groups. ADHD with HDOL (n = 99) ADHD with LDOL (n = 84) Statistical Values Subscales Mean ± SD Mean ± SD F (1, 182) P Partial η2 p SNAP scores Inattentive 18.39 ± 4.45 14.37 ± 5.36 32.30 <.001 .152 Hyperactive-impulsive 10.46 ± 6.12 7.52 ± 4.44 18.39 <.001 .093 ODD-related problem 11.17 ± 4.64 7.46 ± 3.77 34.98 <.001 .163 CD-related problem 2.63 ± 2.55 1.19 ± 1.45 20.87 <.001 .104 Emotional problem 5.48 ± 4.03 4.17 ± 4.12 4.44 .04 .024 BRIEF factor Inhibition 16.94 ± 4.10 15.50 ± 3.64 7.04 <.01 .038 Shift 13.12 ± 2.72 11.79 ± 2.90 9.96 <.01 .052 Emotional control 17.39 ± 4.07 15.07 ± 4.04 14.59 <.001 .075 Initiation 15.66 ± 2.96 13.88 ± 3.09 15.25 <.001 .078 Working memory 21.37 ± 3.71 18.76 ± 3.86 22.52 <.001 .111 Plan 27.14 ± 4.22 23.58 ± 4.19 32.18 <.001 .152 Organize 13.54 ± 2.87 11.89 ± 3.05 13.71 <.001 .071 Monitor 18.36 ± 3.06 16.82 ± 3.16 11.96 .001 .062 BRIEF index Behavior regulation 47.45 ± 8.74 42.36 ± 9.15 14.85 <.001 .076 Metacognition 96.07 ± 13.69 84.94 ± 14.76 27.86 <.001 .134 BRIEF GEC 143.53 ± 20.50 127.30 ± 22.64 25.85 <.001 .126 FES-CV Cohesion 6.55 ± 2.34 7.23 ± 2.16 4.10 .04 .022 Expression 5.05 ± 1.69 5.49 ± 1.81 2.86 .09 .016 Conflict 4.37 ± 2.29 3.23 ± 1.93 13.03 <.001 .068 Independent 5.45 ± 1.61 5.49 ± 1.27 .03 .87 <.001 Achievement 5.85 ± 1.63 5.35 ± 1.90 3.66 .06 .020 Intellectual-cultural orientation 4.03 ± 2.02 4.93 ± 2.08 8.84 <.01 .047 Active-recreational orientation 4.13 ± 2.69 5.12 ± 2.19 6.88 <.01 .037 Morality 4.73 ± 1.51 4.56 ± 1.62 .39 .53 .002 Organization 4.77 ± 1.41 5.17 ± 1.54 3.20 .08 .017 Control 3.56 ± 1.96 4.02 ± 2.03 2.80 .10 .015 Total score 48.48 ± 7.95 50.57 ± 8.99 2.81 .10 .015 PSOC Efficacy 29.69 ± 4.41 31.76 ± 5.10 8.74 <.01 .046 Satisfaction 30.64 ± 6.42 34.77 ± 7.29 16.462 <.001 .084 Total score 60.32 ± 9.08 66.54 ± 10.69 17.93 <.001 .091 SLMC Initiative 2.22 ± 1.64 1.56 ± 1.65 7.55 <.01 .040 Awareness 2.40 ± 1.48 2.11 ± 1.47 1.62 .21 .009 Interesting 1.77 ± 1.31 1.39 ± 1.01 4.73 .03 .026 Goal 2.06 ± 1.43 1.51 ± 1.33 6.90 <.01 .037 Total score 8.45 ± 3.72 6.57 ± 3.75 11.32 <.01 .059 DSRSC 14.46 ± 6.07 12.23 ± 5.23 6.62 .01 .035 SCARED 20.48 ± 18.18 14.85 ± 13.98 5.09 .03 .028 Daily digital media usage Total time 3.66 ± 3.04 2.54 ± 2.43 7.08 <.01 .038 Time on video game 2.09 ± 2.66 .99 ± 1.18 11.90 <.01 .062 Time on social software 1.57 ± 2.61 .79 ± 1.46 5.56 .02 .030 (continued)   |
+|------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
+
+| Table 2. (continued)                      | ADHD with HDOL (n = 99)   | ADHD with LDOL (n = 84)   | Statistical Values   |       |              |
+|-------------------------------------------|---------------------------|---------------------------|----------------------|-------|--------------|
+| Subscales                                 | Mean ± SD                 | Mean ± SD                 | F (1, 182)           | P     | Partial η2 p |
+| Days per week for doing Physical exercise | 2.07 ± 1.93               | 2.98 ± 2.18               | 8.59                 | <.01  | .046         |
+| Artistic and music                        | .73 ± 1.23                | 1.66 ± 2.35               | 11.29                | <.01  | .059         |
+| Science and culture                       | 1.38 ± 1.88               | 2.93 ± 2.70               | 21.26                | <.001 | .106         |
+| Other hobbies                             | .86 ± 1.55                | 1.76 ± 2.43               | 8.87                 | <.01  | .047         |
+
+ADHD, attention deficit hyperactivity disorder; BRIEF, Behavior Rating Scale of Executive Function; CD, conduct disorder; DSRSC, Depression Self-Rating Scale for Children; FES-CV, Chinese Version of Family Environment Scale; GEC, global executive composite; HDOL, High Difficulties in Online Learning; LDOL, Low Difficulties in Online Learning; ODD, oppositional defiant disorder; PSOC, Parenting Sense of Competence; SD, standard deviation; SCARED, Screening child anxiety-related emotional disorders; SLMC, Students Learning Motivation Scale.
+
+HDOL group had significantly higher scores on inattentive [F
+(1, 182) = 32.30, η2 p = .15, P < .001)], hyperactiveimpulsive [F (1, 182) = 18.39, η2 p = .09, P < .001)], oppositional defiant [F (1, 182) = 34.89, η2 p = .16, P < .001],
+conduct problem [F (1, 182) = 20.87, η2 p = .10, P < .001], and emotional problem [F (1, 182) = 4.44, η2 p = .02, P = .04]
+on the SNAP when compared with the LDOL group. The EF
+measured by the BRIEF showed significant impairment in each factor among the HDOL group for: inhibition [F (1, 182) =
+7.04, η2 p = .04, P < .01], shift [F (1, 182) = 9.96, η2 p = .05, P
+< .01], emotional control [F (1, 182) = 14.59, η2 p = .08, P < .001], initiation [F (1, 182) = 15.25, η2 p = .08, P < .001],
+working memory [F (1, 182) = 22.52, η2 p = .11, P < .001],
+plan [F (1, 182) = 32.18, η2 p = .15, P < .001], monitor [F (1, 182) = 11.96, η2 p = .06, P < .001], index of behavior regulation [F (1, 182) = 14.58, η2 p = .08, P < .001], metacognition [F (1, 182) = 27.86, η2 p = .13, P < .001], and the BRIEF GEC [F (1, 182) = 25.85, η2 p = .13, P < .001].
+
+Compared to LDOL group, ADHD children in the HDOL
+group had lower scores of cohesion [F (1, 182) = 4.10, η2 p = .02, P = .04], conflict [F (1, 182) = 13.03, η2 p = .07, P <
+.001], intellectual-cultural orientation [F (1, 182) = 8.84, η2 p =
+.05, P < .01], and active-recreational orientation [F (1, 182) =
+6.88, η2 p = .04, P < .01] on the FES-CV. Additionally, there were also significant group differences in the subscales of the PSOC, specifically on the items: parenting efficacy [F
+(1, 182) = 8.74, η2 p = .05, P < .01] and satisfaction [F (1, 182) = 16.46, η2 p = .08, P < .001].
+
+With regard to the results of children's and adolescents' self-rating scales, there were significant differences on initiative [F (1, 182) = 7.55, η2 p = .04, P < .01], interest [F (1, 182) = 4.73, η2 p = .03, P = .03], and goal [F (1, 182) = 6.90, η2 p = .04, P < .01], on the SLMC, between the 2 groups. In terms of emotional problems in children and adolescents, the results of the DSRSC [F (1, 182) = 6.62, η2 p = .04, P = .01]
+and SCARED [F (1, 182) = 5.09, η2 p = .03, P = .03] among children and adolescents with ADHD showed that the HDOL
+group scored worse than those in the LDOL group.
+
+In addition, this research also observed significant differences with regard to digital media usage and activity arrangement. Compared to ADHD children in the LDOL
+group, those in the HDOL group significantly spent more time on video games [F (1, 182) = 11.90, η2 p = .06, P = .001]
+and social software [F (1, 182) = 5.56, η2 p = .03, P = .02];
+and they also had a higher overall total time spent on digital media per day [F (1, 182) = 7.08, η2 p = .04, P < .01].
+
+Furthermore, those in the LDOL group also reported more frequently participating in various activities per week than the HDOL group, including spending more time on physical exercise [F (1, 182) = 8.59, η2 p = .05, P < .01], arts and music
+[F (1, 182) = 11.29, η2 p = .06, P = .001], science and culture [F (1, 182) = 21.26, η2 p = .11, P < .001], and other hobbies [F
+(1, 182) = 8.87, η2 p = .05, P < .01].
+
+## Discussion
+
+This study aimed to explore situation and difficulties of online learning during COVID-19 pandemic and the results found that the performance of online learning of children and adolescents with ADHD showed association with inattentionrelated behaviors, emotional states, EF, parenting and family environment, learning motivation, digital media usage, and extracurricular activities.
+
+## Inattention-Related Problems
+
+ADHD children in the HDOL group had more severe inattention-related problems during the online learning period of the epidemic, such as making careless mistakes in homework. Many studies have confirmed the relationship between the core symptoms of ADHD and the academic achievement of children as well as adolescents. Children with inattention-related problems also resulted in significant learning difficulties in mathematics, writing, and reading.38,39 These results were similar to the results of this research in regards to the performance of online learning among children and adolescents with ADHD. Over 47.5% of parents in this study reported that the attention of their children became worse during online learning when compared to their usual way of learning. There were 2 possible reasons for this.
+
+Firstly, because of the limitations associated with online courses, such as lacking a rich atmosphere conducive to learning, children might treat online learning as an informal class, and even as entertainment. Meaning they are hardly pay attention to learning, especially for those who are already faced with learning difficulties.13 Secondly, digital media is used to deliver online courses, and prolonged screen exposure could interfere with the ability to concentrate; however, there is still no definite conclusion on this influence.40,41 This suggest that parents and schools need to correct the attitude toward online learning and strengthen the supervision of ADHD children, which might in turn help improve attention during online learning.
+
+## Executive Function
+
+This study's results also showed that ADHD children in the HDOL group had significant impairments in each factor of EF. Several studies have confirmed the relationship between ADHD and executive dysfunction,42,43 leading to long-term learning difficulties.44 Online courses, that lack face-to-face teaching, require children to arrange their own learning, such as balancing their progression of their online learning and finishing their homework. About 43% of parents in this study reported that the efficiency and completion of homework, during their children's online learning period, was obviously worse than before, which is probably due to lack of ability to organize and plan (related to EF) among those who tended to have a poorer academic performance.45 Additionally, during online learning, children also should manage the usage of digital media by themselves. ADHD children with impaired self-control and behavioral inhibition of EF could hardly restrain their behaviors, which could further aggravate their difficulties during online learning, such as problem with time management, prioritizing tasks, and overfocusing on task at hand.46 These results indicated that an improvement of EF would not only improve academic performance but also help in online learning environment.
+
+## Emotional Problems
+
+Compared with the LDOL group, the HDOL group had more severe anxious and depressive problems. A previous study has proved a strong negative relationship between depression and academic achievement among children with ADHD.47 Another study showed that among children with specific learning difficulties, certain aspects of a positive school atmospheres, such as care and guidance from the teacher and a harmonious social relationship with others demonstrated a significant correlation with children's anxiety.48 During the COVID-19 lockdown, children could not go to school, and thus, it has become difficult for them to have the same positive experiences through the online learning environment. In addition, several studies have confirmed that ADHD
+children suffered from severe negative emotions due to COVID-19 epidemic outbreak restrictions.4,49 The above factors can cause children and adolescents with ADHD to have difficulties with the process of online learning. Although it is still to be determined if a causal relationship between experiences during online learning and negative emotions exists, schools and teachers should provide their students with a desirable learning platform and environment.
+
+## Family And Parenting Environment
+
+In this study, compared with the LDOL group, ADHD
+children in the HDOL group had a poorer family environment. In these families, there is less emotional communication between parents and children, and the sense of cohesion is lower. During the COVID-19 pandemic, the majority of Chinese parents encouraged their children to study online.5 Although previous research has shown that online learning can have a positive impact on students' academic performance, the attitudes of Chinese parents toward online learning remained generally negative.7,13 Parents also placed a greater importance on the supervision of online learning, hiding many potential factors that could cause conflicts between parents and children, such as children's oppositional behavior.50 Another research study revealed that in the group of ADHD children with learning difficulties, some of the parents believed correct understanding with regard to disorders and negative emotions could help them reestablish a harmonious and intimate relationship with their children,49 which could also help psychiatrist to guide a family-based treatment program.
+
+It is worth noting that the parents in the HDOL group also reported lower parenting efficacy and satisfaction. Thus, much attention should be paid to the difficulties faced by these parents. During this period, many parents have faced problems such as unemployment, financial distress, and social issues.51,52 Over 32.2% of parents in this study reported that it was difficult for them to do their own work while taking care of their child with ADHD. Furthermore, some features in online courses require parents to have certain technical knowledge, such as debugging equipment and online clock in, which may result in an extra burden for some parents.13 Consequently, during the COVID-19 pandemic, parents also need to effectively balance their work life as well as their own life, bearing in mind an adjustment of their own emotions, in order to better support their children to learn online at home.
+
+## Learning Motivation
+
+This study demonstrated that ADHD children and adolescents in the HDOL group had poorer learning motivations when compared to those in the LDOL group. The importance of learning goals and achievements motivates students' grades in different academic subjects.53 However, adolescents with ADHD significantly lacked the motivation and ability to set learning goals, which likely exacerbated poor learning performance.54 As an advanced learning approach, online learning, lack familiarity with the majority of children and adolescents. Compared with traditional courses, ADHD children and adolescents might need to put greater efforts into online learning and achievement.
+
+What needs to be specified is that the scales used in this study were designed to evaluate the children's intrinsic motivation of learning, such as interest and awareness.55 A
+previous study has shown that students who lack intrinsic motivation can improve their learning performance by increasing their extrinsic motivation, such as appropriate rewards and incentives.19 During the period of COVID-19 lockdown, ADHD children and adolescents have spent a lot of time with their parents, which has provided time for their parents to learn effective parenting skills to stimulate their children's learning motivation.
+
+## Digital Media Use And Extracurricular Activities
+
+In terms of digital media use, ADHD children and adolescents in the HDOL group spent significantly more time with various activities than those in the LDOL group, including video games and social software. Among students of different ages, several studies have shown a significant negative correlation between the cumulative use of digital media products and academic performance.56-58 During the COVID-19 epidemic, online learning naturally and inevitably made children and adolescents spend more time using digital media products, especially due to the lack of self-control among children with ADHD, which increased the risk of internet addiction.59 Additionally, in our study, over 30% of parents reported that management of media time has become more difficult than before. Although there were many dif-ficulties in balancing the use of media digital and online learning, it is still extremely necessary for parents to supervise their child's time spent online.60 There was also a significant lack of extracurricular activities in children and adolescents in the HDOL group.
+
+Several studies have shown physical exercise can have a positive influence on learning performance in children and adolescents with ADHD.61,62 During the COVID-19 lockdown, physical exercise for children and adolescents was affected,63 with reduced teaching resources preventing the school from carrying out regular physical education. However, many schools have encouraged physical exercise at home to maintain a healthy body while learning online.5 When it comes to artistic and scientific activities, another study proved that listening to pleasant music while performing an academic task helped students to overcome stressful emotions and maintain a better educational performance.64 Another study revealed that participating in schoolbased activities is linked to positive academic achievement.65 Although there are few relevant studies, children who are quarantined at home should be encouraged to get involved in other regular extracurricular activities.
+
+Although online learning environments have been rapidly developing and evolving during the COVID-19 pandemic in China, it is actually a novel teaching method that did not receive much attention until recently. As a special group of students, ADHD children and adolescents have many difficulties when learning online. Exploring the factors that are related to the adaptation of ADHD children to online learning therefore is clinically meaningful.
+
+This study has some limitations that need to be discussed.
+
+First, due to the prevention and control policy during the COVID-19 pandemic, it was difficult to recruit a normal control group through schools. Thus, the results of this study are applicable only to those children with ADHD. Secondly, the self-designed OLPI questionnaire has not been developed into a standardized assessment tool with high concurrent and discriminant validity and adequate reliability, this occurred because of the tight research time and lack of similar scales.
+
+Meanwhile, the questions in the OLPI scale were relatively subjective, which had a certain impact on our grouping. And the learning performance was only generally evaluated by parents of the children and adolescents with ADHD, lacking the teacher's evaluation and objective test scores as references. Additionally, comorbidities and medication were regarded as the confounding factors, and therefore, this research could only be used as a report on the current situation according to the former research, as it did not reveal the causality.66
+
+## Conclusion
+
+In general, this study demonstrated that among ADHD
+children and adolescents online learning is related to inattention-related behaviors, emotional state, EF, learning motivation, family and parenting environment, and arrangements of daily activities during quarantine. The results suggest parents as well as schools can do more to construct a healthy psychosocial environment for children and adolescents with ADHD to better adapt to online learning. For example, in this period, severe symptoms of ADHD and negative emotions should be managed by medication, promoting the development of EF, and by establishing a good parent–child relationship through some artistic and scientific activities.
+
+## Declaration Of Conflicting Interests
+
+The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
+
+## Funding
+
+The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by The Key Discipline Construction Project Mental Health and Psychiatry Three Years' Action of Shanghai Public Health System Construction Project grant number GWV-10.1-
+XK19.
+
+## Orcid Ids
+
+Shan He  https://orcid.org/0000-0002-5767-8993 Lan Shuai  https://orcid.org/0000-0002-4080-6012
+
+## References
+
+1. Dubey S, Biswas P, Ghosh R, et al. Psychosocial impact of COVID-19. Diabetes Metab Syndr. 2020;14(5):779-788. doi: 10.1016/j.dsx.2020.05.035.
+
+2. Shah K, Mann S, Singh R, Bangar R, Kulkarni R. Impact of COVID-19 on the mental health of children and adolescents.
+
+Cureus. 2020;12(8):e10051. doi: 10.7759/cureus.10051.
+
+3. Wang T, Liu K, Li Z, et al. Prevalence of attention deficit/
+hyperactivity disorder among children and adolescents in China: a systematic review and meta-analysis. BMC Psychiatry.
+
+2017;17(1):32. doi: 10.1186/s12888-016-1187-9.
+
+4. Zhang J, Shuai L, Yu H, et al. Acute stress, behavioural symptoms and mood states among school-age children with attention-deficit/hyperactive disorder during the COVID-19 outbreak. Asian J Psychiat. 2020;51:102077. doi: 10.1016/j. ajp.2020.102077.
+
+5. Wang G, Zhang Y, Zhao J, Zhang J, Jiang F. Mitigate the effects of home confinement on children during the COVID-19 outbreak. Lancet. 2020;395(10228):945-947. doi: 10.1016/
+S0140-6736(20)30547-X.
+
+6. Yokoyama S. Academic self-efficacy and academic performance in online learning: a mini review. Front Psychol. 2019;9:
+2794. doi: 10.3389/fpsyg.2018.02794.
+
+7. Clark AE, Nong H, Zhu H, Zhu R. Compensating for academic loss: online learning and student performance during the COVID-19 pandemic. China Economic Review, 2021, 68: 101629. doi: 10.1016/j.chieco.2021.101629.
+
+8. Singh V, Thurman A. How many ways can we define online learning? A systematic literature review of definitions of online learning (1988-2018). Am J Dist Educ. 2019;33(4):289-306. doi: 10.1080/08923647.2019.1663082.
+
+9. Silva PGdB, de Oliveira CAL, Borges MMF, et al. Distance learning during social seclusion by COVID-19: Improving the quality of life of undergraduate dentistry students. Eur J Dent Educ. 2021;25:124-134. doi: 10.1111/eje.12583.
+
+10. Robinson TN, Banda JA, Hale L, et al. Screen media exposure and obesity in children and adolescents. Pediatrics. 2017; 140(suppl 2):S97-S101): doi: 10.1542/peds.2016-1758K.
+
+11. Strasburger VC, Jordan AB, Donnerstein E. Health effects of media on children and adolescents. Pediatrics. 2010;125(4): 756-767. doi: 10.1542/peds.2009-2563.
+
+12. Nouwen M, Zaman B. Redefining the role of parents in young children's online interactions. A value-sensitive design case study. Int J Child Comput Interact 2018;18:22-26. doi: 10. 1016/j.ijcci.2018.06.001.
+
+13. Dong C, Cao S, Li H. Young children's online learning during COVID-19 pandemic: Chinese parents' beliefs and attitudes.
+
+Child Youth Serv Rev. 2020;118:105440. doi: 10.1016/j.
+
+childyouth.2020.105440.
+
+14. Becker SP, Breaux R, Cusick CN, et al. Remote learning during COVID-19: examining school practices, service continuation, and difficulties for adolescents with and without attentiondeficit/hyperactivity disorder. J Adolesc Health. 2020;67:
+769-777. doi: 10.1016/j.jadohealth.2020.09.002.
+
+15. Arnold LE, Hodgkins P, Kahle J, Madhoo M, Kewley G.
+
+Long-term outcomes of ADHD: academic achievement and performance. J Atten Disord. 2020;24(1):73-85. doi: 10.
+
+1177/1087054714566076.
+
+16. Wright MF. Cyberstalking victimization, depression, and academic performance: the role of perceived social support from parents. Cyberpsychol Behav Soc Netw. 2018;21(2):110-116.
+
+doi: 10.1089/cyber.2016.0742.
+
+17. Wang Y, Zhou X. Longitudinal relations between executive function and internalizing problems in grade school: the role of peer difficulty and academic performance. Dev Psychol. 2019; 55(10):2147-2158. doi: 10.1037/dev0000790.
+
+18. Zhang X, Hu BY, Ren L, Huo S, Wang M. Young Chinese children's academic skill development: identifying child-, family-, and school-level factors. New Dir Child Adolesc Dev. 2019;2019(163):9-37. doi: 10.1002/cad.20271.
+
+19. Liu Y, Hau KT, Liu H, Wu J, Wang X, Zheng X. Multiplicative effect of intrinsic and extrinsic motivation on academic performance: a longitudinal study of Chinese students. J Pers.
+
+2020;88(3):584-595. doi: 10.1111/jopy.12512.
+
+20. Yan H, Zhang R, Oniffrey T, et al. Associations among screen time and unhealthy behaviors, academic performance, and well-being in Chinese adolescents. Int J Environ Res Publ Health. 2017;14(6):596: doi: 10.3390/ijerph14060596.
+
+21. Kvalø SE, Dyrstad SM, Bru E, Brønnick K. Relationship between aerobic fitness and academic performance: the mediational role of executive function. J Sports Med Phys Fitness. 2019;59(8):1397-1404. doi: 10.23736/s0022-4707.18.
+
+08971-5.
+
+22. Barkley BA. Attention Deficit Hyperactivity Disorder: A Handbook for Diagnosis and Treatment. New York: The Guilfford Press; 1998.
+
+23. Yang L, Wang YF, Qian QJ, Gu BM. Primary exploration of the clinical subtypes of attention deficit hyperactivity disorder in Chinese children. Chin J Psychiarty. 2001;34(4):204-207. doi:
+10.3760/j:issn:1006-7884.2001.04.004.
+
+24. Zhou JB, Guo LT, Chen Y. Reliability and validity of the Chinese version of Swanson, Nolan, and Pelham Version IV
+Rating Scale-Parent Form for attention-deficit/hyperactivity disorder. Chinese J Child Health Care 2013;27(06):424-428. doi:10.3969/j.issn.1000-6729.2013.06.005.
+
+25. Gioia GA, Isquith PK, Guy SC, Kenworthy L. Behavior rating inventory of executive function. Child Neuropsychol. 2000; 6(3):235-238. doi: 10.1076/chin.6.3.235.3152.
+
+26. Qian Y, Wang YF. [Reliability and validity of behavior rating scale of executive function parent form for school age children in China]. Beijing Da Xue Xue Bao Yi Xue Ban. 2007;39(03):
+277-283. doi: 10.3321/j.issn:1671-167X.2007.03.015.
+
+27. Phillips MR, West CL, Shen Q, Zheng Y. Comparison of schizophrenic patients' families and normal families in China, using Chinese versions of FACES-II and the Family Environment Scales. Fam Process. 1998;37(1):95-106. doi: 10.
+
+1111/j.1545-5300.1998.00095.x.
+
+28. Tao JH, Jin FX, Zhang MR, Cheng ZH. Reliability and validity of FES-CV in the adolescent population. Chinese J Clin Psychol. 2015;23(6):1024-1027. doi: 10.16128/j.cnki.10053611.2015.06.015.
+
+29. Gibaud-Wallston J, Wandersman LP. The Parenting Sense of Competence Scale (PSOC). J Marriage Fam. 2001;2:166-167. doi: 10.1037/t01311-000.
+
+30. Zhang H, Liu XD, Wang QH, Yin DD, Chen X. Research progress of international and national parenting competence.
+
+Chinese J Modern Nursing. 2016;22(16):2361-2363. doi: 10.
+
+3760/cma.j.issn.1674-2907.2016.16.043.
+
+31. Chen YQ, Xu J. Influence of learning motivation on self-esteem of high school students and mediating effect of coping style. J
+Bio Educ. 2020;8(2):129-133. doi: 10.3969/j.issn.2095-4301.
+
+2020.02.009.
+
+32. Birleson P. The validity of depressive disorder in childhood and the development of a self-rating scale: a research report. J Child Psychol Psychiatry. 1981;22(1):73-88. doi: 10.1111/j.14697610.1981.tb00533.x.
+
+33. Su LY, Wang K, Zhu Y, Luo XR, Yang ZW. Norm of the depression self-rating scale for children in Chinese urban children. Chinese Mental Health J. 2003;17(08):547-549. doi:
+10.3321/j.issn:1000-6729.2003.08.011.
+
+34. Birmaher B, Khetarpal S, Brent D, et al. The Screen for Child Anxiety Related Emotional Disorders (SCARED): scale construction and psychometric characteristics. J Am Acad Child Adolesc Psychiatry. 1997;36(4):545-553. doi: 10.
+
+1097/00004583-199704000-00018.
+
+35. Wang K, Su LY, Zhu Y. Norms of the screen for child anxiety related emotional disorders in Chinese urban children. Chinese J Clin Psychol. 2002;10(04):270-272. doi: 10.3969/j.issn.
+
+1005-3611.2002.04.009.
+
+36. Chen Y. Design and analysis of learning difficulty index of distance learners. Distance Education In China. 2009;0(06): 38-41. doi: 10.3969/j.issn.1009-458X.2009.06.008.
+
+37. Cohen J. CHAPTER 8 - F tests on means in the analysis of variance and covariance. In: Cohen J, ed. Statistical Power Analysis for the Behavioral Sciences: New York: Academic Press; 1977:273-406.
+
+38. Galera C, Melchior M, Chastang J-F, Bouvard M-P, Fombonne ´
+E. Childhood and adolescent hyperactivity-inattention symptoms and academic achievement 8 years later: the GAZEL
+Youth study. Psychol Med. 2009;39(11):1895-1906. doi: 10. 1017/s0033291709005510.
+
+39. Salla J, Michel G, Pingault JB, et al. Childhood trajectories of inattention-hyperactivity and academic achievement at 12 years. Eur Child Adolesc Psychiatry. 2016;25(11):1195-1206.
+
+doi: 10.1007/s00787-016-0843-4.
+
+40. Ra CK, Cho J, Stone MD, et al. Association of digital media use with subsequent symptoms of attention-deficit/hyperactivity disorder among adolescents. JAMA. 2018;320(3):255-263.
+
+doi: 10.1001/jama.2018.8931.
+
+41. Nikkelen SWC, Valkenburg PM, Huizinga M, Bushman BJ.
+
+Media use and ADHD-related behaviors in children and adolescents: a meta-analysis. Dev Psychol. 2014;50(9):
+2228-2241. doi: 10.1037/a0037318.
+
+42. Shuai L, Chan RCK, Wang Y. Executive function profile of Chinese boys with attention-deficit hyperactivity disorder:
+different subtypes and comorbidity. Arch Clin Neuropsychol.
+
+2011;26(2):120-132. doi: 10.1093/arclin/acq101.
+
+43. Zhang H-F, Shuai L, Zhang J-S, et al. Neuropsychological profile related with executive function of Chinese preschoolers with attention-deficit/hyperactivity disorder: neuropsychological measures and behavior rating scale of executive function-preschool version. Chin Med J. 2018;131(6):648-656. doi: 10.4103/03666999.226893.
+
+44. Chu FW, vanMarle K, Hoard MK, Nugent L, Scofield JE,
+Geary DC. Preschool deficits in cardinal knowledge and executive function contribute to longer-term mathematical learning disability. J Exp Child Psychol. 2019;188:104668. doi: 10.1016/j.jecp.2019.104668.
+
+45. Langberg JM, Epstein JN, Girio-Herrera E, Becker SP, Vaughn AJ, Altaye M. Materials organization, planning, and homework completion in middle-School students with ADHD: impact on academic performance. School Mental Health. 2011;3(2):
+93-101. doi: 10.1007/s12310-011-9052-y.
+
+46. Mathews CL, Morrell HER, Molle JE. Video game addiction, ADHD symptomatology, and video game reinforcement. Am J Drug Alcohol Abuse. 2019;45(1):67-76. doi: 10.
+
+1080/00952990.2018.1472269.
+
+47. Visser L, Linkersdorfer J, Rothe J, G ¨ orgen R, Hasselhorn M, ¨
+Gerd Schulte-Korne G. The role of ADHD symptoms in the ¨
+relationship between academic achievement and psychopathological symptoms. Res Dev Disabil. 2020;97 103552. doi: 10.
+
+1016/j.ridd.2019.103552.
+
+48. Chiappedi M, Baschenis IM. Specific learning disorders and anxiety: a matter of school experience? Minerva Pediatr. 2016; 68(1):51-55.
+
+49. Bobo E, Lin L, Acquaviva E, et al. [How do children and adolescents with Attention Deficit Hyperactivity Disorder (ADHD)
+experience lockdown during the COVID-19 outbreak?] Encephale. 2020;46(3S):S85-S92. doi: 10.1016/j.encep.2020.05.011.
+
+50. Ghosh R, Dubey M J, Chatterjee S, Dubey S. Impact of COVID
+-19 on children: special focus on the psychosocial aspect.
+
+Minerva Pediatr. 2020;72(3):226-235. doi: 10.23736/s00264946.20.05887-9.
+
+51. Lawson M, Piel M H, Simon M. Child maltreatment during the COVID-19 pandemic: consequences of parental job loss on psychological and physical abuse towards children. Child Abuse Neglect. 2020;110;104709. doi: 10.1016/j.chiabu.2020.104709.
+
+52. Prime H, Wade M, Browne DT. Risk and resilience in family well-being during the COVID-19 pandemic. Am Psychol. 2020; 75(5):631-643. doi: 10.1037/amp0000660.
+
+53. Steinmayr R, Weidinger AF, Schwinger M, Spinath B. The importance of students' motivation for their academic achievement - replicating and extending previous findings.
+
+Front Psychol. 2019;10:1730. doi: 10.3389/fpsyg.2019.01730.
+
+54. Sibley MH, Graziano PA, Ortiz M, Rodriguez L, Coxe S. Academic impairment among high school students with ADHD: the role of motivation and goal-directed executive functions. J Sch Psychol. 2019;77 67-76. doi: 10.1016/j.jsp.2019.10.005.
+
+55. Cook DA, Artino AR Jr. Motivation to learn: an overview of contemporary theories. Med Educ. 2016;50(10):997-1014. doi: 10.1111/medu.13074.
+
+56. Mundy LK, Canterford L, Hoq M, et al. Electronic media use and academic performance in late childhood: a longitudinal study. PloS One. 2020;15(9):e0237908. doi: 10.1371/journal.
+
+pone.0237908.
+
+57. Sampasa-Kanyinga H, Chaput J-P, Hamilton HA. Social media use, school connectedness, and academic performance among adolescents. J Prim Prev. 2019;40(2):189-211. doi: 10.1007/
+s10935-019-00543-6.
+
+58. Adelantado-Renau M, Moliner-Urdiales D, Cavero-Redondo I,
+Beltran-Valls MR, Mart´ınez-Vizca´ıno V, Alvarez-Bueno C. ´
+Association between screen media use and academic performance among children and adolescents: a systematic review and meta-analysis. JAMA Pediatrics. 2019;173(11):
+1058-1067. doi: 10.1001/jamapediatrics.2019.3176.
+
+59. Ko C-H, Yen J-Y, Chen C-S, Yeh Y-C, Yen C-F. Predictive values of psychiatric symptoms for internet addiction in adolescents: a 2-year prospective study. Arch Pediatr Adolesc Med.
+
+2009;163(10):937-943. doi: 10.1001/archpediatrics.2009.159.
+
+60. Chen I-H, Chen C-Y, Pakpour AH, Griffiths MD, Lin C-Y.
+
+Internet-related behaviors and psychological distress among schoolchildren during COVID-19 school suspension. J Am Acad Child Adolesc Psychiatry. 2020;59(10):1099-1102.e1. doi: 10.
+
+1016/j.jaac.2020.06.007.
+
+61. Pontifex MB, Saliba BJ, Raine LB, Picchietti DL, Hillman CH.
+
+Exercise improves behavioral, neurocognitive, and scholastic performance in children with attention-deficit/hyperactivity disorder. J Pediatr. 2013;162(3):543-551. doi: 10.1016/j. jpeds.2012.08.036.
+
+62. Ramer JD, Santiago-Rodr´ıguez ME, Davis CL, Marquez DX,
+Frazier SL, Bustamante EE. Exercise and academic performance among children with attention-deficit hyperactivity disorder and disruptive behavior disorders: a randomized controlled trial. Pediatr Exerc Sci. 2020;32:140-149. doi: 10. 1123/pes.2019-0224.
+
+63. Xiang M, Zhang Z, Kuwahara K. Impact of COVID-19 pandemic on children and adolescents' lifestyle behavior larger than expected. Prog Cardiovasc Dis. 2020;63(4):531-532. doi: 10.1016/j.pcad.2020.04.013.
+
+64. Arnaud C, Perlovsky L, Bonniot-Cabanac M-C, Cabanac M.
+
+Music and academic performance. Behav Brain Res. 2013;256 257-260. doi: 10.1016/j.bbr.2013.08.023.
+
+65. Knifsend CA, Camacho-Thompson DE, Juvonen J, Graham S.
+
+Friends in activities, school-related affect, and academic outcomes in diverse middle schools. J Youth Adolesc. 2018;47(6):
+1208-1220. doi: 10.1007/s10964-018-0817-6.
+
+66. Shuai L, He S, Zheng H, et al. Influences of digital media use on children and adolescents with ADHD during COVID-19 pandemic. Global Health. 2021;17(1):48. doi: 10.1186/
+s12992-021-00699-z.

medical/md/PMC8600055.md

@@ -0,0 +1,244 @@
+Open Access Full Text Article
+
+# O R I G I N A L R E S E A R C H Thrombospondin 2 Promotes Il-6 Production In Osteoarthritis Synovial Fibroblasts Via The Pi3K/ Akt/Nf-Κb Pathway
+
+Chun-Han Hou1 Chih-Hsin Tang2–5 Po-Chun Chen 5–7 Ju-Fang Liu7,8 1Department of Orthopedic Surgery, National Taiwan University Hospital, Taipei City, Taiwan; 2School of Medicine, China Medical University, Taichung, Taiwan; 3Graduate Institute of Biomedical Science, China Medical University, Taichung, Taiwan; 4Chinese Medicine Research Center, China Medical University, Taichung, Taiwan; 5Department of Biotechnology, College of Health Science, Asia University, Taichung, Taiwan; 6Translational Medicine Center, Shin-Kong Wu Ho-Su Memorial Hospital, Taipei City, Taiwan; 7Department of Medical Research, China Medical University Hospital, China Medical University, Taichung, Taiwan; 8School of Oral Hygiene, College of Oral Medicine, Taipei Medical University, Taipei, Taiwan Correspondence: Ju-Fang Liu; Po-Chun Chen School of Oral Hygiene, College of Oral Medicine, Taipei Medical University, No. 250 Wu-Hsing Street, Taipei, 11031, Taiwan Tel +8862-27361661 Ext. 5110 Email jufangliu@tmu.edu.tw; blibra1002@gmail.com Background: It is known that osteoarthritis (OA) pathogenesis involves inflammation that drives pathologic changes and that the matricellular protein, thrombospondin-2 (TSP2), is involved in angiogenesis, carcinogenesis, and inflammation. However, how TSP2 contributes to OA inflammatory processes is unclear.
+
+Objective: The aim of current study was to elucidate whether TSP2 could promote interleukin6 (IL-6), a pro-inflammatory cytokine, expression in osteoarthritis synovial fibroblasts (OASFs).
+
+Methods: The synovial fibroblasts isolated from osteoarthritis and healthy donors were incubated with recombinant TSP2 to evaluate its effect in OA pathogenesis. The SFs were incubated with recombinant TSP2, followed by determining the IL-6 expression by qPCR and Western blot. After SFs were incubated with TSP2 for different time interval, the Western blot was performed to investigate the activation of signal pathway. The different strategies including neutralizing antibodies, siRNAs, and chemical inhibitors were used to discover the signal transduction in response to TSP2 incubation in OASFs. To evaluate the therapeutic potential of TSP2 in osteoarthritis, the anterior cruciate ligament transection (ACLT) in SD rats was performed in the presence or absence of TSP neutralizing antibody treatment.
+
+Results: Our investigations have revealed that TSP2 promoted IL-6 expression in OASFs in a dose-dependent manner, especially in 30 and 100 ng/mL concentration (p < 0.05). Using different strategies including neutralizing antibodies, siRNAs, and chemical inhibitors, all of which attenuated signal pathway components in OASFs, we found evidence for the involvement of integrin αvβ3, PI3K, Akt, and NF-κB in TSP2-mediated upregulation of IL-6 (p < 
+0.05). Finally, in the result of rat ACLT surgical model, we found that TSP2 neutralizing antibody had protective effects in cartilage destruction during OA progression.
+
+Conclusion: Thrombospondin-2 palys an important role in osteoarthritis pathogenesis and provides an opportunity to deal with osteoarthritis.
+
+Keywords: TSP2, osteoarthritis, integrin αvβ3, IL-6
+
+## Introduction
+
+The degenerative joint disease, osteoarthritis (OA), affects mainly people from middle-age onwards1 and most often afflicts the hands and knees, hips, and spine.2,3 There are also earlier forms of OA. The multifactorial etiology of OA 
+includes occupational and nonoccupational (ie, joint injury, obesity, aging, and heredity) factors.4,5 OA joints are characterized by severe synovial inflammation, abrasive wear at the cartilage surface, thickening of the subchondral bone, and the development of osteophytes.6 Besides this, OA has been also described as a chronic inflammatory disease caused by an increase of inflammatory mediators.7 Major 
+
+| Journal of Inflammation Research 2021:14 5955–5967                                                                                                                                                                                                                                                                                           | 5955   |
+|----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|--------|
+| © 2021 Hou et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php  and incorporate the Creative Commons Attribution - Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work |        |
+| you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For  permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).                    |        |
+
+contributing factors to the pathogenesis of OA include the extracellular matrix (ECM) degrading enzyme such as the matrix metalloproteinases (MMPs) and ADAMTS-5 (ADAM metallopeptidase with thrombospondin type 1 motif 5), the proinflammatory cytokines interleukin-1 beta (IL-1β), IL-6, and tumor necrosis factor-alpha 
+(TNF-α), as well as Wnt signaling regulating bone formation and regeneration.8–11 Understanding the mechanisms responsible for the destruction of joint tissue in OA and identifying the key factors involved will identify new targets for therapy and enable the development of new therapies that not just treat the symptoms, but slow the disease progression.
+
+Cartilage oligomeric matrix protein (COMP/thrombospondin [TSP]-5), a glycoprotein that belongs to the thrombospondin family, is one of the most studied markers of cartilage degradation as well as joint degeneration.12,13 An elevated level of COMP/TSP5 was found in serum and synovial fluid and associated with the degree of cartilage destruction and disease progression in osteoarthritis.14–16 Besides COMP/TSP5, the other members of the thrombospondin family are also associated with osteoarthritis progression. For instance, increased levels of TSP1 expression were found in human cartilage with early OA, as well as substantially reduced TSP1 synthesis and TSP1 protein staining in severe OA, compared with normal cartilage.17 The other report showed that TSP1 exhibited protective effects against osteoarthritis by indirect interaction with adipose stem cells, subsequently reducing inflammation of chondrocytes.18 TSP4 expression was found to upregulate in OA keen cartilage and associated with disease severity.19 These evidence reveal that the TSP 
+family, a matricellular protein with various functions, has an important role in the homeostasis of chondrocyte as well as in OA pathogenesis.
+
+The loss of cartilage tissue in OA is due to the degradation of the ECM, which is influenced in part by a lack of the matricellular protein TSP2, an essential component in the proper assembly of the ECM,20 endothelial cell proliferation, migration, and differentiation.21–23 TSP2-null mice exhibit connective tissue abnormalities including lax tendons and ligaments, abnormal collagen fibrils in the skin and tendons, and prolonged bleeding times.24 Embryonic tissues from TSP2-null mice reveal TSP2 expression in chondrogenic, osteogenic, vasculogenic cells, dermal fibroblasts, and other connective tissueforming cells.25,26 In adult tissue, TSP2 is found almost solely in the pericellular environment of cells.24 Moreover, compared with normal littermates, increased numbers of endocortical osteoblasts in TSP2-null mice mean that they have thicker cortical bones, with higher endocortical bone formation rates and an overall increased periosteal mineralizing surface.27,28 Previous report provided evidence that TSP2 served as regulator of inflammation in rhumatoid arthritis.29 However, this study only provided pathologic evidence and clinical revelance of TSP2 in rhumatoid arthritis.
+
+Although many evidences support a pathogenic role for the other members among the TSP family in arthritis, more remains to be clarified as to the molecular connections between TSP2 and arthritis. Here, we found increased expression of TSP2 in OASFs compared with NSFs. We also verified the therapeutic response of TSP2 neutralizing antibody by using in vivo OA model. These evidence provided potential for clinical application of TSP2 in OA.
+
+## Materials And Methods Materials
+
+Invitrogen (Carlsbad, CA, USA) supplied fetal bovine serum (FBS; Cat. No. 26140079), Dulbecco's Modified Eagle Medium (DMEM; Cat. No. 12100046), and Lipofectamine 3000 (Cat. No. L3000015). Corning (NY, USA) supplied all cell culture materials including dishes and well plates. Millipore (Billerica, MA, USA) supplied polyvinylidene difluoride (PVDF) membranes and chemiluminescent HRP Substrate (ECL). Santa Cruz Biotechnology (Santa Cruz, CA, USA) supplied antibodies against PI3K (Cat. No. sc-1637), Akt (Cat. No. sc-5298), IκB (Cat. No. sc-1643), IKKα/β (Cat. No. sc-7607), p65 
+(Cat. No. sc-8008), integrin avb3 (Cat. No. sc-7312) and βactin (Cat. No. sc-47778). The antibodies against phosphoPI3K (Tyr458/199) (Cat. No. \#4228), phospho-Akt (ser473) 
+(Cat. No. \#9271), phospho-IKKα/β (ser176/180) (Cat. No. \#2697), phospho-IκBα (ser32/36) (Cat. No. \#9246) and phospho-p65 (ser536) (Cat. No. \#3033) were provided by Cell Signaling and Neuroscience (Danvers, MA, USA). 
+
+Sigma-Aldrich (St. Louis, MO, USA) provided the chemical inhibitors used in current study, including Wortmannin 
+(Cat. No. W1628), LY294002 (Cat. No. L9908), AktI (Cat. No. A6730), TPCK (Cat. No. T4376), and PDTC (Cat. No. P8765). R&D Systems (Minneapolis, MN, USA) supplied recombinant human TSP2 (Cat. No. 1635-T2-050). 
+
+shRNAs for integrins αv and β3 and their respective controls were obtained from the National RNAi Core Facility Platform (RNAi Core, Academia Sinica, Taiwan). 
+
+Stratagene (La Jolla, CA, USA) provided the NF-κB luciferase plasmid. Dr. Wen-Mei Fu (National Taiwan University, Taipei, Taiwan) kindly gifted the dominantnegative mutants of p85 and Akt. Promega (Madison, MA, USA) supplied the pSV-β-galactosidase vector and the luciferase assay kit. The chemicals used in the current research were supplied by Sigma-Aldrich (St. Louis, MO, USA).
+
+## Clinical Samples
+
+The Institutional Review Board (IRB) of Shin Kong Wu Ho-Su Memorial Hospital (Approval No. 20161209R) and China Medical University (Approval No. CMUH108- 
+REC3-039) granted study approval and each study participant provided written informed consent. All methods were conducted in accordance with the provisions of the Declaration of Helsinki, as well as the IRB's guidelines and regulations. Clinical samples were collected from patients meeting the following inclusion criteria: (1) aged over 20 years presenting with an accidental or sports injury requiring joint replacement and repair; or (2) degenerative arthritis. Exclusion criteria specified patients who did not satisfy either of these two categories. Synovial specimens were collected from donors with OA who have knee replacement surgery (OASFs) and nonarthritic synovial tissues obtained from healthy donors undergoing arthroscopy after trauma/joint derangement (NSFs).
+
+## Cell Cultures
+
+The NSFs and OASFs cells were collected and maintained according to previous study procedures.30–32 Fresh synovial tissues were finely minced and digested in DMEM 
+containing 2 mg/mL type II collagenase (Sigma-Aldrich, St. Louis, MO, USA) for 4 h at 37°C and under 5% CO2. 
+
+After incubation with collagenase, the synovial fibroblasts were harvested by filtering through 70 μM nylon filters, centrifugation, and maintained in DMEM supplied with 10% FBS, 100 µg/mL streptomycin, and 100 U/mL penicillin. The cells were kept in a CO2 incubator at 37°C and 5% CO2. As previous study described,33 after isolating the cells from synovial tissues, the cells were characterized by immunofluorescence staining using antibody against vimentin, a typical fibroblast's marker. More than 95% of the cells were fibroblasts. The synovial fibroblasts from passages of four to nine were used for the experiments.
+
+## Rna Extraction And Quantitative Real-Time Pcr
+
+The RNA of the treated cells was extracted by an easyBLUE™ Extraction Kit (iNTRON Biotechnology, Seoul, Korea). The total 2 μg RNA was used to synthesize cDNA by reverse transcription reaction using M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). SYBR Green Mastermix (KAPA Biosystem, Woburn, MA, USA) was used to perform quantitative real-time PCR (qPCR) analysis on StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The running protocol was 10 min at 95 °C, 15 s at 95 °C for 40 cycles, and finally 60 s at 60 °C. The primers used for detecting target genes were obtained from SigmaAldrich (St. Louis, MO, USA). Relative expressions of target genes were normalized to endogenous control GAPDH by using 2 ΔΔCt Method. All data shown were representative of three independent experiments. The sequence information of primers was provided in Supplementary Table 1.
+
+## Western Blot
+
+Total proteins were extracted from the cells treated as indicated conditions by using RIPA buffer. Protein quantification and normalization were conducted by using a Thermo Scientific Pierce BCA Protein Assay Kit (Thermo Fisher Scientific Inc., Waltham, USA). Proteins were loading to SDS-PAGE and running with 100 V for 90 mins, followed by transferring to PVDF membranes. The membranes were blocked with blocking buffer containing 5% BSA for 1 h at room temperature, followed by incubated the membranes with primary antibodies (1:1000) overnight at 4°C. After 3 washes by TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5000) for 1 h at room temperature. The membranes were stained by Amersham™ ECL™ Western Blotting Detection Reagents (GE Healthcare Life Sciences, Marlborough, MA, USA) and monitored by using a UVP ChemiDoc-It Imaging System (UVP Inc., Upland, CA, USA).
+
+## Transfection And Reporter Gene Assay
+
+The reporter gene assay was used to monitor NF-κB transcriptional activity as described previously.34 Briefly, cells grown in 24 well plates were transfected with 0.8 µg reporter vector including NF-κB response element and 0.4 µg β-galactosidase expression vector by Lipofectamine® 3000 (LF3000; Invitrogen). 24-hour posttransfection, the cells were further treated with the indicated condition. Finally, the cells were lysed by reporter lysis buffer (Promega, Madison, WI, USA). The 20 μL lysates were mixed with 80 μL luciferase assay buffer (Promega), followed by detection of luminescence by using a microplate luminometer. The activity of βgalactosidase was used to evaluate transfection efficiency and in normalization of luciferase activity.
+
+## Immunofluorescence Staining
+
+The cells grown in 8 well chamber slides were treated with the indicated condition. For immunofluorescence staining, the cells were fixed by 4% paraformaldehyde for 30 mins at room temperature, incubated in BSA blocking buffer containing 0.05% Triton X-100 for 30 mins at room temperature. Subsequently, the cells were incubated with p65 antibody (1:100) overnight at 4°C. After 3 times washing with PBS, the cells were further incubated with FITCconjugated secondary antibody (1:100) for 1 h at room temperature (Leinco Technology Inc., St. Louis, MO, 
+USA). Finally, the immunofluorescence signal was monitored by using a Nikon Ti2-E microscope system.
+
+## Aclt Animal Model
+
+All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Shin Kong Wu Ho-Su Memorial Hospital (Approval No. 
+
+MOST1060009). All animal experimental procedures followed the Guide for the Care and Use of Laboratory Animals (Council of Agriculture, Executive Yuan, Taiwan). All experimental procedures were performed by two of the study authors, PC Chen and JF Liu, who have excellent experience in performing and replicating this animal model. The small sample size was chosen because the response of TSP2 neutralized antibody was investigated in OA animal model first time. A total of 25 male Sprague-Dawley (SD) rats (8 weeks) were purchased from the National Laboratory Animal Center (Taipei, Taiwan) and used for this study. The rats were randomly assigned to different groups; a) sham operation (n = 7), b) ACLT operation without treatment (n = 7), c) ACLT operation with TSP2 neutralizing antibody treatment (n = 7). Briefly, after animals were anesthetized with inhaled isoflurane and the joint capsules were opened, the ACL fibers were transected with a scalpel and the entire medial meniscus was excised using a medial parapatellar mini-arthrotomy. 
+
+After surgery, the joints were washed with sterile PBS and sutured. The rats received 7 days of ampicillin treatment (50 mg/kg). The 4 rats were excluded because of the poor wound healing after surgery. One week later, they were administered an intra-articular injection of PBS (50 μL) 
+containing a TSP2 neutralizing antibody (10 μg/mL); this was repeated after 1 week. All rats were allowed to move freely in plastic cages and were sacrificed 4 weeks after the ACLT procedure. PC Chen and JF Liu, who performed the operation were the only investigators aware of the experiment allocation. The research assistant (unaware of treatment) was responsible for the animal sacrifice, tissue collection, and histological analysis including Safranin O/ fast green staining, immunohistochemistry staining, and ORASI score.
+
+## Histological Analysis
+
+Paraffin-embedded sections were prepared from sacrificed rats. The sections were subjected to Safranin O/fast green staining to evaluate cartilage degradation, or incubated with a specific antibody against IL-6, as per our previous protocol.22 IL-6 antibody in the sections was detected by the NovoLink Polymer Detection Systems kit (Leica Biosystems, Wetzlar, Germany), according to the manufacturer's protocol.
+
+For Safranin O/fast green staining, briefly, the sections were stained with Safranin O/fast green, hematoxylin, and eosin to investigate the histopathological changes of all experiment groups under a light microscope. The cartilage destruction was evaluated according to the OARSI score system established by the International Association for Osteoarthritis Research.35 The OARSI score system includes 6 grades (Grade 0 = no cartilage degeneration; Grade 1 = Minimal degeneration, 5–10% of the total projected cartilage area affected by matrix or chondrocyte loss; Grade 2 = Mild degeneration, 11–25% affected; Grade 3 = Moderate degeneration, 26–50% affected; Grade 4 = Marked degeneration, 51–75% affected; Grade 5 = Severe degeneration, greater than 75% 
+affected). The scoring was evaluated blindly by two individuals and the scores were averaged to minimize observer bias.
+
+## Statistical Analysis
+
+Statistical data were analyzed using SigmaPlot version 12.0 (Systat Software, Inc., San Jose, CA). All values reported are means ± standard deviations (S.D) of independent experiments. Statistical analysis of two samples was performed using the Student's t-test. In the case of the experiment groups more than two groups, statistical analysis was performed using one-way analysis of variance (ANOVA) with the Fisher's Least Significant Difference (LSD) post-hoc test. In all cases, p < 0.05 presented statistical significance.
+
+## Results
+
+![4_Image_0.Png](4_Image_0.Png) Tsp2 Induced Significant Increases In Il-6 Expression
+
+As shown in Figure 1A and B, evidence from Western blot and qPCR assays reveals higher levels of TSP2 protein and mRNA expression in OASFs than in human normal synovial fibroblasts (NSFs). As previous research has shown high quantities of proinflammatory cytokines (IL-1β, IL-6, and TNF-α) as well as endothelial adhesion molecules (ICAM-1 and VCAM-1) in OA fibroblast lines,36 consistent with our resuts (Supplementary Figure 1). Therefore, we hypothesized that the same phenomenon might be observed in TSP2-directed OA pathogenesis. The levels of IL-6 expression were significantly higher than those for all other molecules (Figure 1D), whereas TSP2 had no effect upon IL-6 expression in NSFs (Figure 1C). TSP-induced increases in IL-6 expression were concentration-dependent (Figure 1E and F). These data suggest that OASFs are more sensitive than normal SFs to TSP2 and that TSP2 effectively increases IL-6 production in OASFs.
+
+## A Tsp2/Integrin Αvβ3 Interaction Was Linked To Il-6 Expression In Oasfs
+
+TSP2 is reported to interact with various integrins to exert its biological functions, including integrin αvβ3, 22,37,38 α4β1, 39 and β1.
+
+40 The TSP2 arginine-glycine-aspartic acid sequence interacts with cell-associated integrin ανβ3 and heparan sulfate proteoglycans and also binds to the low-density lipoprotein receptor-related protein that modulates TSP2 concentrations in the pericellular environment via endocytotic and lysosomal protein degradation processes.41 Our results found that both basal expression levels of integrin αν and β3 were higher in OASFs than NSFs (Figure 2A), 
+suggesting their important role in OA pathogenesis. We, therefore, examined the effect of integrin ανβ3 neutralization upon TSP2-induced increases in IL-6 expression in human OASFs. Our data show that the integrin ανβ3 antibody 
+
+![5_image_0.png](5_image_0.png)
+
+substantially inhibited such increases (Figure 2B and C). This process was dramatically inhibited when OASFs were transfected with integrin αν and integrin β3 shRNAs 
+(Figure 2D). Thus, it appears that the effects of TSP2 upon IL-6 expression occur via the activation of integrin ανβ3.
+
+## Tsp2-Mediated Il-6 Production Involves Pi3K/Akt Signaling
+
+The PI3K/Akt signaling pathway is one of several that are activated by the engagement of integrin ανβ3 with its ligand.42 Furthermore, IL-6 expression in prostate cancer cells and human lung fibroblasts is mediated by PI3K/Akt signaling.43,44 We, therefore, examined whether TSP2induced increase of IL-6 expression involves PI3K and Akt signaling. Pretreatment with LY294002, Wortmannin, and AktI all markedly reduced the effects of TSP2 upon IL-6 expression in OASFs (Figure 3A–C), while TSP2 treatment significantly increased p85 and Akt phosphorylation (Figure 3D). The OASFs which transfected with a p85 or an Akt dominant-negative (DN) mutant showed obvious inhibition of TSP-2-induced IL-6 expression (Figure 3E). Thus, blocking PI3K and Akt activity appears to inhibit TSP2-mediated IL-6 expression. Moreover, these findings indicate that TSP2 stimulates IL-6 production via the activation of integrin ανβ3, which subsequently activates the PI3K/ 
+Akt signaling pathway in OASFs.
+
+## Nf-Κb Is Involved In Tsp2-Induced Stimulation Of Il-6 Expression
+
+NF-κB activation can induce IL-6 in various cell types.45 To examine whether NF-κB activity in the signaling pathway mediates TSP2-induced increases in IL-6 expression, OASFs were pretreated separately with the NF-κB inhibitor (PDTC; 5 µM) and IκB protease inhibitor (TPCK; 5 µM) before TSP2 application. The data showed that pretreatment with inhibitors of NF-κB signal cascade dramatically abrogated IL-6 mRNA and protein expression in response to TSP2 incubation (Figure 4A and B). 
+
+![6_image_0.png](6_image_0.png)
+
+Moreover, TSP2 treatment time-dependently upregulated IKKα/β, IkBα, and p65 phosphorylation in OASFs (Figure 4C). Upon IKKα and IKKβ mutant transfection, TSP2-induced stimulation of IL-6 expression was significantly reduced in OASFs (Figure 4D).
+
+Pretreatment with integrin αvβ3 monoclonal antibody 
+(mAb), LY294002, Wortmannin, and AktI all reversed the nuclear translocation of p65, which was induced by TSP2 incubation in OASFs (Figure 5A), and abolished phosphorylation of the NF-κB signaling cascade (Figure 5B). 
+
+We also found that TSP2 stimulated NF-κB promoter activity (Figure 5C), which was abolished when the OASFs were pretreated with integrin αvβ3 mAb, LY294002, Wortmannin, and AktI (Figure 5D). Our evidence suggests that TSP2-mediated increases of IL-6 expression in human OASFs are dependent upon integrin αvβ3 and PI3K/Akt-NF-κB pathway activation.
+
+## Tsp2-Targeting Therapy Alleviates Aclt-Induced Osteoarthritis In Vivo
+
+Finally, to confirm the therapeutic value of TSP2 in OA, IL-6 expression was assessed in the presence of TSP2 mAb. The results indicated that TSP2 neutralizing antibody dose-dependently abolished IL-6 expression in OASFs (Figure 6A and B). Meanwhile, the ACLTinduced OA in rat model,46 an animal model suitable for evaluating OA pathogenesis, was conducted to evaluate whether TSP2 target therapy could alleviate OA progression in vivo. Our result showed that treatment with TSP2 neutralizing antibody attenuated articular cartilage 
+
+Hou et al **Dovepress**
+
+![7_image_0.png](7_image_0.png)
+
+degradation and IL-6 expression, as proved by Safranin O/ fast green staining and immunohistochemistry respectively (Figure 6C–E), demonstrating the therapeutic potential of TSP2 in OA progression in vivo.
+
+## Discussion
+
+TSP2 was proposed as prognosis marker in liver fibrosis,47,48 non-alcoholic fatty liver disease,49 and different cancers.50–53 This study demonstrates that TSP2 is an important player in OA pathogenesis, with a positive correlation observed between TSP2 expression and synovial tissue inflammation, suggesting TSP2 could been developed as novel osteoarthritis marker. The pre-clinical experiments, which utilized TSP2 neutralizing antibody to ameliorate cartilage destruction in OA animal model, also showed the promising response. The results provided therapeutic opportunity of TSP2 in OA treatment.
+
+Evidence implicates TSP2 in the regulation of various biological processes, such as thrombosis,54 angiogenesis,55 proteolytic enzyme release, control of inflammatory cell influx, and activation of the inflammatory response.56,57 Previous research has demonstrated TSP involvement in OA pathogenesis, such as TSP1,17 and a positive correlation between levels of TSP4 protein expression and disease severity.19 Moreover, TSP2 displays antiangiogenic activity and suppresses autoimmune inflammation in RA 
+synovial tissue.29 COMP/TSP5 is also a well-established cartilage destruction marker in osteoarthritis.58 Several reports have proposed that COMP/TSP5 is a promising diagnostic and prognostic marker, as well as disease severity. COMP/TSP5 has shown promise as a diagnostic and prognostic indicator and as a marker of the disease severity and the effect of treatment.59 COMP/TSP5 was proved to exert its biological function by interaction with integrin αvβ3 on chondrocytes,60 which in accordance with our current finding that TSP2 promoted IL-6 expression by binding to integrin αvβ3. Interestingly, we found expression levels of integrin αv and β3 were higher in OASFs 
+
+![8_image_0.png](8_image_0.png)
+
+than NSFs, which explains that OASFs had obvious response to TSP2 stimulation.
+
+The initiation and progression of OA depends upon synovial inflammation,61 which produces proinflammatory mediators that contribute to degradation of the cartilage matrix. For example, the expression of IL-1β in synovial cells initiates an inflammatory cascade that leads to joint damage,62 while IL-6 perpetuates inflammation and destruction in the synovium.63 Moreover, TNF-α contributes to inflammation and joint destruction in RA synovial fluid64 and induces ICAM-1 and VCAM-1 expression in endothelial cells.65 Here, we found TSP2 neutralized antibody ameliorated ACLT-induced OA model in rats by attenuating articular cartilage degradation and IL-6 expression. However, the other molecules which are involved in OA pathogenesis should be investigated to evaluate the therapeutic effects of TSP2 on OA progression.
+
+An important driver of inflammation is the PI3K/Akt signaling pathway, which mediates many cellular functions, including cell apoptosis, mobility, and autophagic reflux.66 By regulating the PI3K/AKT pathway, TSP2 knockdown inhibits the proliferative, migratory, and 
+
+Hou et al **Dovepress**
+
+![9_image_0.png](9_image_0.png)
+
+invasive capabilities of gastric cancer cells and facilitates cellular apoptosis.67 Our investigation demonstrates that PI3K and Akt inhibitors inhibit TSP2-induced IL-6 expression, while p85 and Akt mutants reduced IL-6 expression in OASFs. Furthermore, the incubation of OASFs with TSP2 upregulated the phosphorylation of PI3K and Akt. Our evidence supports the involvement of the PI3K/Akt signaling pathway in TSP2-mediated effects upon IL-6 expression in OASFs.
+
+Since NF-κB is a major downstream signaling molecule of the PI3K/Akt pathway,68,69 we explored the extent of NF-κB involvement in TSP2-mediated IL-6 production in OASFs. We found that treatment with NF-κB pathway inhibitors or mutants downregulated TSP2-enhanced IL-6 production. TSP2 treatment of OASFs increased NF-κB 
+phosphorylation. Following PI3K or Akt inhibitor treatment, TSP2-induced cellular p65 phosphorylation was downregulated, which indicates that TSP2 stimulates the production of IL-6 in OASFs via the PI3K/Akt-NF-κB signaling cascade.
+
+## Conclusions
+
+In conclusion, thrombospondin-2 increases interleukin-6 production by integrin αvβ3/PI3K/Akt/NF-κB signal cascade (Figure 7), which gives us more insight into the mechanisms driving osteoarthritis pathogenesis and is expected to assist with the development of more efficacious osteoarthritis therapy.
+
+![10_image_0.png](10_image_0.png)
+
+Figure 7 Schematic diagram illustrates the mechanism whereby TSP2 promotes IL6 expression in OASFs. Thrombospondin-2 increases interleukin-6 production by integrin αvβ3/PI3K/Akt/NF-κB signal cascade.
+
+## Data Accessibility
+
+The datasets used and analysed in this study are available from the corresponding authors on reasonable request.
+
+## Acknowledgments
+
+This work was supported by grants from Taiwan's Ministry of Science and Technology (MOST-108-2314-B-002-211-MY3, MOST-107-2314-B-341-003, MOST106-2314-B-341-001- MY3) and the Shin-Kong Wu Ho-Su Memorial Hospital 
+(SKH-8302-106-0401). We would like to thank Iona J. MacDonald in China Medical University for her English language revision of this manuscript. We thank the staff of the Eighth Core Lab, Department of Medical Research, National Taiwan University Hospital for technical support during the study.
+
+## Disclosure
+
+The authors state no conflict of interest in this work.
+
+## References
+
+1. Cho HJ, Gn KK, Kang JY, Suh KT, Kim TK. Epidemiological characteristics of patellofemoral osteoarthritis in elderly Koreans and its symptomatic contribution in knee osteoarthritis. *Knee*. 2016;23 (1):29–34. doi:10.1016/j.knee.2015.09.003 2. Lawrence RC, Felson DT, Helmick CG, et al. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 
+
+Part II. *Arthritis Rheum*. 2008;58(1):26–35. doi:10.1002/art.23176 3. Dillon CF, Rasch EK, Gu Q, Hirsch R. Prevalence of knee osteoarthritis in the United States: arthritis data from the Third National Health and Nutrition Examination Survey 1991–94. *J Rheumatol*. 2006;33(11):2271–2279.
+
+4. Loeser RF. Aging and osteoarthritis: the role of chondrocyte senescence and aging changes in the cartilage matrix. *Osteoarthritis* Cartilage. 2009;17(8):971–979. doi:10.1016/j.joca.2009.03.002 5. Krasnokutsky S, Samuels J, Abramson SB. Osteoarthritis in 2007. 
+
+Bull NYU Hosp Jt Dis. 2007;65(3):222–228.
+
+6. Brandt KD, Dieppe P, Radin EL. Etiopathogenesis of osteoarthritis. 
+
+Rheum Dis Clin North Am. 2008;34(3):531–559. doi:10.1016/j. rdc.2008.05.011 7. Berenbaum F. Osteoarthritis as an inflammatory disease (osteoarthritis is not osteoarthrosis!). *Osteoarthr Cartil*. 2013;21(1):16–21. 
+
+doi:10.1016/j.joca.2012.11.012 8. Zhu M, Chen M, Zuscik M, et al. Inhibition of β-catenin signaling in articular chondrocytes results in articular cartilage destruction. Arthritis Rheum. 2008;58(7):2053–2064. doi:10.1002/art.23614 9. Gu J, Rong J, Guan F, et al. Association of ADAMTS5 gene polymorphisms with osteoarthritis in Chinese Han population: a community-based case-control study. *Rheumatol Int*. 2013;33 (11):2893–2897. doi:10.1007/s00296-012-2506-1 10. Glasson SS, Askew R, Sheppard B, et al. Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis. *Nature*. 2005;434(7033):644–648. doi:10.1038/ nature03369 11. Zeng GQ, Chen AB, Li W, Song JH, Gao CY. High MMP-1, MMP-2, and MMP-9 protein levels in osteoarthritis. *Genet Mol Res*. 2015;14 (4):14811–14822. doi:10.4238/2015.November.18.46 12. Saxne T, Heinegard D. Cartilage oligomeric matrix protein: a novel marker of cartilage turnover detectable in synovial fluid and blood. Br J Rheumatol. 1992;31(9):583–591. doi:10.1093/rheumatology/ 31.9.583 13. Urakami T, Manki A, Inoue T, Oda M, Tanaka H, Morishima T. 
+
+Clinical significance of decreased serum concentration of cartilage oligomeric matrix protein in systemic juvenile idiopathic arthritis. J Rheumatol. 2006;33(5):996–1000.
+
+14. Wislowska M, Jablonska B. Serum cartilage oligomeric matrix protein (COMP) in rheumatoid arthritis and knee osteoarthritis. *Clin* Rheumatol. 2005;24(3):278–284. doi:10.1007/s10067-004-1000-x 15. Koelling S, Clauditz TS, Kaste M, Miosge N. Cartilage oligomeric matrix protein is involved in human limb development and in the pathogenesis of osteoarthritis. *Arthritis Res Ther*. 2006;8(3):R56. doi:10.1186/ar1922 16. Lohmander LS, Saxne T, Heinegard DK. Release of cartilage oligomeric matrix protein (COMP) into joint fluid after knee injury and in osteoarthritis. *Ann Rheum Dis*. 1994;53(1):8–13. doi:10.1136/ard.53.1.8 17. Pfander D, Cramer T, Deuerling D, Weseloh G, Swoboda B. 
+
+Expression of thrombospondin-1 and its receptor CD36 in human osteoarthritic cartilage. *Ann Rheum Dis*. 2000;59(6):448–454. doi:10.1136/ard.59.6.448 18. Maumus M, Manferdini C, Toupet K, et al. Thrombospondin-1 partly mediates the cartilage protective effect of adipose-derived mesenchymal stem cells in osteoarthritis. *Front Immunol*. 2017;8:1638. 
+
+doi:10.3389/fimmu.2017.01638 19. Maly K, Schaible I, Riegger J, Brenner RE, Meurer A, Zaucke F. The expression of thrombospondin-4 correlates with disease severity in osteoarthritic knee cartilage. *Int J Mol Sci*. 2019;20(2):447. doi:10.3390/ijms20020447 20. Calabro NE, Kristofik NJ, Kyriakides TR. Thrombospondin-2 and extracellular matrix assembly. *Biochim Biophys Acta*. 2014;1840 (8):2396–2402. doi:10.1016/j.bbagen.2014.01.013 21. Helkin A, Maier KG, Gahtan V. Thrombospondin-1, −2 and −5 have differential effects on vascular smooth muscle cell physiology. Biochem Biophys Res Commun. 2015;464(4):1022–1027. doi:10.1016/j.bbrc.2015.07.044 22. Liu JF, Lee CW, Tsai MH, et al. Thrombospondin 2 promotes tumor metastasis by inducing matrix metalloproteinase-13 production in lung cancer cells. *Biochem Pharmacol*. 2018;155:537–546. doi:10.1016/j.bcp.2018.07.024 23. Bornstein P, Armstrong LC, Hankenson KD, Kyriakides TR, Yang Z. 
+
+Thrombospondin 2, a matricellular protein with diverse functions. Matrix Biol. 2000;19(7):557–568. doi:10.1016/S0945-053X(00) 00104-9 24. Kyriakides TR, Zhu YH, Smith LT, et al. Mice that lack thrombospondin 2 display connective tissue abnormalities that are associated with disordered collagen fibrillogenesis, an increased vascular density, and a bleeding diathesis. *J Cell Biol*. 1998;140(2):419–430. 
+
+doi:10.1083/jcb.140.2.419 25. Taylor DK, Meganck JA, Terkhorn S, et al. Thrombospondin-2 influences the proportion of cartilage and bone during fracture healing. *J Bone Miner Res*. 2009;24(6):1043–1054. doi:10.1359/ jbmr.090101 26. Jeong SY, Ha J, Lee M, et al. Autocrine action of thrombospondin-2 determines the chondrogenic differentiation potential and suppresses hypertrophic maturation of human umbilical cord blood-derived mesenchymal stem cells. *Stem Cells*. 2015;33(11):3291–3303. doi:10.1002/stem.2120 27. Hankenson KD, Bain SD, Kyriakides TR, Smith EA, Goldstein SA, 
+Bornstein P. Increased marrow-derived osteoprogenitor cells and endosteal bone formation in mice lacking thrombospondin 2. J Bone Miner Res. 2000;15(5):851–862. doi:10.1359/ jbmr.2000.15.5.851 28. Hankenson KD, Ausk BJ, Bain SD, Bornstein P, Gross TS, 
+Srinivasan S. Mice lacking thrombospondin 2 show an atypical pattern of endocortical and periosteal bone formation in response to mechanical loading. *Bone*. 2006;38(3):310–316. doi:10.1016/j. bone.2005.08.027 29. Park YW, Kang YM, Butterfield J, Detmar M, Goronzy JJ, 
+Weyand CM. Thrombospondin 2 functions as an endogenous regulator of angiogenesis and inflammation in rheumatoid arthritis. Am J Pathol. 2004;165(6):2087–2098. doi:10.1016/S0002-9440(10) 63259-2 30. Tang CH, Chiu YC, Tan TW, Yang RS, Fu WM. Adiponectin enhances IL-6 production in human synovial fibroblast via an AdipoR1 receptor, AMPK, p38, and NF-κB pathway. *J Immunol*. 2007;179(8):5483–5492. doi:10.4049/jimmunol.179.8.5483 31. Chiu YC, Lin CY, Chen CP, et al. Peptidoglycan enhances IL-6 production in human synovial fibroblasts via TLR2 receptor, focal adhesion kinase, Akt, and AP-1- dependent pathway. *J Immunol*. 2009;183(4):2785–2792. doi:10.4049/jimmunol.0802826 32. Hou CH, Fong YC, Tang CH. HMGB-1 induces IL-6 production in human synovial fibroblasts through c-Src, Akt and NF-κB pathways. J Cell Physiol. 2011;226(8):2006–2015. doi:10.1002/jcp.22541 33. Chen HT, Tsou HK, Hsu CJ, et al. Stromal cell-derived factor-1/ 
+CXCR4 promotes IL-6 production in human synovial fibroblasts. J Cell Biochem. 2011;112(4):1219–1227. doi:10.1002/jcb.23043 34. Yang WH, Chang JT, Hsu SF, et al. Bradykinin enhances cell migration in human chondrosarcoma cells through BK receptor signaling pathways. *J Cell Biochem*. 2010;109(1):82–92.
+
+35. Gerwin N, Bendele AM, Glasson S, Carlson CS. The OARSI histopathology initiative - recommendations for histological assessments of osteoarthritis in the rat. *Osteoarthr Cartil*. 2010;18(Suppl 3):S24– S34. doi:10.1016/j.joca.2010.05.030 36. Yellin MJ, Winikoff S, Fortune SM, et al. Ligation of CD40 on fibroblasts induces CD54 (ICAM-1) and CD106 (VCAM-1) up-regulation and IL-6 production and proliferation. *J Leukoc Biol*. 1995;58(2):209–216. doi:10.1002/jlb.58.2.209 37. Chen H, Sottile J, O'Rourke KM, Dixit VM, Mosher DF. Properties of recombinant mouse thrombospondin 2 expressed in Spodoptera cells. *J Biol Chem*. 1994;269(51):32226–32232. doi:10.1016/S00219258(18)31625-9 38. Chen PC, Tang CH, Lin LW, et al. Thrombospondin-2 promotes prostate cancer bone metastasis by the up-regulation of matrix metalloproteinase-2 through down-regulating miR-376c expression. 
+
+J Hematol Oncol. 2017;10(1):33. doi:10.1186/s13045-017-0390-6 39. Li Z, Calzada MJ, Sipes JM, et al. Interactions of thrombospondins with α4β1 integrin and CD47 differentially modulate T cell behavior. J Cell Biol. 2002;157(3):509–519. doi:10.1083/jcb.200109098 40. Bancroft T, Bouaouina M, Roberts S, et al. Up-regulation of thrombospondin-2 in Akt1-null mice contributes to compromised tissue repair due to abnormalities in fibroblast function. *J Biol* Chem. 2015;290(1):409–422. doi:10.1074/jbc.M114.618421 41. Chen H, Strickland DK, Mosher DF. Metabolism of thrombospondin 2. Binding and degradation by 3t3 cells and glycosaminoglycan-variant Chinese hamster ovary cells. J Biol Chem. 1996;271(27):15993–15999. doi:10.1074/jbc.271.27.15993 42. Urtasun R, Lopategi A, George J, et al. Osteopontin, an oxidant stress sensitive cytokine, up-regulates collagen-I via integrin αVβ3 engagement and PI3K/pAkt/NFκB signaling. *Hepatology*. 2012;55 
+(2):594–608. doi:10.1002/hep.24701 43. Shao G, Liu Y, Ma T, Zhang L, Yuan M, Zhao S. GCN5 inhibition prevents IL-6-induced prostate cancer metastases through PI3K/ PTEN/Akt signaling by inactivating Egr-1. *Biosci Rep*. 2018;38(6). doi:10.1042/BSR20180816 44. Zhou J, Sun X, Zhang J, Yang Y, Chen D, Cao J. IL-34 regulates IL-6 and IL-8 production in human lung fibroblasts via MAPK, PI3K-Akt, JAK and NF-κB signaling pathways. *Int Immunopharmacol*. 2018;61:119–125. doi:10.1016/j.intimp.2018.05.023 45. Wei L, Xiong H, Li W, Li B, Cheng Y. Upregulation of IL-6 expression in human salivary gland cell line by IL-17 via activation of p38 MAPK, ERK, PI3K/Akt, and NF-kappaB pathways. J Oral Pathol Med. 2018;47(9):847–855. doi:10.1111/jop.12765 46. Hayami T, Pickarski M, Zhuo Y, Wesolowski GA, Rodan GA, 
+Duong LT. Characterization of articular cartilage and subchondral bone changes in the rat anterior cruciate ligament transection and meniscectomized models of osteoarthritis. *Bone*. 2006;38 (2):234–243. doi:10.1016/j.bone.2005.08.007 47. Lee CH, Seto WK, Lui DT, et al. Circulating thrombospondin-2 as a novel fibrosis biomarker of nonalcoholic fatty liver disease in type 2 diabetes. *Diabetes Care*. 2021;44(9):2089–2097. doi:10.2337/dc21-0131 48. Kozumi K, Kodama T, Murai H, et al. Transcriptomics identify thrombospondin-2 as a biomarker for NASH and advanced liver fibrosis. *Hepatology*. 2021. doi:10.1002/hep.31995 49. Kimura T, Tanaka N, Fujimori N, et al. Serum thrombospondin 2 is a novel predictor for the severity in the patients with NAFLD. *Liver* Int. 2021;41(3):505–514. doi:10.1111/liv.14776 50. Deng LY, Zeng XF, Tang D, Deng W, Liu HF, Xie YK. Expression and prognostic significance of thrombospondin gene family in gastric cancer. J Gastrointest Oncol. 2021;12(2):355–364. doi:10.21037/jgo-21-54 51. Peng HY, Chang MC, Hu CM, Yang HI, Lee WH, Chang YT. 
+
+Thrombospondin-2 is a highly specific diagnostic marker and is associated with prognosis in pancreatic cancer. *Ann Surg Oncol*. 2019;26(3):807–814. doi:10.1245/s10434-018-07109-6 52. Jiang YM, Yu DL, Hou GX, Jiang JL, Zhou Q, Xu XF. Serum thrombospondin-2 is a candidate diagnosis biomarker for early non-smallcell lung cancer. *Biosci Rep*. 2019;39(7). doi:10.1042/BSR20190476 53. Wang X, Zhang L, Li H, Sun W, Zhang H, Lai M. THBS2 is a potential prognostic biomarker in colorectal cancer. *Sci Rep*. 2016;6:33366. doi:10.1038/srep33366 54. MacLauchlan S, Yu J, Parrish M, et al. Endothelial nitric oxide synthase controls the expression of the angiogenesis inhibitor thrombospondin 2. *Proc Natl Acad Sci U S A*. 2011;108(46):E1137–E1145. 
+
+doi:10.1073/pnas.1104357108 55. Roudnicky F, Yoon SY, Poghosyan S, et al. Alternative transcription of a shorter, non-anti-angiogenic thrombospondin-2 variant in cancer-associated blood vessels. *Oncogene*. 2018;37(19):2573–2585. doi:10.1038/s41388-018-0129-z 56. Lamy L, Foussat A, Brown EJ, Bornstein P, Ticchioni M, Bernard A. 
+
+Interactions between CD47 and thrombospondin reduce inflammation. *J Immunol*. 2007;178(9):5930–5939. doi:10.4049/ 
+jimmunol.178.9.5930 57. Daniel C, Wagner A, Hohenstein B, Hugo C. Thrombospondin-2 therapy ameliorates experimental glomerulonephritis via inhibition of cell proliferation, inflammation, and TGF-β activation. Am J Physiol Renal Physiol. 2009;297(5):F1299–F1309. doi:10.1152/ ajprenal.00254.2009 58. Maly K, Andres Sastre E, Farrell E, Meurer A, Zaucke F. COMP and TSP-4: functional roles in articular cartilage and relevance in osteoarthritis. *Int J Mol Sci*. 2021;22(5):2242. doi:10.3390/ ijms22052242 59. Tseng S, Reddi AH, Di Cesare PE. Cartilage oligomeric matrix protein (COMP): a biomarker of arthritis. *Biomark Insights*. 2009;4:33–44. doi:10.4137/BMI.S645 60. Chen FH, Thomas AO, Hecht JT, Goldring MB, Lawler J. Cartilage oligomeric matrix protein/thrombospondin 5 supports chondrocyte attachment through interaction with integrins. *J Biol Chem*. 2005;280(38):32655–32661. doi:10.1074/jbc.M504778200 61. Goldring MB, Goldring SR. Osteoarthritis. *J Cell Physiol*. 2007;213 
+(3):626–634. doi:10.1002/jcp.21258 62. Zheng W, Feng Z, You S, et al. Fisetin inhibits IL-1β-induced inflammatory response in human osteoarthritis chondrocytes through activating SIRT1 and attenuates the progression of osteoarthritis in mice. *Int Immunopharmacol*. 2017;45:135–147. doi:10.1016/j. intimp.2017.02.009 63. Wu X, Cao L, Li F, Ma C, Liu G, Wang Q. Interleukin-6 from subchondral bone mesenchymal stem cells contributes to the pathological phenotypes of experimental osteoarthritis. *Am J Transl Res*. 
+
+2018;10(4):1143–1154.
+
+64. Husby G, Williams RC. Synovial localization of tumor necrosis factor in patients with rheumatoid arthritis. *J Autoimmun*. 1988;1 (4):363–371. doi:10.1016/0896-8411(88)90006-6 65. Mattila P, Majuri ML, Mattila PS, Renkonen R. TNF alpha-induced expression of endothelial adhesion molecules, ICAM-1 and VCAM-1, is linked to protein kinase C activation. Scand J Immunol. 1992;36(2):159–165. doi:10.1111/j.1365-3083.1992. tb03087.x 66. Martini M, De Santis MC, Braccini L, Gulluni F, Hirsch E. PI3K/ 
+AKT signaling pathway and cancer: an updated review. *Ann Med*. 2014;46(6):372–383. doi:10.3109/07853890.2014.912836 67. Ao R, Guan L, Wang Y, Wang JN. Silencing of COL1A2, COL6A3, and THBS2 inhibits gastric cancer cell proliferation, migration, and invasion while promoting apoptosis through the PI3k-Akt signaling pathway. *J Cell Biochem*. 2018;119(6):4420–4434. doi:10.1002/ 
+jcb.26524 68. Sun HZ, Yang TW, Zang WJ, Wu SF. Dehydroepiandrosteroneinduced proliferation of prostatic epithelial cell is mediated by NFKB via PI3K/AKT signaling pathway. *J Endocrinol*. 2010;204 (3):311–318. doi:10.1677/JOE-09-0270 69. Zhang XY, Liu Y, He T, et al. Anaphylatoxin C5a induces inflammation and reduces insulin sensitivity by activating TLR4/NF-kB/PI3K 
+signaling pathway in 3T3-L1 adipocytes. *Biomed Pharmacother*. 2018;103:955–964. doi:10.1016/j.biopha.2018.04.057 Journal of Inflammation Research Dovepress Publish your work in this journal The Journal of Inflammation Research is an international, peerreviewed open-access journal that welcomes laboratory and clinical findings on the molecular basis, cell biology and pharmacology of inflammation including original research, reviews, symposium reports, hypothesis formation and commentaries on: acute/chronic inflammation; mediators of inflammation; cellular processes; molecular mechanisms; pharmacology and novel anti-inflammatory drugs; clin ical conditions involving inflammation. The manuscript management system is completely online and includes a very quick and fair peerreview system. Visit http://www.dovepress.com/testimonials.php to read real quotes from published authors. 
+
+Submit your manuscript here: https://www.dovepress.com/journal-of-inflammation-research-journal

medical/md/PMC8716864.md

@@ -0,0 +1,276 @@
+Contents lists available at ScienceDirect
+
+![0_image_0.png](0_image_0.png)
+
+# Saudi Journal Of Biological Sciences
+
+journal homepage: www.sciencedirect.com Original article
+
+![0_image_1.png](0_image_1.png)
+
+The association between two genetic polymorphisms in ITGB3 and increase risk of venous thromboembolism in cancer patients in Eastern Province of Saudi Arabia Asma Y. Alsulaim a, Faisal Azam b, Tunny Sebastian c, Fathelrahman Mahdi Hassan d, Sayed AbdulAzeez e, J. Francis Borgio e, Faisal M. Alzahrani a,⇑
+aDepartment of Clinical Laboratory Sciences, College of Applied Medical Sciences, Imam Abdulrahman Bin Faisal University, Dammam, Saudi Arabia b Consultant Medical Oncologist, King Fahad specialist Hospital, Dammam, Saudi Arabia cDepartment of Clinical Nutrition, College of Applied Medical Sciences, Imam Abdulrahman bin Faisal University, Dammam, Saudi Arabia dDepartment of Hematology and Immunohematology, College of Medical Laboratory Science, Sudan University of Science and Technology, Khartoum, Sudan eDepartment of Genetic Research, Institute for Research and Medical Consultations (IRMC), Imam Abdulrahman Bin Faisal University, Dammam, Saudi Arabia article info Article history:
+Received 1 June 2021 Revised 20 August 2021 Accepted 22 August 2021 Available online 27 August 2021
+
+Keywords:
+
+Genetic Polymorphisms
+
+ITGB3 gene
+
+Risk Venous Thromboembolism
+
+Cancer
+
+Eastern Province Saudi Arabia
+
+## Abstract
+
+Venous thromboembolism (VTE) is one of the major complications in most cancer patients leading to poor prognosis and short survival. Several common clinical risk factors coexist in cancer patients are used as risk predictive biomarkers to help in the management and prevention of VTE. These include cancer site and stage, chemotherapy regimen and elevated biological markers. However, Genetic polymorphisms in genes controlling coagulation and fibrinolysis are significantly associated with VTE if detected, then they might be more sensitive individual predictive biomarkers for VTE risk assessment. This study was conducted to evaluate the association between ITGB3 rs3809865 and rs5918 with VTE risk as well as monitor the effect of VTE on overall survival of these cancer patients. In this retrospective case-control study, 195 cancer patients' formalin-fixed paraffin embedded tissue (FFPE) samples were collected (controls n = 157, case n = 38) using the stored data through Jan 2010 to Sep 2018 from King Fahad Specialist Hospital in Dammam. Samples were genotyped using TaqMan genotyping assay, then logistic regression analysis and Chi-square were used to predict the association between risk factors and VTE. Survival Comparison was tested by the log-rank test. Genetic polymorphisms in ITGB3 (rs3809865 and rs5918)
+found not to be associated with VTE increasing risk in cancer patients (p>0.05). While the advanced stage was potentially increasing the risk of VTE events (OR 5.1 CI 2.01–12.9p = 0.001). Patients with VTE showed a poor overall survival reflected by the median survival rate of only three years compared to seven years for cancer patients without VTE. This study highlighted the potential influence of VTE on prognosis and survival of cancer patients and raised the importance of exploring risk predictive biomarkers in our population. This will improve the risk prediction biomarkers leading to implementing safe and effective thrombosis prophylaxis strategies.
+
+ 2021 The Author(s). Published by Elsevier B.V. on behalf of King Saud University. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
+
+## 1. Introduction
+
+⇑ Corresponding author.
+
+E-mail addresses: faisal.azam@kfsh.med.sa (F. Azam), tspurayidathil@iau.edu.sa
+(T. Sebastian), asayed@iau.edu.sa (S. AbdulAzeez), fbalexander@iau.edu.sa
+(J.F. Borgio), fmzahrani@iau.edu.sa (F.M. Alzahrani).
+
+Peer review under responsibility of King Saud University.
+
+Venous thromboembolism (VTE) is reported to be a relatively common complication in cancer patients (Donnellan and Khorana, 2017). Cancer increases the risk of venous thromboembolism by four to six folds leading to poor prognosis as well as increased rates of mortality, morbidity, and health care costs
+(Khalil et al., 2015, Eichinger, 2016, Angelini and Khorana, 2017; Hiraide et al., 2020). Recent study on the 499 092 patients revealed ninefold higher and increased risk of VTE in cancer patients compared to the general population (Mulder et al., 2021). Recent studies are suggesting development of specific recommendation for
+
+| Production and hosting by Elsevier   |
+|--------------------------------------|
+
+https://doi.org/10.1016/j.sjbs.2021.08.073
+
+![0_image_2.png](0_image_2.png)
+
+1319-562X/ 2021 The Author(s). Published by Elsevier B.V. on behalf of King Saud University.
+
+This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
+
+ 
+treating cancer types complicated with VTE (Zheng et al., 2021). It was estimated that 1.6–20% of cancer patients encounter VTE at any time during the disease course (Gran et al., 2018, Mohammed et al., 2015). Also, it was shown that VTE increases the rate of death in cancer patients by more than four folds as it is considered the second leading cause of death in this group of patients after cancer itself (Timp et al., 2013, Khalil et al., 2015, Donnellan and Khorana, 2017). These findings highlighted the importance of exploring potential factors that increase the risk of venous thromboembolism in cancer patients to manage and prevent VTE by establishing thrombosis prophylaxis plan (Iorga et al., 2019). Integrin Subunit Beta 3 (ITGB3) encodes for the beta subunit (IIIa) of the glycoprotein GPIIb/IIIa (aIIbb3 integrin)
+(Database, 2019). This glycoprotein is considered the main receptor having a crucial role in platelet aggregation (Huang et al.,
+2019). Intracellular coagulation cascade events is activated upon the latest signalling process leading to irreversible aggregation and stable thrombus formation (Fullard, 2004). Current studies are directed towards identifying genetic markers specifically associated with an individual cancer patient to be used as individual risk factors predictors. Factor V Leiden mutation, prothrombin mutation (G20210A), methylenetetrahydrofolate reductase
+(MTHFR-A1298C), and (MTHFR-C677T) are studied extensively with conflicting results regarding the significant association with VTE. Most studies found that these polymorphisms increased the risk of venous thromboembolism in both cancer and non–cancer patients in the same proportion and did no show a significant difference in association in either group (Connolly and Francis, 2013). Conversely, a case-control study on breast cancer patients demonstrates a possible association between FV polymorphism that showed to be linked to increase Factor V expression and increase the coagulation activity when investigating polymorphisms in F5 other than FV Leiden (Tinholt et al., 2014) . Interestingly, one of the recently studied genetic risk factors is ITGB3 polymorphisms of the Glycoprotein IIIa (Bianconi et al., 2015). Three single nucleotide polymorphisms (SNPs) such as rs4642, rs5918 and rs3809865 in the ITGB3 were studied for the association with VTE (Bianconi et al., 2015).The same previous study demonstrated a significant association between rs3809865 and VTE in colorectal cancer patients with (p < 0.05), while statistical analysis did not show any significant association between the other polymorphisms and the risk of VTE (Bianconi et al., 2015). Moreover, platelet bearing the glycoprotein IIIa with rs5918 polymorphism showed an increased risk for aggregation as it is assumed to have an increased affinity to fibrinogen. On the other hand, (Khatami et al., 2016, Xiang et al., 2016) reported contradictory conclusions in the association between rs5918 and venous thromboefmbolism. Allele frequency based on TOPMed (Trans-Omics for Precision Medicine) for SNPs rs3809865 and rs5918 are T = 0.304061 (80482/264690, TOPMED) and C = 0.123586 (32712/264690, TOPMED), respectively (Sherry et al., 2001). This research aim was to investigate the association between two SNPs rs3809865 and rs5918 in the ITBG3 for the GPIIIa of platelets with increased risk of venous thromboembolism in cancer patients in the Eastern Province of Saudi Arabia and to study the overall survival rate of cancer patients and to identify the median time of occurrence of VTE after the initial diagnosis of cancer.
+
+## 2. Materials And Methods
+
+A retrospective case-control study was conducted in Imam Abdulrahman bin Faisal University in accordance with the Declaration of Helsinki. This research protocol was approved by Imam Abdulrahman bin Faisal University Institutional review board (IRB-PGS-2018–03-136) and King Fahad Specialist Hospital
+(LAB0311). The study samples for this research were archived formalin-fixed paraffin embedded tissue (FFPE) samples. For that, waiver consent was sufficient for approval of the study sample collection. The study population for this research was 195 cancer patients diagnosed at King Fahad Specialist Hospital in Dammam
+(KFSHD). The inclusion criteria for controls were as follow, Saudi and non-Saudi of both gender patients older than 18 years with a confirmed diagnosis of cancer by histopathological studies. Additional inclusion criteria for cases were venous thromboembolism VTE which was confirmed by radiological studies. However, the exclusion criteria for both cases and controls were paediatric cancer patients, patients with haematological malignancies and cancer patients with known FV Leiden, prothrombin, MTHFR mutation carriers.
+
+Cancer patients confirmed using histopathology were proven VTE using routine diagnosis. Radiological reports of cancer patients from Jan 2010 to Sep 2018 were collected using ultrasound venous doppler as code for VTE cases that fit the inclusion criteria of the study. A total of 45 cases were available and out of them only 38
+(Breast cancer 24; Colon cancer 7; Ovarian cancer 1; Brain cancer 3; Lung cancer 2; and Bladder cancer 1) were included in the research for one of these reasons either the tissue blocks were used for another research or only one block was available for the case and using these blocks for research is against IRB rules. Simple random sampling technique that was done using IBM SPSS Statistics 21 software (Hong Kong, China) was used to select 157 (Breast cancer 76; Colon cancer 41; Ovarian cancer 8; Brain cancer 10; Lung cancer 6; and Bladder cancer 16) control samples. Demographic data and clinical history were collected for selected cases. Data collected include age, gender, date of initial cancer diagnosis, site and stage of cancer, date of VTE occurrence, history of hospitalization, chemotherapy regimen used and date of death.
+
+Tissue blocks containing soft tissue, medium-sized, low fat content and perfect tissue embedding were accepted. From each selected FFPE tissue, four sections with 10 mm thickness were cut using the Rotary Microtome (LEICA RM 2255 Rotary Microtome by Leica Biosystems (IL, USA) then placed in a 1.5 ml sterile microcentrifuge tube. Melting the paraffin using hazard solvents such as ethanol and xylene described by was performed in this research with minor modifications (Sikora et al., 2011). Silica membranebased DNA extraction was the method of choice provided by DNeasy Blood and Tissue extraction kit (Qiagen, Hilden, Germany).
+
+DNA concentration and purity were measured by Nanodrop 8000 spectrophotometer by Thermo Scientific (DE, USA) and samples were stored at 80 C to be used for further analysis.
+
+## 2.1. Genotyping Of The Studied Variants
+
+TaqMan based SNP Genotyping assay was conducted by 7500 Fast Real-Time PCR System (Applied BiosystemsTM). The flanking sequences of SNP rs3809865 in ITGB3 was obtained from the national centre for biotechnology information (NCBI) with sequence reference (GenBank accession number:
+NC_0000171.11). Forward and reverse primers flanking the SNP of interest were selected to have an amplicon length between 700 and 800 bp with a C/G content between 40 and 60 %. Complete primers design was achieved by NCBI primer blast together with reverse complement tools. Amplification was optimized using primers, As9865F [(Forward) 5ʹ ATGGTTCTCTCGCAAGG 3ʹ] and As9865R [(Reverse) 5ʹ GTGACTTGCTGTGAATGAT 5ʹ] through gradient PCR. Agarose gel electrophoresis was used for DNA fragments separation according to the fragment size. Agarose gel was then transferred to the Molecular Imager ChemiDoc DocTM XR System, Bio-Rad (CA, USA) to visualize DNA under UV light. PCR products were purified from impurities like as primers, nucleotides, enzymes, and salts using QIAquickpurification kit. Amplicons were sequenced using 3500 genetic analyser (Applied BiosystemsTM HITACHI, Austin, USA) through Sanger sequencing technology. Purification of PCR products after cycle sequencing was done to remove unbound BigDye terminators and salts. This step was archived by Big dye terminatorTM purification kit, Applied biosystem. The sequencing analysis software mutation surveyor software was used for ITGB3 sequencing analysis.
+
+IBM SPSS v.21 software was used in this study for descriptive statistical analysis. Mean and standard deviation as well as median and interquartile ranges were used to present the continuous variables. Nominal variables frequencies were presented as percent and numbers. Chi square and logistic regression test were used to compare the frequencies between cases and controls clinical history. It was also used to assess the association between rs3809865 and rs5918 and VTE. Kaplan-Meier Curve and log rank test were used to compare survival time and asses its significance between the study groups. A p-value < 0.05 within 95% confidence interval was considered statistically significant Hardy Weinberg equilibrium and minor allele frequency were calculated using Haploview 4.2 software (MA, USA).
+
+## 3. Results
+
+Study population detailed demographics characteristics and clinical data were presented in Table 1, they were divided into two groups: case (n = 38) and controls (n = 157). The mean age of the study population in both cases and controls was 58 years with a mean BMI for cases and controls of approximately 29.2 and 28.1, respectively. The predominance of female patients was demonstrated in both case and control groups accounting for 72.3% of the total study population. Hospitalization status which included any hospital stay more than 4 days as well as patients under palliative care presented 69% of the study population with no significant difference between cases and controls. More than 70% of cases were dead compared to only 17% in controls. In this study, two cancer treatments data known to be a risk factor of VTE were collected which included chemotherapy and hormonal therapy. Most cases were under chemotherapy presenting 92.1%, while for hormonal therapy only 44.7% were under this type of treatment. Advanced stage cancer patients were higher in cases compared to controls accounting for 84%, 50%, respectively. Chemotherapy as well as advanced stage of cancer showed a statistically significant p-value of 0.04 and 0.01, respectively by univariate analysis. But, with logistic regression chemotherapy showed statistically insignificant p-value of 0.56 while advanced stage showed p-value of 0.001(OR 5.1 CI 2.0–12.9) which indicates advanced stage significant association with VTE occurrence. The samples used for this research were subjected to TaqMan genotyping analysis without any exclusion. As known that the effect of DNA quality will be demonstrated by the success or failure in the final analysis. Only three samples were excluded from the research as they were below the accepted DNA concentration. A total of 192 samples were genotyped using the TaqMan Genotyping assay.
+
+Genotypes were then analyzed by the TaqMan software. The software fluorescence calls were automatically plotted on the allelic discrimination plot which discriminates each allele as a specific cluster. The allelic discrimination plot was divided into three clusters. Lower right cluster (red) represents homozygous for allele 1, upper left cluster (blue) represents homozygous for allele 2, while the center cluster represents heterozygous for allele 1 / allele 2 Allele specifications were determined by rs3809865A (VICTM) / rs3809865T (FAMTM) and rs5918C (VICTM) / rs5918T (FAMTM).
+
+Allele distribution for the study SNPs differs between cases and controls. For rs3809865, higher frequency of heterozygous genotype AT was demonstrated in the cases showing 51.4% compared to 36.4% in controls. On the other hand, homozygous genotype AA showed a higher frequency in controls compared to only 31.4% in cases. However, these differences in frequency were statistically insignificant by the bivariate analysis showing a p-value of 0.31 for genotype AA and a p-value of 0.98 for genotype AT. Homozygous genotype TT showed the least frequency in cases and controls being 17% and 11%, respectively. For rs5918, homozygous TT genotype showed the highest frequency, 69.7% and 73% for cases and controls, respectively. Heterozygous genotype CT was slightly higher in controls being 22% compared to 27% in case. Lowest frequency was the carriers of homozygous genotype CC. The bivariate analysis reflected statistically insignificant differences between the cases and controls represented by a p-value of 0.53 and 0.64 for genotypes CT and CC, respectively. Genotypes frequency distributions are shown in Table 2. The minor allele for both SNPs was (T). Minor allele frequency (T) of rs3809865 was found to be 0.317, while for rs5918 was 0.162 in the study population (Table 3). Hardy Weinberg equilibrium was calculated for these SNPs by comparing the differences between predicted and observed heterozygosity of these SNPs and found to obey the Hardy Weinberg equilibrium (HWE). Three known samples were sequenced to be used as positive quality control samples for the SNP rs3809865. Sequenced samples analyzed by mutation sur-
+
+| Table 1 Characteristics and clinical data of the study population. Variable Case   | Control    | Total       | p-value**   |        |
+|------------------------------------------------------------------------------------|------------|-------------|-------------|--------|
+| (n %)                                                                              | (n %)      | (n %)       | (v2 )       |        |
+| Age (year) Mean                                                                    | 58 ± 12.4  | 58 ± 13.1   |             |        |
+| BMI Mean                                                                           | 29.2 ± 10  | 28.1 ± 6    |             |        |
+| Gender Female                                                                      | 31 (81.6%) | 110 (70.1%) | 141(72.3%)  | 0.15   |
+| Male                                                                               | 7 (18.4%)  | 47 (29.9%)  | 54 (27.7%)  |        |
+| Cancer treatment Chemotherapy                                                      | 35 (92.1%) | 122 (77.7%) | 157 (80.5%) | 0.04   |
+| Hormonal therapy                                                                   | 17 (44.7%) | 47 (29.9%)  | 64 (32.8%)  | 0.08   |
+| Stage Local                                                                        | 6 (16.2%)  | 78 (49.7%)  | 84 (43.3%)  | 0.01   |
+| Advanced / metastasis                                                              | 31 (83.8%) | 79 (50.3%)  | 110 (56.7%) |        |
+| Hospitalization                                                                    | 29 (76.3%) | 103 (67.3%) | 132 (69.1%) | 0.2    |
+| Mortality Dead                                                                     | 27 (71.1%) | 27 (17.4%)  | 54 (28.0%)  | <0.001 |
+| Alive                                                                              | 11 (28.9%) | 128 (82.6%) | 139 (72.0%) |        |
+| ** p < 0.05 is statistically significant.                                          |            |             |             |        |
+
+| Table 2 Genotype and frequency distribution. SNP ID                                                                             | Genotypes   | Genotype Frequencies   | p-value** (v2 )   |       |
+|---------------------------------------------------------------------------------------------------------------------------------|-------------|------------------------|-------------------|-------|
+| Case (%)                                                                                                                        | Control (%) |                        |                   |       |
+| rs3809865                                                                                                                       | AA          | 11 (31.4%)             | 81 (52.6%)        | 0.310 |
+| AT                                                                                                                              | 18 (51.4%)  | 56 (36.4%)             | 0.980             |       |
+| TT                                                                                                                              | 6 (17.1%)   | 17 (11%)               | Reference*        |       |
+| rs5918                                                                                                                          | CT          | 9 (27.3)               | 33 (21.7%)        | 0.53  |
+| CC                                                                                                                              | 1 (3 %)     | 8 (5.3 %)              | 0.64              |       |
+| TT                                                                                                                              | 23 (69.7%)  | 111 (73%)              | Reference*        |       |
+| * The reference genotypes used the chi-square (v2 ) to compare genotypes frequencies; ** p < 0.05 is statistically significant. |             |                        |                   |       |
+
+| Table 3 Minor allele frequencies and HW p-value. SNP Minor Allele           | MAF   | Predicted heterozygosity   | Observed   | HW p-value *   |       |
+|-----------------------------------------------------------------------------|-------|----------------------------|------------|----------------|-------|
+| Heterozygosity                                                              |       |                            |            |                |       |
+| rs3809865                                                                   | T     | 0.317                      | 0.433      | 0.392          | 0.232 |
+| rs5918                                                                      | C     | 0.162                      | 0.272      | 0.272          | 0.054 |
+| * p < 0.05 Obeying Hardy Weinberg equilibrium; MAF: Minor allele frequency. |       |                            |            |                |       |
+
+![3_image_0.png](3_image_0.png)
+
+veyor software results reflected the specific genotype result from the TaqMan genotyping assay. The sequence results are shown with an example of a sequence chromatogram in Fig. 1. To investigate the association between rs3809865 and rs5918 with VTE, binary logistic regression analysis was used for this investigation. The Genotype TT was used as the reference for both SNPs according to the NCBI reference sequence. Crude logistic regression analysis of rs3809865 showed an odds ratio of 2.6 (95% CI 0.845–7.99) for genotype AA with a p-value pf 0.096, reflecting a statistically insignificant association between VTE and genotype AA in the study population. Genotype AT for the same SNP also did not show any significant association with a p-value of 0.86 and odds ratio of 1. Investigating the association between rs5918 and VTE reveals a lack of association of both CC and CT genotypes which was reflected by statistically insignificant of p-value for both genotypes.
+
+Genotype CC regression analysis resulted in odds ratio 1.6 (95% CI 0.198–13.9, p-value 0.64) and for genotype CT the odds ratio was 0.76 (95% CI 0.321–1.8, p-value 0.53). Table 4 presents crude regression analysis data details for both SNPs.
+
+The duration between the initial diagnosis of cancer and VTE
+occurrence for the cases was estimated by the calculated median and interquartile range. The median of VTE occurrence was about 22 months after the initial diagnosis of cancer with 25% of cases who experience VTE within five months or less since the initial diagnosis of the cancer. On the other hand, 25% of cases were diagnosed with VTE after 51 months or more since the first cancer diagnosis. Survival probabilities between cases and controls were examined by Kaplan Meier survival plots. Two samples were excluded from this analysis due to the unknown death date. As demonstrated in Kaplan Meier survival plot of Fig. 2 the probabilities of cases survival were low compared to survival probability in controls which clearly indicates a poor survival of cases. A 2-year survival probability in cases was approximately 64% compared to higher survival in controls which was 90%. The log rank (Mental -Cox) test was also used to explore this difference in survival which was statistically significant with p-value < 0.001. Overall mean survival was around three years for cases and seven years for controls.
+
+## 4. Discussion
+
+Cancer patients encounter multiple complications during the disease course. One of the most common complications is VTE
+
+| Table 4 Crude binary logistic regression for rs3809865 and rs5918 using the VTE occurrence as the dependent variable. SNP ID Genotype p-value Odds ratio   | 95% C.I**   |       |       |        |       |
+|------------------------------------------------------------------------------------------------------------------------------------------------------------|-------------|-------|-------|--------|-------|
+| rs3809865                                                                                                                                                  | AA          | 0.096 | 2.6   | 0.845  | 7.995 |
+| AT                                                                                                                                                         | 0.86        | 1     | 0.376 | 3.206  |       |
+| TT                                                                                                                                                         | Reference*  | -     |       |        |       |
+| rs5918                                                                                                                                                     | CT          | 0.53  | 0.760 | 0.321  | 1.801 |
+| CC                                                                                                                                                         | 0.64        | 1.658 | 0.198 | 13.904 |       |
+| TT                                                                                                                                                         | Reference*  | -     |       |        |       |
+| * Reference genotypes used for regression analysis; p < 0.05 is statistically significant. ** CI: Confidence Interval,                                     |             |       |       |        |       |
+
+which correlates with increased mortality, morbidity in these patients. Identifying risk factors correlated to VTE occurrence will help to constrain its significant effects by selecting the VTE highrisk cancer patients. Cancer patient categorization depending on risk are based on different VTE prediction assessment tools. Thrombosis risk may arise from cancer itself as the primary cancer site, stage and grade of cancer. Surgery, chemotherapy, hormonal therapy, antiangiogenic drugs and the central catheter can raise the risk of thrombosis in relation to different treatment modalities described for cancer patients. Lastly, multiple clinical parameters if encountered by the patient, will increase the risk of VTE events, like, abnormal white blood cell count, platelet count, d-dimer and P-selection (Khalil et al., 2015, Fernandes et al., 2019).
+
+Recently, studies are concentrating on exploring genetic risk factors related to thrombosis risk, specifically in cancer patients. It is hypothesized that these genetic factors may add precision to the risk assessment tools (Muñoz Martín et al., 2018). Our retrospective case-control hospital-based study mainly aimed to investigate the association between rs3809865, rs5918 SNPs in ITGB3 and VTE occurrence increase risk in cancer patients. Additionally, exploring the survival rate of these patients and observing the time of VTE occurrence during cancer disease. The major findings of this study were the lack of association between rs3809865, rs5918 in ITGB3 with an increased risk of VTE in cancer patients after the adjustment of covariates. The cancer stage showed a significant effect on increasing VTE risk. Monitoring the VTE events time occurrence and survival rate of cancer patients with VTE revealed that 25% of the cases had a VTE event in the first year after cancer diagnosis initially and all cases had poor survival which was directly linked to the VTE occurrence. These findings affirm the impact of venous thrombosis on cancer patients' overall survival. The frequency of rs3809865 genotypes between cases and controls was slightly different but not reaching the statistical significance reflecting the lack of association with increased risk. Correspondingly, Bianconi et al., 2015 reported an eight-fold increase in the risk of developing venous thromboembolism in colorectal cancer patients carrying AA genotype of rs3809865. As mentioned, the later research enrolled only colorectal cancer patients. While in our study, study population cancer types were not specified, and this may explain the conflict results between the two studies as this polymorphism may be specific only to colorectal cancer groups. No studies were found examining the effect of this SNP
+on platelet function. For the second SNP in this study, we investigated the association between rs5918 with increasing VTE risk and the results confirmed the absence of any association. The prospective study that was done by Bianconi et al., 2015 revealed 187
+
+![4_image_0.png](4_image_0.png)
+
+that the presence of rs5918 in cancer patients does not carry any risk for VTE occurrence. Similarly, (Xiang et al., 2016) had explored 29 variants in the ITGB3, including rs5918 in the Chinese population, to analyse their influence on GPIIb/IIIa receptor expression and their impact on platelet function. The study demonstrated no effect on platelet function and thus no association with thrombosis. Likewise, (Bennett et al., 2001) showed no impact of this SNP
+on platelet function. However, Komsa-Penkova et al., 2017 explored if rs5918 polymorphism carriers exhibit higher risk for developing VTE. They found that it significantly contributes to increased risk of VTE in the general population only as no cancer patients were included in their study. Also, they noted the increased risk in relation to this polymorphism to be higher in females compared to males. Cancer patients with metastasis or advanced-stage cancer comprising 84% of cases showed an increased risk of VTE in our study. Similarly, Abdol Razak et al.,
+2018 reported that the risk of VTE in cancer patients with metastasis could reach 58-fold increased risk compared to patients with local cancer.(Khalil et al., 2015) also considered the cancer patients with distant metastasis as VTE high-risk group. Conversely, Khorana and Connolly, 2009, indicated that the stage of cancer was not predictive of VTE risk occurrence in the case of ambulatory cancer patients. Chemotherapy carries an adverse effect on the cancer patients by causing endothelial damage initiating an abnormal thrombosis response which may cause VTE Maia et al., 2019).
+
+In our study, chemotherapy had no impact on increasing VTE risk.
+
+Other studies declared that the occurrence of VTE is directly connected to the initiation of chemotherapy (Chen et al., 2018). This finding was also reported by Maia et al., 2019, who found that the risk of VTE in lung cancer patients increases after six months following the chemotherapy initiation. Wang et al., 2019 similarly documented a significant association of chemotherapy with VTE as well. Moreover, (Abdol Razak et al., 2018) stated that the VTE risk associated with chemotherapy differs according to cancer type; highlighting stomach and pancreatic cancer to carry a high VTE risk compared to other cancer types. (Khorana and Connolly, 2009) explored the risk of the specific combination of chemotherapy drugs with increasing VTE events and noted that each chemotherapy drug carries a different risk of causing VTE in cancer patients.
+
+As demonstrated above, our results did not match the literature findings, and this may arise from the retrospective nature of the study or different chemotherapy regimens followed in our hospital that may not have any influence on the thrombosis system. Venous thromboembolism risk is distinct in each type of cancer depending on specific cancer mechanisms causing thrombosis (Abdol Razak et al., 2018). In our study, cancer types were not defined as a separate VTE risk factor due to the limited cases of VTE in our study population. Aleem et al., 2012 revealed that breast, lung cancer and non–Hodgkin's lymphoma was the most common types showed high VTE risk. While Abdol Razak et al., 2018 stated that lung, brain, pancreas and kidney carry the highest risk. Furthermore, Sheth et al., 2017 demonstrated that brain, pancreas and stomach were the highest at risk. As noted, that reports indicating the common primary site of cancer with the highest risk were controversial, this may be influenced by the frequency of each cancer in the population studied. In this study, we compared the survival of cancer patients who encounter VTE with cancer patients without VTE (controls). The results revealed 79% of cases with oneyear survival of compared to a 94% for controls. Similarly, a twoyear survival was lower by more than 10% in cases but still around 90% in controls. As known that survival may be affected by many factors besides the VTE itself. In our study, the mortality was significantly associated with VTE according to multivariate analysis after covariates adjustments. Also, Mohammed et al., 2015 noted a oneyear survival of cases to be only 18.9% with a median survival of 12.4 months in a retrospective study conducted at King Abdullah
+ 
+Medical city in the western region. Similarly, A recently published retrospective study by Maia et al., 2019 on lung cancer patients confirmed a poor prognosis and reduced overall survival related to VTE occurrence, which was 29.1% survival rate with a median survival of 1.5 months. Conversely, in a study comprising pancreatic cancer patients with advanced-stage, Chen et al., 2018 reported no differences in survival between cancer patients with VTE and without VTE, however, they observed a poor survival in patients with early VTE events with a median survival of 1.8 months compared to late VTE. Chen et al., 2018 included only pancreatic cancer patients with advanced-stage and this may explain the insignificant difference in survival. Also, they confirmed the association of advanced-stage cancer with an increased risk of VTE which was found in our research as well. The discrepancies between these studies may be influenced by sample size, study design, generalized vs. specific cancer sites which highlight the need for further research. Comorbidities like cancer disease progression, renal disease, pulmonary disease, infections, and other factors that may add risk to poor survival should alsobeconsidered when monitoring overall survival. As observed by Chen et al., 2018, the early-onset venous thromboembolism was linked with poor survival. This observation highlighted the importance of VTE screening since the initial diagnosis of cancer as the risk increase in the first months after diagnosis. In this study, 25% of cases encountered VTE in the first six months while the remaining had VTE after one year with a median duration of 22 months from cancer diagnosis to VTE occurrence. On the other hand, it was observed by Agnelli et al., 2014 who monitored the VTE risk prospectively, that the risk was 2–folds higher in the first 12 months after an initial cancer diagnosis. Similarly, a study published by Wang et al., 2019 found that the VTE cases increased significantly in the first three months affecting 50% of cases and the risk of death increases after three months of VTE event.
+
+A recent systematic review published by Mulder et al., 2019, analysing the most validated risk assessment tools named Khorana risk assessment tool for ambulatory cancer patients, revealed that most VTE events occurred within the low and intermediate-risk groups. This observation reflects that more studies are required to validate more predictive risk factors to establish precise assessment tools. In King Faisal Specialist Hospital in Riyadh, the Caprine VTE assessment tool is now followed as a mandatory measure for all hospitalized patients before admission considering cancer patients as a very high-risk group. In ambulatory cancer patients the Khorana risk assessment tool is used but as an optional measure to be decided according to the case of the patients by the physician. The retrospective design of the study was a significant limitation causing the enrolment of only a small sample size of the VTE cases due to the difficulty of radiological reports retrieval from the system. The chance of a repetition of any failure of the extraction procedure was limited because of the FFPE samples used in the study. Also, cancer cases included in this study without stratification of the cancer types making the study generalized rather than cancer specific. To our knowledge, this is the first study in Saudi Arabia to investigate genetic predictive risk factors related to VTE risk in cancer patients.
+
+## 5. Conclusion
+
+Venous thromboembolism showed a major complication of cancer in our study population. The molecular and clinical predication biomarkers for VTE risk in Saudi Arabian population are limited and need further research. This step is beneficial to establish the appropriate thromboprophylaxis plans maximizing the efficacy of anticoagulation treatments and minimizing the risk of bleeding.
+
+We recommend running this study in a prospective design to monitor the cancer patients closely and collect the required data precisely as needed. Larger study population with a case: control ratio with 1:1 or 1:2 for an accurate statistical comparison is recommended too. Also, it is recommended to conduct this study on a specific cancer type starting from the common type in the region.
+
+High throughput molecular technologies are recommended to explore the VTE molecular prediction markers. Finally, exploring the clinical VTE risk factors in our population is highly recommended.
+
+## Declaration Of Competing Interest
+
+The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
+
+## Acknowledgments
+
+Special thanks to all research assistants (Mr. Ranilo. M. Tumbaga, Mr. Horace T. Pacifico, and Mrs. Jee Entusiasamo Aquino) at the Department of Genetic Research, Institute for Research and Medical Consultations, Heath informatics department (Mr. Essam Elmemegy), Histopathology laboratory (Mohammed Foqha) and Radiology Department (Dr. Najla altuwaijri) at king Fahad specialist hospital Dammam who helped us during the conduction of this study, Also thanks to the Deanship of Scientific Research, Imam Abdulrahman Bin Faisal University for supporting this work.
+
+## References
+
+Abdol Razak, N.B., Jones, G., Bhandari, M., Berndt, M.C., Metharom, P., 2018. Cancerassociated thrombosis: an overview of mechanisms, risk factors, and treatment.
+
+Cancers 10 (10), 380.
+
+Agnelli, G., Verso, M., Mandalà, M., Gallus, S., Cimminiello, C., Apolone, G., Di Minno, G., Maiello, E., Prandoni, P., Santoro, A., Crinò, L., 2014. A prospective study on survival in cancer patients with and without venous thromboembolism. Internal and emergency medicine 9 (5), 559–567.
+
+Aleem, A., Diab, A.R.A., Alsaleh, K., Algahtani, F., Alsaeed, E., Iqbal, Z., El-Sherkawy, M.S., 2012. Frequency, clinical pattern and outcome of thrombosis in cancer patients in Saudi Arabia. Asian Pacific Journal of Cancer Prevention 13 (4),
+1311–1315.
+
+Angelini, D. and Khorana, A.A., 2017, July. Risk assessment scores for cancerassociated venous thromboembolic disease. In Seminars in thrombosis and hemostasis (Vol. 43, No. 05, pp. 469-478). Thieme Medical Publishers.
+
+Bennett, J.S., Catella-Lawson, F., Rut, A.R., Vilaire, G., Qi, W., Kapoor, S.C., Murphy, S.,
+FitzGerald, G.A., 2001. Effect of the PlA2 alloantigen on the function of b3integrins in platelets. Blood, The Journal of the American Society of Hematology 97 (10), 3093–3099.
+
+Bianconi, D., Schuler, A., Pausz, C., Geroldinger, A., Kaider, A., Lenz, H.-J., Kornek, G.,
+Scheithauer, W., Zielinski, C.C., Pabinger, I., Ay, C., Prager, G.W., 2015. Integrin beta-3 genetic variants and risk of venous thromboembolism in colorectal cancer patients. Thrombosis research 136 (5), 865–869.
+
+Chen, J.S., Hung, C.Y., Chang, H., Liu, C.T., Chen, Y.Y., Lu, C.H., Chang, P.H., Hung, Y.S.,
+Chou, W.C., 2018. Venous thromboembolism in asian patients with pancreatic cancer following palliative chemotherapy: Low incidence but a negative prognosticator for those with early onset. Cancers 10 (12), 501.
+
+Connolly, G.C. and Francis, C.W., 2013. Cancer-associated thrombosis. Hematology 2013, the American Society of Hematology Education Program Book, 2013(1), pp.684-691.
+
+Database, G. H. G. 2019. ITGB3 Gene - GeneCards | ITB3 Protein | ITB3 Antibody. Donnellan, E., Khorana, A.A., 2017. Cancer and venous thromboembolic disease: a review. The Oncologist 22 (2), 199–207.
+
+Eichinger, S., 2016. Cancer associated thrombosis: risk factors and outcomes.
+
+Thromb Res 140 (Suppl 1), S12–S17.
+
+Fernandes, C.J., Morinaga, L.T.K., Alves, J.L., Castro, M.A., Calderaro, D., Jardim, C.V.P.,
+Souza, R., 2019. Cancer-associated thrombosis: the when, how and why. Eur Respir Rev 28.
+
+Fullard, J.F., 2004. The role of the platelet glycoprotein IIb/IIIa in thrombosis and haemostasis. Curr Pharm Des 10, 1567–1576.
+
+Gran, O.V., Brækkan, S.K., Hansen, J.B., 2018. Prothrombotic genotypes and risk of venous thromboembolism in cancer. Thromb Res 164 (Suppl 1), S12–S18.
+
+Hiraide, M., Shiga, T., Minowa, Y., Nakano, Y., Yoshioka, H., Suzuki, K., Yasuda, C.,
+Takahashi, H., Hama, T., 2020. Identification of risk factors for venous thromboembolism and evaluation of Khorana venous thromboembolism risk assessment in Japanese lung cancer patients. J Cardiol 75 (1), 110–114.
+
+Huang, J., Li, X., Shi, X., Zhu, M., Wang, J., Huang, S., Huang, X., Wang, H., Li, L., Deng, H., Zhou, Y., Mao, J., Long, Z., Ma, Z., Ye, W., Pan, J., Xi, X., Jin, J., 2019. Platelet integrin aIIbb3: signal transduction, regulation, and its therapeutic targeting. J
+Hematol Oncol 12, 26.
+
+Iorga, R.A., Bratu, O.G., Marcu, R.D., Constantin, T., Mischianu, D.L.D., Socea, B.,
+Gaman, M.A., Diaconu, C.C., 2019. Venous thromboembolism in cancer patients:
+Still looking for answers. Exp Ther Med 18, 5026–5032.
+
+Khalil, J., Bensaid, B., Elkacemi, H., Afif, M., Bensaid, Y., Kebdani, T., Benjaafar, N.,
+2015. Venous thromboembolism in cancer patients: an underestimated major health problem. World J Surg Oncol 13, 204.
+
+Khatami, M., Heidari, M.M., Soheilyfar, S., 2016. Common rs5918 (PlA1/A2)
+polymorphism in the. Arch Med Sci Atheroscler Dis 1, e9–e15.
+
+Khorana, A.A., Connolly, G.C., 2009. Assessing risk of venous thromboembolism in the patient with cancer. J Clin Oncol 27, 4839–4847.
+
+Komsa-Penkova, R., Golemanov, G., Tsankov, B., Ivanov, P., Beshev, L., Tonchev, P.,
+2017. Rs5918ITGB3 Polymorphism, Smoking, and BMI as Risk Factors for Early Onset and Recurrence of DVT in Young Women. Clin Appl Thromb Hemost 23, 585–595.
+
+Mohammed, A.A., Al-Zahrani, A.S., Farooq, M.U., Ghanem, H.M., Abdelaziz, L.A., ElKhatib, H.M., 2015. Pattern of Venous Thrombosis in Cancer Patients: Frequency and Survival Effect; Single Center Experience. Indian J Hematol Blood Transfus 31, 439–445.
+
+Mulder, F.I., Candeloro, M., Kamphuisen, P.W., Di Nisio, M., Bossuyt, P.M., Guman, N.,
+Smit, K., Büller, H.R., Van Es, N., Collaborators, C.-P., 2019. The Khorana score for prediction of venous thromboembolism in cancer patients: a systematic review and meta-analysis. Haematologica 104, 1277–1287.
+
+Mulder, F.I., Horvàth-Puhó, E., van Es, N., van Laarhoven, H.W.M., Pedersen, L.,
+Moik, F., Ay, C., Büller, H.R., Sørensen, H.T., 2021. Venous thromboembolism in cancer patients: a population-based cohort study. Blood 137 (14), 1959– 1969.
+
+Muñoz Martín, A.J., Ortega, I., Font, C., Pachón, V., Castellón, V., Martínez-Marín, V.,
+Salgado, M., Martínez, E., Calzas, J., Rupérez, A., Souto, J.C., Martín, M., Salas, E.,
+Soria, J.M., 2018. Multivariable clinical-genetic risk model for predicting venous thromboembolic events in patients with cancer. Br J Cancer 118, 1056–1061.
+
+Maia, R., Neves, I., Morais, A., Queiroga, H., 2019. Venous and lung thromboembolism in the context of lung cancer: clinical manifestations, risk factors and prognosis. Acta medica portuguesa 32 (10), 647–653.
+
+Sheth, R.A., Niekamp, A., Quencer, K.B., Shamoun, F., Knuttinen, M.G., Naidu, S., Oklu, R., 2017. Thrombosis in cancer patients: etiology, incidence, and management.
+
+Cardiovasc Diagn Ther 7, S178–S185.
+
+Sherry, S.T., Ward, M.H., Kholodov, M., Baker, J., Phan, L., Smigielski, E.M., Sirotkin, K., 2001. dbSNP: the NCBI database of genetic variation. Nucleic Acids Research 29 (1), 308–311.
+
+Sikora, M.J., Thibert, J.N., Salter, J., Dowsett, M., Johnson, M.D., Rae, J.M., 2011. Highefficiency genotype analysis from formalin-fixed, paraffin-embedded tumor tissues. Pharmacogenomics J 11, 348–358.
+
+Timp, J.F., Braekkan, S.K., Versteeg, H.H., Cannegieter, S.C., 2013. Epidemiology of cancer-associated venous thrombosis. Blood 122, 1712–1723.
+
+Tinholt, M., Viken, M.K., Dahm, A.E., Vollan, H.K., Sahlberg, K.K., Garred, O., BørresenDale, A.L., Jacobsen, A.F., Kristensen, V., Bukholm, I., Kåresen, R., Schlichting, E.,
+Skretting, G., Lie, B.A., Sandset, P.M., Iversen, N., 2014. Increased coagulation activity and genetic polymorphisms in the F5, F10 and EPCR genes are associated with breast cancer: a case-control study. BMC Cancer 14, 845.
+
+Wang, H., Xu, X., Pu, C., Li, L., 2019. Clinical characteristics and prognosis of cancer patients with venous thromboembolism. J Cancer Res Ther 15, 344–349.
+
+Xiang, Q., Ji, S.D., Zhang, Z., Zhao, X., Cui, Y.M., 2016. Identification of. Biomed Res Int 2016, 5675084.
+
+Zheng, L.-X., Li, L.i., Huang, J.-H., Mai, Y.-M., Chen, C., Dong, J.-H., Xu, Z.-Y., Li, W.-F.,
+Chen, X.-R., 2021. Venous thromboembolism in patients with severe lung cancer: a narrative review. Annals of Palliative Medicine. 10 (6), 6957–6967.

medical/md/PMC9015197.md

@@ -0,0 +1,97 @@
+# Ideas And Innovations
+
+![0_Image_0.Png](0_Image_0.Png)
+
+![0_Image_3.Png](0_Image_3.Png)
+
+![0_image_2.png](0_image_2.png)
+
+# Schlieren Phenomenon For Identification Of 
+
+![0_Image_1.Png](0_Image_1.Png) Lymphorrhea Point
+
+Yohei Sotsuka, MD, PhD
+Hanako Wakatsuki, MD, PhD
+Ken Matsuda, MD, PhD
+Summary: Surgical invasion of the lymphatic system can lead to lymphorrhea. Lymphorrhea is first treated conservatively, but is often refractory and subsequently treated surgically. In surgery, it is difficult to identify the lymphatic leak points visually. In this study, we observed the schlieren phenomenon based on the difference in the refractive index between glucose solution and lymph fluid, and were able to easily identify the site of the lymphatic leakage in real time and treat lymphorrhea. (Plast Reconstr Surg Glob Open 2022;10:e4269; doi: 10.1097/GOX.0000000000004269; Published online 18 April *2022.)*
+
+## Introduction
+
+Lymphorrhea is one of the postoperative complications of surgical invasion of the lymphatic system.1-4 When conservative treatment fails, surgical treatment is usually performed after identifying the site of lymphorrhea, using lymphoscintigraphy or indocyanine green (ICG).5,6 Surgical procedures include lymphatic vessel ligation, fibrin glue application, and lymphaticovenular anastomosis.4 Lymphatic fluid is colorless and transparent, making intraoperative exact identification of lymphatic leak points difficult; therefore, ICG is usually used.6,7 ICG 
+requires an infrared camera system, making it difficult to visualize directly in the operative field in real time unless digital technology is used.7 In addition, ICG adheres to the surgical field, and observation becomes more difficult with time (Fig. 1). The schlieren phenomenon is a phenomenon in which a striped pattern or a misty shadow appears in a transparent medium when the refractive index differs from place to place. In this study, we report that the use of dextrose solution can easily reveal the point where the lymphatic fluid leaks from the lymph vessels under direct vision in the surgical field using the schlieren phenomenon caused by the difference in refractive index between lymphatic fluid and hypertonic glucose solution. This study was approved by the ethics committee of Niigata University (approval number: 2021-0128), 
+and adhered to the tenets of the Declaration of Helsinki.
+
+From the Department of Plastic and Reconstructive Surgery, Niigata University Graduate School of Medicine, Niigata, Japan. Received for publication October 19, 2021; accepted February 28, 2022. Copyright © 2022 The Authors. Published by Wolters Kluwer Health, Inc. on behalf of The American Society of Plastic Surgeons. This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.
+
+DOI: 10.1097/GOX.0000000000004269
+
+## Surgical Procedure
+
+The intraoperative wound with lymphorrhea is observed and filled up with 2–3ml of 50% dextrose solution. Because the lymphatic fluid is lighter than glucose solution, if the lymphatic fluid exudes from the lymphatic vessel, it is observed rising in the glucose solution like a striped pattern or a misty shadow even though it is the same transparent liquid, just like a point of the ocean where an underwater hot spring is bubbling up, and that is to be the schlieren phenomenon caused by the difference in the concentration of lymphatic fluid and hypertonic glucose solution. Once the wound is filled up with 50% dextrose solution, lymphatic fluid usually leaks out of the lymphatic vessel after a little while, as shown in the Supplemental Video, without milking any distal part of the body. (**See Video [online],** which displays the surgical procedure for identification of lymphorrhea points using schlieren phenomenon.)
+If the leakage point is identified, the region is ligated with 6-0 polypropylene sutures (Prolene; Ethicon, Inc., Somerville, N.J.). The wound is closed after confirming that there are no lymph leaks.
+
+## Case Report
+
+A 62-year-old man had right inguinal lymphorrhea after an aortic valve replacement. His lymphorrhea started 2 weeks after the surgery; it continued despite conservative treatments, including compression, aspiration, and drainage. Four weeks after the surgery, the wound was subsequently treated with negative pressure wound therapy; every daily amount of lymphorrhea was estimated to be more than 500ml and showed no signs of decreasing. Eight weeks after cardiovascular surgery, re-exploration Disclosure: *The authors have no financial interest to declare* in relation to the content of this article.
+
+Related Digital Media are available in the full-text version of the article on www.PRSGlobalOpen.com.
+
+![1_image_0.png](1_image_0.png)
+
+## Discussion
+
+When conservative treatment fails for lymphorrhea patients, surgical treatments are usually performed after identifying the site of lymphorrhea using lymphoscintigraphy or ICG.5,6 The best treatment for injured lymph vessels may be direct repair; however, it is difficult to find damaged lymph vessels in a previously treated and scarred wound.8 In addition, lymphatic fluid is colorless and transparent, making intraoperative exact identification of lymphatic leak points difficult. So that treatment often fails, and additional treatments such as lymphaticovenular anastomosis are then often administered.6 To prevent direct repair treatment failure, the exact location of the lymphatic fluid leaking site needs to be identified. For exact identification of lymphatic leak points, ICG is usually used. However, ICG requires an infrared camera system. Those displays are usually placed besides the operation table or on the wall of the operation room. To identify lymphatic vessels in the infrared view, the operator has 
+
+2 and macroscopic ligation were performed using the schlieren phenomenon as described (Figs. 2, 3), and the wound was closed in layers. No lymphorrhea recurrence was observed 2 months after the ligation (Fig. 4).
+
+![1_image_2.png](1_image_2.png)
+
+## Takeaways
+
+Question: In patients with lymphorrhea, it is difficult to pinpoint the exact site of lymphatic leakage during surgery. Is there an easy way to do this?
+
+Findings: We were were able to easily identify the site of the lymphatic leakage in real time by observing the schlieren phenomenon based on the difference in the refractive index between glucose solution and lymph fluid.
+
+Meaning: Using glucose solution in the surgical field for lymphorrhea patients is an easy way to identify the exact site of the lymphatic leakage in real time during surgery.
+
+to move his or her viewpoint from the display to the operation field, back and forth, which means it is difficult to 
+
+![1_image_1.png](1_image_1.png)
+
+visualize directly in the operative field in real time. There is a report of using digital technology to overcome these shortcomings, but it has not become widespread.7 In addition, ICG adheres to the surgical field, and observation becomes more difficult with time (Fig. 1).
+
+The schlieren phenomenon is a photographic process in which a striped pattern or a misty shadow appears in a transparent medium when the refractive index differs from place 
+
+![1_image_3.png](1_image_3.png)
+
+to place. The word *schlieren* comes from the German *schliere*, 
+meaning "streak" in English. For example, a mirage, a naturally-occurring optical phenomenon, is caused by the schlieren phenomena.9 Because the lymphatic fluid is lighter than glucose solution, in this study, we attempted to identify lymphatic leak points using the schlieren phenomenon caused by the difference in refractive index between lymphatic fluid and hypertonic glucose solution, even though they are the same transparent liquid. With our method using schlieren phenomenon, the only item we need for the surgery is a hypertonic glucose solution. In addition, this method also has the advantage of being able to be used many times intraoperatively because glucose solution does not remain in the surgical field as ICG remains in the surgical field, making observation in the operative field difficult over time. Glucose solution is always available at any facility, and this method seems to be inexpensive and very simple, and no additional system is required. We used this method for a case of lymphorrhea in the groin; it can be used not only in the groin but also in any part of the body where lymphorrhea is observed and where glucose solution can be applied.
+
+Although blood glucose level fluctuation is one of the adverse events to be noted when using 50% dextrose solution, the amount of glucose solution used in the lesion is about 2–3ml, which is about 1.5g in terms of dextrose. Even if all of the glucose is absorbed into the body, the blood glucose level fluctuation is considered to be within the range of 10mg per dL,10 which has little impact on patients.
+
+## Conclusion
+
+In conclusion, our results indicated that the use of dextrose solution can easily reveal the point where the lymphatic fluid leaks from the lymph vessels under direct vision in the surgical field.
+
+Yohei Sotsuka, MD, PhD
+Department of Plastic and Reconstructive Surgery Niigata University Graduate School of Medicine 1-757, Asahimachi-Dori Niigata 951-8510, Japan E-mail: sotsu@sotsuka.com
+
+REFERENCES
+1. Skudder PA Jr, Geary J. Lymphatic drainage from the groin following surgery of the femoral artery. *J Cardiovasc Surg (Torino).*
+1987;28:460–463.
+
+2. al-Salman MM, Rabee H, Shibli S. Groin lymphorrhea postoperative nuisance. *Int Surg.* 1997;82:60–62. 3. Boccardo F, Campisi CC, Molinari L, et al. Lymphatic complications in surgery: possibility of prevention and therapeutic options. *Updates Surg.* 2012;64:211–216. 
+
+4. Lv S, Wang Q, Zhao W, et al. A review of the postoperative lymphatic leakage. *Oncotarget.* 2017;8:69062–69075. 
+
+5. Jones TR, Carlisle MR, Hofmann LV, et al. Lymphoscintigraphy in the diagnosis of lymphatic leak after surgical repair of femoral artery injury. *Clin Nucl Med.* 2001;26:14–17. 
+
+6. Yamamoto T, Yoshimatsu H, Koshima I. Navigation lymphatic supermicrosurgery for iatrogenic lymphorrhea: supermicrosurgical lymphaticolymphatic anastomosis and lymphaticovenular anastomosis under indocyanine green lymphography navigation. *J Plast Reconstr Aesthet Surg.* 2014;67:1573–1579. 
+
+7. Nishimoto S, Kinoshita M, Miyazaki Y, et al. Lymphoedema of the penis and scrotum as a sequela of chronic skin infection. J Surg Case Rep. 2016;2016:rjw127. 
+
+8. Kadota H, Shimamoto R, Fukushima S, et al. Lymphaticovenular anastomosis for lymph vessel injury in the pelvis and groin. Microsurgery. 2021;41:421–429. 
+
+9. Friberg TR, Tano Y, Machemer R. Streaks (schlieren) as a sign of rhegmatogenous detachment in vitreous surgery. Am J Ophthalmol. 1979;88:943–944. 
+
+10. Bando H, Kato Y, Kanazawa S, et al. Variability of glucose and lifestyle in continuous glucose monitoring (CGM). *Asp Biomed* Clin Case Rep. 2018;2:1–3.

medical/md/PMC9067138.md

@@ -0,0 +1,239 @@
+# 
+
+Cite this: RSC Adv., 2019, 9, 22740
+
+# Flexible And Highly Sensitive Pressure Sensors Based
+
+![0_Image_0.Png](0_Image_0.Png) On Microcrack Arrays Inspired By Scorpions†
+
+Junqiu Zhang,ab Tao Sun,a Linpeng Liu,a Shichao Niu, a Kejun Wang,a Honglie Song, c Qigang Han, d Zhiwu Han, *a Luquan Rena and Qiao Linb Recently, there has been tremendous interest in flexible pressure sensors to meet the technological demands of modern society. For practical applications, pressure sensors with high sensitivity at small strains and low detection limits are highly desired. In this paper, inspired by the slit sensillum of the scorpion, a flexible pressure sensor is presented which has regular microcrack arrays and its reversed pattern acts as a tunable contact area of the sensing material microstructures. The template with regular crack arrays generated on the inner surface is fabricated using a solvent-induced swelling method, which provides a simple and economical way to obtain the controllable fabrication of crack arrays without any physical damage to materials. At the same time, the working principle of the bio-inspired pressure sensor is attributed to pressure-dependent variations because of the contact area change between the interlocking polydimethylsiloxane films with the negative and positive patterns of the microcrack arrays. The device shows good performance, with a gauge factor of 27.79 kPa1 (0–2.4 kPa),
+a short response/recovery time (111/95 ms), a low detectable pressure limit and excellent reproducibility over 3000 cycles. Practical applications, such as the detection of human motion and touch sensing, are then tested in this work, and the results imply that it should have significant potential applications in numerous fields. Note that the reversed pattern of the slit sensillum of the scorpion is explored to enhance the performance of pressure sensors, thus opening a new route for the fabrication of flexible pressure sensors, even wearable electronics, in a cost-effective and scalable manner.
+
+Received 15th May 2019 Accepted 29th June 2019 DOI: 10.1039/c9ra03663f rsc.li/rsc-advances
+
+## Introduction
+
+With the rapid development of wearable electronics and articial intelligence, exible pressure sensors have attracted considerable attention for their potential applications in healthcare monitoring,1–3 motion detection,4–6 smart robots7,8 as well as in highly advanced human-interactive devices.9,10 To date, many reported studies have focused on exible pressure sensors, by utilizing capacitive,11,12 piezoelectric,13,14 organic eld-effect transistor,15,16 triboelectric,17,18 and piezoresistive19,20 sensing mechanisms. Among them, piezoresistive sensors, which are composed of substrates and conducting material layers, can transduce the applied pressure or mechanical force aKey Laboratory of Bionic Engineering, Ministry of Education, Jilin University, Changchun 130022, People's Republic of China. E-mail: zwhan@jlu.edu.cn bDepartment of Mechanical Engineering, Columbia University, 500 West 120th Street, New York, NY 10027, USA
+cDepartment of Engineering Mechanics, Center for Flexible Electronics Technology, Center for Mechanics and Materials, Tsinghua University, Beijing 100084, People's Republic of China dCollege of Materials Science and Engineering, Jilin University, Changchun 130022, People's Republic of China
+† Electronic supplementary information (ESI) available. See DOI:
+10.1039/c9ra03663f into a change in resistance, and this has attracted tremendous research interest because of its simple sensing mechanism, easier fabrication, high reproducibility and low energy consumption.21,22 For higher performance, exible substrates and active materials play an important role in developing piezoresistive pressure sensors.
+
+Generally, the selection of an outstanding active material is one of the most predominant approaches to obtaining pressure sensors with a high sensitivity. To date, materials such as carbon nanotubes (CNTs),23,24 carbon black,25 graphene
+(including reduced graphite oxide),10,26,27 metal nanowires,11,28 metal–organic frameworks,29 and conductive polymers30,31 are usually used as the sensing elements because of their superior mechanical and electrical properties. Furthermore, elastomeric materials, including silicone-based elastomers, rubbers or epoxy, are oen exploited as exible substrates because of their excellent exibility, stretchability and stability. However, sensing materials endowed with outstanding electrical properties commonly have an undesired impact on the performance of pressure sensors. For example, CNTs can bring high sensitivity and tunable metallic/semiconducting properties.32 Nevertheless, the interface between the CNTs and the supporting substrates is not strong enough, which inuences the stability and service life of the pressure sensors. Therefore, introducing particular engineering structures to polymeric surfaces is another efficient way to realize the performance enhancement of pressure sensors has not been heavily promoted yet. Engineering structures such as pyramid arrays,17,33 micropillar arrays,34 microgrooves,35 interlocking36 and aligned37 nanobers, and hierarchical constructions,38 have been fabricated to endow exible pressure sensors with greatly enhanced pressure sensitivity. For example, the sensitivity of a pressure sensor with pyramid arrays was approximately 50 times higher than that of the pressure sensor with no microstructures.33 Despite the fact that signicant device sensitivity has been achieved, the previously mentioned microstructured lms are mainly replicated from silicon molds. The sophisticated molds largely depend on traditional lithography followed by a wet or dry etching process to form the desired geometry,19 which is a complicated, highcost and time-consuming process with limited scalability.
+
+Thus, it is a great challenge to fabricate pressure sensors with high sensitivity and on larger production scales.
+
+Fortunately, nature oen offers inspiration for the advancement of science and technology. Inspired from the silt sensory receptor of arthropods, researchers have established various crack-shaped, wearable strain sensors, which benet from the connection of the reversible crack fracture surfaces.39 In contrast, the crack-shaped structure is scarcely exploited to fabricate exible pressure sensors because much more control over the crack's morphology and layout is still required to turn the sensor into a sensitive one for pressure sensing. For example, Choi et al. developed a exible pressure sensor based on guiding straight cracks through a stretched metal layer deposited on polyurethane acrylate (PUA) lm. Before deposition, the PUA lm was pretreated with ultraviolet ood exposure.40 In addition to the complicated and multi-step processes, the crack sensor was mounted on a custom built machine in order to realize deformation to measure pressure, however this operates over a limited sensitivity and measurement regime. In previous work, a bio-inspired strain sensor based on regular microcrack arrays inspired by scorpions was prepared. Wellregulated microcrack arrays were fabricated using the solvent induced swelling and double template transfer method.41 However, strain sensors rely on structural deformation to achieve measurements, and so this is not suitable for complex surfaces with a large curvature. Furthermore, most reported strain sensors show a fairly limited sensing range. In addition, reversibly interlocked devices with specially designed physical structures can be found in nature, such as the wing-to-body locking device in beetles.42 This interlocking is operated by bringing dense microhairs on the cuticular surface in contact with each other to x the wings of the insects. In this paper, a new bio-inspired strategy to fabricate exible sensors with delicately geometric microstructures, inspired from the slit sensillum of scorpions, and its reversed pattern as a intelligently tunable contact area of sensing material microstructures is reported. Based on the crack geometry of the slit sensillum distributed on the legs, which accounts for the excellent vibrational sensing ability of scorpions, regular microcrack arrays and its reversed arrays were fabricated without damage to materials using the same method as used before.41 Because of the effective interlocking of the crack arrays and its reversed pattern, the pressure sensor shows ultrahigh sensitivity and great potential for wearable electronic devices as well as in robot sensing systems. As far as is known, the reversed microstructures of the creatures used in the sensor fabrication have not been exploited. It is believed that this unique approach opens a new route to fabricate exible pressure sensors, and even wearable electronics, in a cost-effective and scalable way.
+
+## Experimental Section Preparation Of Crack Arrays On A Ps Petri Dish Lid
+
+Crack arrays were generated on the polystyrene (PS) Petri dish lid using the solvent-induced method reported previously.41
+
+## Preparation Of Pdms Positive And Negative Replicas Using Ps Crack Array Molding
+
+To fabricate the reversed pattern of the crack arrays, polydimethylsiloxane (PDMS, Dow Corning Sylgard 184), consisting of a pre-polymer and curing agent was manually mixed in the proportion of 10 : 1 (w/w), and cast onto the Petri dish lid aer mixing uniformly. Next the sample was put into a vacuum chamber (BZF-30, Shanghai Boxun Industrial Co., Ltd) for 1 h to remove air bubbles. Aer heating in an oven (GZX-GF, LongYue Instrument Equipment Co., Ltd) at 70 C for 3 h, the PDMS lm with a negative pattern was carefully peeled off from the Petri dish lid. Crack arrays were transferred onto the surface of a PDMS lm using a double template transferring method.
+
+Epoxy AB glue (Ausbond (China) Co., Ltd) composed of a resin precursor and curing agent, was mixed thoroughly in a 3 : 1 (w/
+w) ratio to fabricate an intermediate transition layer and was then poured into the Petri dish lid. Aer a vacuum degassing process the sample was heated at 60 C for 2 h, and then peeled off the Petri dish lid aer curing. Next, the PDMS was mixed uniformly in a 10 : 1 (w/w) ratio, and then cast onto the epoxy mold. A 1 h degassing process was needed before the sample was put in the oven. Aer a 3 h heating process, the PDMS lm was peeled off from the solid Epoxy AB lm with the crack arrays on the surface.
+
+## Fabrication Of Microcrack Array-Based Pressure Sensor
+
+The microstructured PDMS lms were cut into pieces with dimensions of 40  10 mm (l  w). Then samples with regular positive and negative patterns of crack arrays were selected and treated (120 W, 20 s) by plasma and then immersed in a sodium lauryl sulfate (SDS, Shengtongxin Company, Tianjin, China)
+solution (0.5%, 15 s). A 30 nm thick silver (Ag) layer was deposited on the top of the PDMS sheets to introduce a layer of electricity active using sputter coating (108auto sputter coater, Cressington). Aer copper (Cu) paste and Cu wires were anchored on the Ag layer, two layers of coated PDMS lms with the micro-structured surfaces were placed face-to-face, to make the nal bio-inspired exible pressure sensors. In order to exclude the interference of environmental factors, the pressure sensor was covered with a 50 mm thick encapsulation layer.
+
+## Results And Discussion
+
+Fig. 1 illustrates the novel design of the exible pressure sensor inspired by scorpions, which were sensitive to environmental vibrations. Aer undergoing billions of years of natural selection and evolution, a number of creatures have gained the knowledge on how to realize optimal functions with the lowest cost of resources. Microstructures widely exist upon the surfaces of natural creatures.43 With the existence of these characteristic surface constructions, plants or animals can have a self-cleaning function,44 possess highly dry adhesion,45 and exhibit sensitive, stimuli-responsive behaviors.46 Thus, researchers have done much research to develop biomimetic functional surfaces to mimic the intrinsic structures of creatures, while showing little interest in the reversed pattern of the micro-structured surfaces of creatures.
+
+As shown in Fig. 1a, it was demonstrated that scorpions are extremely sensitive to vibratory stimuli. Scorpions sense minute vibrations with sensory sensillum called the slit sensillum for the detection of prey and predators, and which are embedded in the cuticle near their leg joints.47 In order to characterize the surface morphology of the crack-shaped slit sensillum from Heterometrus petersii (Giant Forest Scorpion), scanning electronic microscopy (SEM) was used (Fig. 1b). It was found that the slit sensillum consisted of 12 microcrack units arranged in a radial-like pattern on the surface (Fig. 1c). Inspired by the geometry and the function of the slit sensillum (Fig. S1, ESI†),
+a exible pressure sensor based on microcrack arrays is presented in this paper. The strategy that relies on the utilization of crack arrays inside the active materials, in which charge carrier transport occurs via a tunneling effect has always been regarded as an effective way to fabricate a strain sensor with high sensitivity. However, crack arrays have rarely been explored for the development of pressure sensors because more control over the morphology and the arrangement of the cracks were required to achieve pressure sensing. In addition to the well-controlled crack arrays that were fabricated in this research, it is worth noting that the reversed pattern of the crack-shaped slit sensillum was creatively utilized to achieve reversible interlocking with the crack arrays, which contributes to the extremely high sensitivity to the external pressure applied on the pressure sensor (Fig. 1d). In general, this is a totally new approach to the fabrication of exible pressure sensors in a simple yet efficient manner.
+
+Fig. 2a illustrates the overall fabrication process for the pressure sensor based on the microcrack arrays. To imitate the geometry of the sensillum, the PS Petri dish acted as the template with regular crack arrays generated on the inner surface using a solvent-induced swelling method reported previously. It provided a simple and economical way to obtain the controllable fabrication of the dimensions of the cracks.41 Then, PDMS was selected as the substrate in this study because of its excellent elasticity and its biomedical compliance for use with human tissue.48 Aer a one-step molding from the PS Petri dish with the uniform crack arrays initiated, the PDMS lm can be endowed with the negative pattern of the crack arrays, and a double template process was needed to transfer the crack arrays onto the top of the PDMS lm. In terms of structure, the fabricated PDMS lms achieved a high level of simulation of the morphology of the slit sensillum of the scorpion. The thickness of the PDMS lms was controlled in the range of 300  50 mm.
+
+The morphology and microstructure of the PDMS lms with the negative as well as the positive patterns of the crack arrays were observed using atomic force microscopy (AFM, Fig. 2b and c). More details, including the uniformity of the microstructures on PDMS and the PS Petri dish, are shown in Fig. S2–S4 (ESI†).
+
+The results indicated that the width and depth of the negative and positive patterns of the cracks were 3 mm and 2 mm, respectively.
+
+Aer fabricating microstructured PDMS substrates, a thin layer of conducting Ag was deposited upon the surfaces to effectively transport the electrons. The adhesion between the active layers and the exible substrates plays a vital role in determining the lifetime of the device. In order to reinforce the interface adhesion, the cured PDMS was treated by plasma and then immersed in sodium lauryl sulfate to deposit –SO3 groups on the surface of the PDMS substrate with the microstructures before depositing the Ag layer. It is mainly thought that this
+
+![2_image_0.png](2_image_0.png)
+
+ 
+
+![3_image_0.png](3_image_0.png)
+
+process can introduce a condensation reaction of the hydrophilic functionalities, leading to close contact between PDMS
+and Ag+.
+
+49 Also, in order to avoid the adhesiveness of the PDMS
+hindering the performance of the pressure sensor, a polyethylene terephthalate (PET) lm was placed onto the top and bottom PDMS lms as the encapsulation layers.
+
+Fig. 3 shows the working principle of the exible pressure sensor based on the positive and negative pattern of the crack arrays. Consequently, two layers of coated PDMS lms with the microstructured surfaces were placed face-to-face into a logically interlocked construction. Because of the existence of this special construction, external pressure and local deformations concentrated at the small contact spots. As a result, a signicant resistance change would appear even at a small external pressure. To better understand the resistive response of the pressure sensor, a simple circuit can be developed, as shown in Fig. 3a.
+
+The equivalent circuit diagram could be described as follows:
+
+$\mathbf{R}=\mathbf{R}_{\mathbf{S}}+\mathbf{R}_{\mathbf{C}}^{\mathbf{R}}$  $\mathbf{R}=\mathbf{R}_{\mathbf{S}}+\mathbf{R}_{\mathbf{C}}^{\mathbf{R}}$ 
+(1)  $\frac{1}{2}$  (2)  ... 
+where R stands for the resistance of pressure, RS is the sum of the resistances of the PDMS surfaces, RC is the resistance of the contact area between the PDMS lms, RL is the resistance of a single contact interface, n is the number of conducting paths, b is the area of a single contact interface, and c is a constant.
+
+Under compressive mode, the sensor response to pressure was reected in its resistance change with respect to the initial state
+(R0  R ¼ DR), as described in eqn (3):
+
+$$\Delta R={\frac{n\Delta R_{\mathrm{{C}}}}{\Delta R_{\mathrm{{C}}}^{n}}}=\left({\frac{2n R_{\mathrm{{L}}}}{\Delta b c}}\right){\Bigg/}\left({\frac{R_{\mathrm{{L}}}}{\Delta b c}}\right)^{2n}$$
+$$\quad(3)$$
+Dbc2n(3)
+ 
+
+![4_image_0.png](4_image_0.png)
+
+where Db is the contact area change, and eqn (3) forms the theoretical basis for quantifying the sensor response to pressure in terms of the contact area change incurred by the top and bottom PDMS lms under external force. Thus, a small compression incurred by an external pressure would build a closer interlocking construction, yielding an increased contact area and providing increased conductive as well as a corresponding resistance decrease [Fig. 3b(i)]. Aer the unloading process, these microstructured PDMS lms would recover their original position, resulting in the increase of the resistance to the initial state. Unfortunately, not all the crack arrays and their reversed patterns can form a reversible interlocking construction, as shown in Fig. 3b(ii). When this happens, the reversed pattern on the top PDMS lm will deform and yield close contact between the microstructures. Generally, the microstructures on the PDMS surface were benecial for improving the sensitivity because of the dramatically increased area under a small applied force.
+
+Fig. 3c and 3d also show the outstanding sensitivity of the pressure sensor based on the negative and positive patterns of the crack arrays. To investigate the effect of the microstructures on the sensing performance, the resistance-pressure behaviors of the pressure sensors with and without microstructures were compared, as shown in Fig. 3c(i) and (ii). Under a 350 Pa pressure, the resistance of the pressure sensor with the negative and positive patterns of the crack arrays dramatically decreased whereas the counterpart without a microstructure upon its surface showed a tiny resistance change (Fig. 3d). In the pristine state, the microstructures on the top and bottom of the PDMS
+lms partially contacted and formed a conductive path. When a small pressure was applied, the contact area between the microstructured lms can increase signicantly, and thus, leads to a more obvious change in resistance than occurs with the unstructured PDMS lms, indicating a high sensitivity to the external pressure. The unstructured lms show few contacts, leading to a relatively low sensitivity. Furthermore, once the pressure was removed, the resistance returns fast to its initial value, implying that the microstructures can recover quickly.
+
+The sensitivity (S), which is expressed as S ¼ (R0  R)/R0P, is
+
+![5_image_0.png](5_image_0.png)
+
+usually regarded as one of the most important performance parameters for sensors, where R0 and R are the initial resistance and resistance under applied pressure, respectively. An ultrahigh sensitivity was obtained by utilizing a compression testing machine (a computer controlled stepping motor and a force sensor). The points in Fig. 4a can be divided into two regions based on the difference in sensitivity. When the applied pressure was less than 2.4 kPa (yellow region), the sensitivity of the device was 27.79 kPa1, which was much higher than that of the relatively large pressure region (1.32 kPa1 in the purple region, 2.4–6 kPa). In brief, a high device sensitivity of 27.79 kPa1 could be generated by this bio-inspired pressure sensor, which was comparable with, or even better, than most reported records of exible sensors (Table S1, ESI†). The separated tting of these points in both regions showed good linear behavior, indicating that the device could be used as a reliable pressure sensor. Here, two different contact modes are applied to explain the changing sensitivity. In the low pressure region, "point contact" was the main contact mode, causing the sharp increase of contact area between the microstructures. Aer that, the
+"point contact" gradually evolved into "area contact" with increasing external pressure in the blue region. In general, "area contact" meant that the conductive network became a stable state, and the applied pressure had little effect on the resistance. In short, the conspicuous change in resistance of the interlocked microcrack arrays could be contributed by the great variation in contact area.
+
+To completely evaluate the pressure sensor, other essential performance parameters, including detection limit, stability, reliability and response time, all needed to be considered and examined. Because of the ultrahigh sensitivity of the pressure sensor with the microcrack arrays, it could be suitable for the detection of small changes in pressure. Fig. 4c shows that the pressure sensor can detect a subtle pressure of 9.6 Pa and 35 Pa for a pushpin and a corn kernel, respectively, demonstrating the fast response, high sensitivity and reliability of the pressure sensor to a subtle pressure. To investigate the response time of the sensors to applied forces, the output resistance signals were recorded (Fig. 4b). It can be seen that the rise time and drop time were 111 ms and 95 ms, respectively, indicating that there was a faster resistance signal variation in the force unloading than the force loading process. Theoretically, the response time would be further optimized as the thickness of the PDMS lms decrease, because correspondingly it reduced the hysteresis effect from the compression and relaxation times.48 Furthermore, the cycling stability of the prepared bio-inspired pressure sensor was measured under a pressure of about 350 Pa. As
+
+ 
+
+![6_image_0.png](6_image_0.png)
+
+shown in Fig. 4d, there was a repeatable and reliable response and no evident degeneration was observed within loading/ unloading for up to 3000 cycles, implying long working life and reliability of this bio-inspired pressure sensor.
+
+Because of the excellent performance parameters, the bioinspired sensor shows a tremendous potential for use in the detection of human physiological signals and motion activities.
+
+Firstly, the pressure sensor was adhered to a human throat for the real-time and non-invasive sensing of human physiological motion (Fig. 5a). The swallowing of saliva led to the obvious resistance change, indicating the sensor's outstanding ability to distinguish laryngeal motion. This might be helpful in a physiological monitor for the early detection of sudden infant death syndrome (SIDS) in sleeping infants or elderly people, warning doctors to any potential problems.41 Furthermore, the pressure sensors were mounted onto the forearm for reliable detection of radial muscle contractions caused by making a st and then reversing it (Fig. 5b). When the tester made a st, the sensor was under compression, resulting in a decrease in resistance. Also, it showed that the instant sensing performance was reproducible aer many cycles. Meanwhile, the bio-inspired sensor was attached onto a nger joint for detecting nger bending at different angles (Fig. 5c). A large resistance change was observed because of the different contact areas between the top and bottom PDMS lms. All these results demonstrated that the exible pressure sensor with negative and positive patterns of microcrack arrays could be used to distinguish subtle amounts of human motion for various potential applications.
+
+In addition, the pressure sensor was attached onto the surface of a PC mouse to detect the gentle tap produced by clicking the PC mouse (Fig. 5d). It was noticed that the sensor had a fast and reliable response to the tap of the nger. When the ngers were taken away, the sensor can return to the initial value. So this experiment suggests that the bio-inspired pressure sensor might have practical applications in exible touch screens. Further work is in progress to assemble the bioinspired pressure sensors into an active-matrix array in order to simultaneously map the pressure distribution, shape and location of touching sensing. Furthermore, our bio-inspired pressure sensor was used as an action sensitive exible switch to control the brightness of a light using a self-made circuit
+(Fig. 5e). When the nger touched and pressed the sensor at a high speed, the pressure sensor showed a prompt and repeatable response with an obvious change in the brightness of the LED (Video, ESI†). It can be concluded that the bio-inspired pressure sensor had potential for use in highly advanced human-interactive devices and so robotics as well as in other elds.
+
+## Conclusions
+
+In summary, a bio-inspired exible pressure sensor was fabricated based on negative and positive patterns of microcrack arrays, which were inspired by the slit sensillum of scorpions. It was noted that the negative and positive patterns of the delicate geometric structure of the slit sensillum were used creatively to build a logical tunable contact area in the sensing material microstructures. Because of the perfectly interlocked constructions, the pressure sensors showed excellent comprehensive performance when compared with other articial pressure sensors. Also, the uniform and regular microcrack arrays and their reversed pattern were fabricated using a solvent-induced swelling and template transferring method. In addition to the well-controlled morphology and arrangement of the crack arrays, this method could effectively avoid physical damage to the exible substrates, leading to a long working life, meaning that this was a low-cost, and simple fabrication process. In addition, the importance of the existence of the interlocking of the microcrack arrays and its reversed pattern were emphasized. The bio-inspired pressure sensor showed advantages, such as a high sensitivity of 27.79 kPa1, a quick response/
+recovery time (111/95 ms) and durable stability (negligible loading-unloading signal changes over 3000 cycles). Thus, the pressure sensor exhibits promising potential for use in exible wearable electronics and in so robotics as well as in humaninteractive devices. It is believed that this unique approach will be a new way to fabricate exible pressure sensors, and even wearable electronics, in a cost-effective and scalable manner.
+
+## Conflicts Of Interest
+
+There are no conicts to declare.
+
+## Acknowledgements
+
+This work was supported by the National Natural Science Foundation of China (No. 51675220, 51835006), the Natural Science Foundation of Jilin Province of China (No. 20170101115JC), the JLU Science and Technology Innovative Research Team (No. 2017TD-04), the Science and Technology Research Project of the Education Department of Jilin Province
+(No. 20190141), the Joint Construction Project of Jilin University and Jilin Province (No. SF2017-3-4), and the China Postdoctoral Science Foundation (No. 2019M650648).
+
+## Notes And References
+
+1 C. Pang, J. H. Koo, A. Nguyen, J. M. Caves, M. G. Kim, A. Chortos, K. Kim, P. J. Wang, J. B. H. Tok and Z. Bao, Adv. Mater., 2015, 27, 634–640.
+
+2 S. Lee, A. Reuveny, J. Reeder, S. Lee, H. Jin, Q. Liu, T. Yokota, T. Sekitani, T. Isoyama, Y. Abe, Z. Suo and T. Someya, Nat.
+
+Nanotechnol., 2016, 11, 472–478.
+
+3 Z. Lou, L. Li, L. Wang and G. Shen, Small, 2017, 13, 1–27.
+
+4 T. Q. Trung and N. E. Lee, Adv. Mater., 2016, 28, 4338–4372.
+
+5 X. Wang, Y. Zhang, X. Zhang, Z. Huo, X. Li, M. Que, Z. Peng, H. Wang and C. Pan, Adv. Mater., 2018, 30, 1–8.
+
+6 M. Liao, P. Wan, J. Wen, M. Gong, X. Wu, Y. Wang, R. Shi and L. Zhang, Adv. Funct. Mater., 2017, 27, 1–11.
+
+7 H. Liu, Z. Ji, H. Xu, M. Sun, T. Chen, L. Sun, G. Chen and Z. Wang, Polymers, 2017, 9, 586.
+
+8 L. Wang, D. Chen, K. Jiang and G. Shen, Chem. Soc. Rev.,
+2017, 46, 6764–6815.
+
+9 Y. Guo, Z. Guo, M. Zhong, P. Wan, W. Zhang and L. Zhang, Small, 2018, 14, 1–9.
+
+10 S. Lim, D. Son, J. Kim, Y. B. Lee, J. K. Song, S. Choi, D. J. Lee, J. H. Kim, M. Lee, T. Hyeon and D. H. Kim, Adv. Funct. Mater.,
+2015, 25, 375–383.
+
+11 X. Shuai, P. Zhu, W. Zeng, Y. Hu, X. Liang, Y. Zhang, R. Sun and C. P. Wong, ACS Appl. Mater. Interfaces, 2017, 9, 26314–
+26324.
+
+12 L. Ma, X. Shuai, Y. Hu, X. Liang, P. Zhu, R. Sun and C. P. Wong, J. Mater. Chem. C, 2018, 6, 13232–13240.
+
+13 W. Wu, X. Wen and Z. L. Wang, Science, 2013, 340, 952–957.
+
+14 C. Dagdeviren, Y. Su, P. Joe, R. Yona, Y. Liu, Y. S. Kim, Y. Huang, A. R. Damadoran, J. Xia, L. W. Martin, Y. Huang and J. A. Rogers, Nat. Commun., 2014, 5, 1–10.
+
+15 G. Schwartz, B. C.-K. Tee, J. Mei, A. L. Appleton, D. H. Kim, H. Wang and Z. Bao, Nat. Commun., 2013, 4, 1859.
+
+16 Y. Chu, X. Wu, J. Lu, D. Liu, J. Du, G. Zhang and J. Huang, Adv. Sci., 2016, 3, 1–6.
+
+17 W. Yang, J. Chen, X. Wen, Q. Jing, J. Yang, Y. Su, G. Zhu, W. Wu and Z. L. Wang, ACS Appl. Mater. Interfaces, 2014, 6, 7479–7484.
+
+18 L. Lin, Y. Xie, S. Wang, W. Wu, S. Niu, X. Wen and Z. L. Wang, ACS Nano, 2013, 7, 8266–8274.
+
+19 T. Li, L. Chen, X. Yang, X. Chen, Z. Zhang, T. Zhao, X. Li and J. Zhang, J. Mater. Chem. C, 2019, 7, 1022–1027.
+
+20 H. Liu, M. Dong, W. Huang, J. Gao, K. Dai, J. Guo, G. Zheng, C. Liu, C. Shen and Z. Guo, J. Mater. Chem. C, 2017, 5, 73–83.
+
+21 S. Jung, J. H. Kim, J. Kim, S. Choi, J. Lee, I. Park, T. Hyeon and D. H. Kim, Adv. Mater., 2014, 26, 4825–4830.
+
+22 H. Bin Yao, J. Ge, C. F. Wang, X. Wang, W. Hu, Z. J. Zheng, Y. Ni and S. H. Yu, Adv. Mater., 2013, 25, 6692–6698.
+
+23 S. Zhao, J. Li, D. Cao, G. Zhang, J. Li, K. Li, Y. Yang, W. Wang, Y. Jin, R. Sun and C. P. Wong, ACS Appl. Mater. Interfaces, 2017, 9, 12147–12164.
+
+24 H. Chen, Z. Su, Y. Song, X. Cheng, X. Chen, B. Meng, Z. Song, D. Chen and H. Zhang, Adv. Funct. Mater., 2017, 27, 1604434.
+
+25 N. Lu, C. Lu, S. Yang and J. Rogers, Adv. Funct. Mater., 2012, 22, 4044–4050.
+
+26 Y. Cheng, R. Wang, J. Sun and L. Gao, Adv. Mater., 2015, 27, 7365–7371.
+
+27 L. Q. Tao, K. N. Zhang, H. Tian, Y. Liu, D. Y. Wang, Y. Q. Chen, Y. Yang and T. L. Ren, ACS Nano, 2017, 11, 8790–8795.
+
+28 S. Yao and Y. Zhu, Nanoscale, 2014, 6, 2345–2352.
+
+29 X. Fu, H. Dong, Y. Zhen and W. Hu, Small, 2015, 11, 3351–
+3356.
+
+30 M. Amjadi, Y. J. Yoon and I. Park, Nanotechnology, 2015, 26, 375501.
+
+31 W. Zhong, Q. Liu, Y. Wu, Y. Wang, X. Qing, M. Li, K. Liu, W. Wang and D. Wang, Nanoscale, 2016, 8, 12105–12112.
+
+32 P. Lv, K. Yu, X. Tan, R. Zheng, Y. Ni, Z. Wang, C. Liu and W. Wei, RSC Adv., 2016, 6, 11256–11261.
+
+33 C. L. Choong, M. B. Shim, B. S. Lee, S. Jeon, D. S. Ko, T. H. Kang, J. Bae, S. H. Lee, K. E. Byun, J. Im, Y. J. Jeong, C. E. Park, J. J. Park and U. I. Chung, Adv. Mater., 2014, 26, 3451–3458.
+
+34 Q. Shao, Z. Niu, M. Hirtz, L. Jiang, Y. Liu, Z. Wang and X. Chen, Small, 2014, 10, 1466–1472.
+
+35 L. Pan, A. Chortos, G. Yu, Y. Wang, S. Isaacson, R. Allen, Y. Shi, R. Dauskardt and Z. Bao, Nat. Commun., 2014, 5, 1–8.
+
+36 C. Pang, G. Y. Lee, T. Il Kim, S. M. Kim, H. N. Kim, S. H. Ahn and K. Y. Suh, Nat. Mater., 2012, 11, 795–801.
+
+37 Q. Gao, H. Meguro, S. Okamoto and M. Kimura, Langmuir, 2012, 28, 17593–17596.
+
+38 J. Shi, Z. Yang, K. Xia, X. Zhang, H. Li, B. Sun, T. Pan and G. Ding, Flexible Printed Electron., 2018, 4, 015003.
+
+39 D. Kang, P. V. Pikhitsa, Y. W. Choi, C. Lee, S. S. Shin, L. Piao, B. Park, K. Y. Suh, T. Il Kim and M. Choi, Nature, 2014, 516, 222–226.
+
+40 Y. W. Choi, D. Kang, P. V. Pikhitsa, T. Lee, S. M. Kim, G. Lee, D. Tahk and M. Choi, Sci. Rep., 2017, 7, 1–8.
+
+41 Z. Han, L. Liu, J. Zhang, Q. Han, K. Wang, H. Song, Z. Wang, Z. Jiao, S. Niu and L. Ren, Nanoscale, 2018, 10, 15178–15186.
+
+42 C. Pang, T. Kim, W. G. Bae, D. Kang and S. M. Kim, Adv.
+
+Mater., 2012, 24, 475–479.
+
+43 Z. Han, Z. Mu, W. Yin, W. Li, S. Niu, J. Zhang and L. Ren, Adv.
+
+Colloid Interface Sci., 2016, 234, 27–50.
+
+44 H. Chen, P. Zhang, L. Zhang, H. Liu, Y. Jiang, D. Zhang, Z. Han and L. Jiang, Nature, 2016, 532, 85–89.
+
+45 M. K. Kwak, C. Pang, H. E. Jeong, H. N. Kim, H. Yoon, H. S. Jung and K. Y. Suh, Adv. Funct. Mater., 2011, 21, 3606–3616.
+
+46 E. Gingl, A. M. Burger and F. G. Barth, J. Comp. Physiol., 2006, 192, 551–558.
+
+47 F. G. Barth and M. Wadepuhl, J. Morphol., 1975, 145, 209–
+227.
+
+48 T. Yang, D. Xie, Z. Li and H. Zhu, Mater. Sci. Eng., R, 2017, 115, 1–37.
+
+49 J. Cui, B. Zhang, J. Duan, H. Guo and J. Tang, Sensors, 2016, 16, 2131.

medical/md/PMC9148206.md

@@ -0,0 +1,271 @@
+# Open Access Full Text Article Original Research Experiences Of Antiretroviral Therapy Initiation Among Hiv-Positive Adults In Ethiopia: A Descriptive Phenomenological Design
+
+Eden Tefera 1, Azwihangwisi Helen Mavhandu-Mudzusi2 1Department of Midwifery, College of Medicine and Health Sciences, Ambo University, Ambo, Ethiopia; 2Department of Health Studies, University of South Africa, Pretoria, South Africa Correspondence: Eden Tefera, Email edengirmaye@gmail.com Purpose: The aim of the study was to explore and describe the lived experiences of HIV-positive adults on antiretroviral therapy
+(ART) initiation in West Shoa Zone, Ethiopia.
+
+Materials and Methods: A descriptive phenomenological design was utilized in the study to gain insight into participants' lived experiences regarding ART initiation in West Shoa Zone, Ethiopia. Data were collected through semi-structured in-depth interviews and analyzed by means of thematic analysis.
+
+Results: The study found that spousal influence, denial of status, inconsistent ART initiation protocol, poverty, fear of side effects, religion and shortages of staff were factors that caused delayed ART initiation. A low CD4 count, the development of opportunistic infections and the prevention of future illness were factors that promoted ART initiation.
+
+Conclusion: This study provides an overview of experiences of adults living with HIV regarding ART initiation. The study emphasizes the need to improve adequate provision of resources to address issues related to finance, human capital, guidelines and inequity to enhance early ART initiation among HIV-positive adults in West Shoa Zone. The study findings have implications for policy implementation, ART service delivery, and the enhancement of prompt ART initiation in the study settings.
+
+Keywords: antiretroviral therapy, early antiretroviral therapy initiation, HIV, lived experience
+
+## Introduction
+
+Initiating antiretroviral therapy (ART) as early as possible following a human immunodeficiency virus (HIV) diagnosis is an emerging global strategy to contain the HIV epidemic and to optimize the health outcomes of people living with HIV
+and AIDS (PLHIV).1 The Joint United Nations Program on HIV/AIDS (UNAIDS) and the World Health Organization
+(WHO) embarked on a strategy of ending the acquired immune deficiency syndrome (AIDS) epidemic by 2030, envisaging that 95% of all people living with HIV should know their HIV status, 95% of all people with diagnosed HIV infection should receive sustained ART, and 95% of all people on ART should suppress viral load.2 Achieving universal access to HIV treatment and care and ending AIDS as a public health threat could be achieved by escalating the immediate initiation of ART during the early stages of HIV infection. Globally, by the end of 2021, 28.2 million people were accessing antiretroviral therapy.2 Initiating ART immediately after a person's infection with HIV assists in sustaining a higher CD4 count, inhibiting viral replications, and decreasing the likelihood of mortality and morbidity.3 There has been a widespread congruence on the clinical, social, and economic benefits of initiating antiretroviral therapy during acute HIV infection. Study endorses that the success of HIV treatment is mainly reliant on early ART
+initiation irrespective of CD4 count.4 A prospective cohort study in Canada affirms that initiating ART at higher CD4 count was significantly associated with optimal viral response and improved health outcomes.5 Likewise, the United States' health and health services on its guideline, implies that immediate ART initiation on the same day of HIV
+diagnosis as a strategy to enhance early ART uptake, engagement in care and to shorten the length of viral suppressions.6 Despite the clinical benefits of earlier initiation of ART, there is also substantial economic impact including improving longer and healthier living thereby reducing the hospital care costs attributed to AIDS and its co-morbidities.7 Besides the economic benefits of ART initiation during the early course of HIV infection, it is also imperative in improving a person's quality of life.8 Furthermore, early ART initiation has a considerable public health benefit on reducing transmissions.9 A study in Uganda and Zimbabwe revealed that HIV-positive people perceived antiretroviral therapy as helpful in a condition of severe illness as some symptoms can be resolved or be self-manageable.10 This view was also elaborated that PLHIV do not want to seek medical care unless they encounter severe illness.11 The authors suggested the need to integrate post-diagnosis counseling to enhance treatment accessibility. Furthermore, a study conducted in Ethiopia showed that late enrollment to HIV/AIDS care was remained a problem.12 Moreover, several studies in Ethiopia have shown that HIV-infected patients seek treatment at a health facility when their CD4 count has already dropped.13–15 HIVinfected patients seek treatment after their CD4 count has already dropped because of several reasons, which have been extensively examined in various studies done in low- and middle-income countries. The reasons for late presenter to HIV
+care outlined in the literature include the following: denial of status,16–18 fear of side effects,19,20 spousal influence,21,22 poverty,23,24 religion,25,26 initiation protocol,1,11,27 and shortages of staff.20,21 The late initiation of ART is occurring in West Shoa Zone, which is the zone with the highest number of people living with HIV in the Oromia region of Ethiopia. This situation represents a threat as far as the further transmission of HIV is concerned. Regardless of this late initiation of ART, there is a dearth of studies that focus on the experiences of adults living with HIV in West Shoa Zone, Ethiopia, in relation to ART initiation. Therefore, the aim of this study was to explore the lived experiences of adults living with HIV in West Shoa Zone regarding ART initiation.
+
+## Definitions Of Key Concepts
+
+The following key concepts guided this study:
+
+## Antiretroviral Therapy
+
+Antiretroviral therapy (ART) is defined as the use of a combination of three or more antiretroviral drugs for treating HIV
+infection.30
+
+## Antiretroviral Therapy Initiation
+
+Antiretroviral therapy initiation is a process of administering ART to all people with HIV, regardless of their CD4 cell count or the clinical stage of disease in which they find themselves.30
+
+## Early Antiretroviral Therapy Initiation
+
+Early antiretroviral therapy initiation is defined as ART initiation within seven days following HIV diagnosis if there are no contraindications.31
+
+## Lived Experience
+
+The meaning of lived experience pertains to the natural world in which humans live or exist. Examining this meaning is aimed at gaining an understanding of how people live through and respond to experiences.32 In this study, lived experience refers to the content of thoughts, feelings, and observations in the context of adults living with HIV regarding HIV testing and ART initiation from their viewpoint.
+
+## Materials And Methods Study Design And Settings
+
+A descriptive phenomenological design was used to gain insight into participants' lived experiences regarding ART initiation in West Shoa Zone, Ethiopia. Descriptive phenomenology is a "discrete" philosophical approach pioneered by Edmund Husserl.33 This type of phenomenology places the emphasis on descriptions of personal experiences and delineations of how and what the individual hears, sees, feels, believes, remembers, decide and evaluates.34 In this particular instance, the researcher engaged in a search for meaning with regard to the experiences of HIV-positive adults in respect of ART initiation.
+
+In keeping with the conventions of a qualitative study, the researcher conducted the study in participants' natural settings.35 The study was conducted at selected hospitals and health centers that provide ART services in West Shoa, Oromia. The administrative center for West Shoa Zone is Ambo, which is located 112 km west of Addis Ababa, the capital city of Ethiopia. The zone is further divided into 19 woredas, 528 rural kebeles and 58 urban kebeles. The woredas are administrative divisions; each woreda has an average population of 100,000. Kebeles are the smallest units in Ethiopian local government. West Shoa Zone has a total population of 2,568,694 and an adult HIV prevalence of 0.7%.36
+
+## Study Population
+
+The study participants were HIV-positive adults who had started with ART at health facilities in West Shoa Zone.
+
+## Eligibility Criteria
+
+Adults in the age range 18 to 65 years who were living with HIV, who had started with ART, able to give informed consent and render breadth information were eligible to participate in this study. Mentally or physically ill persons were excluded from the study. Pregnant and breastfeeding women were also excluded because they fall in the Option B+
+category37 according to WHO guidelines, which is not in line with the study aims. Consequently, their inclusion would have affected the credibility of the study findings.
+
+## Sampling, Sample Size And Recruitment Of Participants
+
+This study used a non-probability purposive sampling method to select the study participants. A sample of eighteen adults living with HIV who had started with ART in West Shoa Zone was enrolled in the study. In phenomenological studies, the samples are selected based on the participants' experience of the phenomenon being studied.38 Moreover, for sample selection in the phenomenological study, the participants must be able to articulate the lived experience.34 Therefore, the purposive sampling approach was considered a suitable choice for this study to explore the experience of ART initiation among HIV-positive adults. Participants were recruited from one hospital and five health centers. Individuals who met the inclusion criteria were recruited to participate in the study while they were visiting the ART clinics to collect their antiretroviral treatment. They were informed about the purpose of the study and all relevant ethical aspects as discussed under the ethics section. They were also informed that participation in the study was voluntary. The researcher obtained both verbal and signed consent from each study participant. However, the researcher read the consent form aloud and obtained consent verbally supported by the thumbprint for the participants with limited reading ability. The participants who signed the consent form have received a copy, and the researcher kept the original form in a locked file cabinet in a locked room. The individuals who were willing to participate in the study and who had the time to do so were requested to go to one of the consultation rooms at the clinics. These consultation rooms were not used for the interviews.
+
+## Data Collection Tools And Procedures
+
+Data were collected through semi-structured in-depth interviews with 18 adults living with HIV who had started with ART at selected public health facilities in West Shoa Zone. Before the actual data were collected, the researcher conducted a pilot study by means of in-depth interviews that were recorded. The pilot study was conducted at a health facility situated outside the study area. As part of the interview process, the researcher also took field notes on the verbal and non-verbal reactions of the participants. Finally, the researcher laid aside her preconceived ideas, assumptions, and knowledge about the topic of inquiry during the interview sessions. Data collection continued until data saturation was achieved. In this study, data saturation was reached at participant number 15, which was the point at which no new ideas, essences or insight emerged. However, the researcher interviewed three more participants. Following data collection, the researcher transcribed all the recordings verbatim.
+
+## Data Analysis And Procedures
+
+The data were analyzed by means of thematic analysis. Data analysis was guided by the seven steps highlighted in Colaizzi's method of data analysis, as follows:39
+- Step one: The researcher read each transcript repeatedly in order to gain a thorough understanding of its content while bracketing her attitudes and perceptions regarding ART initiation.
+
+- Step two: The researcher identified important statements and phrases related to ART initiation. - Step three: The researcher formulated meanings based on the phrases and statements identified. - Stage four: The researcher organized the formulated meanings into clusters of themes. - Step five: The researcher combined the theme clusters, emergent themes and formulated meanings into a description to create an overall structure. A similar process involving steps one to five was followed independently by an independent coder who was knowledgeable of qualitative research.
+
+- Step six: The researcher and the independent researcher reviewed the description of the themes to identify key elements and transposed the key elements into a definition of ART initiation experiences. This involved discussion until consensus was reached.
+
+- Step seven: The description of themes was validated with some of the participants who were available, and also understand English in the form of member checking.
+
+The data analysis in this study provided detailed descriptions of individual experiences of ART initiation among people living with HIV. The data analysis in this study was carried out concurrently with data collection. The first step of data analysis was to read and reread the transcripts several times to identify patterns and themes. Each transcript was coded individually. Next, the researcher employed an independent coder to analyze the interview transcripts. Thereafter, the researcher organized the condensed data into coding to refine the aim of the study, thus making it possible to identify themes. Then the researcher carefully reviewed the results obtained from the independent coder and compared them with the initial transcriptions to ensure confirmability of the study.
+
+## Measures To Ensure Trustworthiness
+
+The term "trustworthiness" can be defined as a set of criteria for judging and examining the quality and rigor of a qualitative research study to make the study noteworthy to audiences.40 The researcher employed measures to ensure credibility, dependability, confirmability and transferability in the study. Credibility refers to confidence in the truth value of data and interpretations of findings.34 The researcher implemented multiple validity indicators to convey credibility throughout the study in order to build a rapport with the study participants through prolonged engagement, peer debriefing, verbatim accounts and member checking. To enhance dependability, the researcher used probing and paraphrasing to ensure that the participants repeated what they had previously mentioned or confirmed what they meant during the discussions. The researcher also ensured the confirmability of the study findings through bracketing, reflexivity and triangulation. The researcher provided thick and vivid data descriptions of the participants meaning, emotions, and actions enough to ensure transferability of the findings. This study used purposive sampling to select HIV-positive adults who initiated ART since the test and treat strategies were implemented in Oromia region, Ethiopia. The study findings would have a similar meaning to other people living with HIV in the study setting.
+
+## Results Demographic Characteristics Of Participants
+
+A total of 18 HIV-positive adult men and women aged 18 to 65 years participated in the study. Regarding the educational level of the participants, seven had no formal education, four had a primary education and seven had a secondary education and above. Three of them were unemployed and the rest were employed. All of them had tested HIV positive and started with ART at the health facilities in the study settings (refer to Table 1).
+
+Table 1 Socio-Demographic Characteristic of HIV-Positive Adults in West Shoa Zone Public Health Facilities
+
+P6 27 years Male Married Secondary Steel worker Ambo hospital
+
+| Code   | Age      | Sex    | Marital Status   | Educational Status   | Occupation                    | Area of Residence    |
+|--------|----------|--------|------------------|----------------------|-------------------------------|----------------------|
+| P1     | 19 years | Female | Divorced         | No formal education  | Small-scale merchant          | Ginchi health center |
+| P2     | 56 years | Male   | Married          | Secondary            | Community adherence supporter | Guder health center  |
+| P3     | 22 years | Female | Divorced         | Primary              | Daily worker                  | Ginchi health center |
+| P4     | 43 years | Female | Widowed          | Secondary            | Adherence supporter           | Ginchi health center |
+| P5     | 46 years | Male   | Married          | No formal education  | Farmer                        | Ambo health center   |
+| P7     | 42 years | Female | Widowed          | Primary              | Merchant                      | Ginchi health center |
+| P9     | 33 years | Male   | Married          | Secondary            | Small-scale merchant          | Bako health center   |
+| P10    | 38 years | Female | Married          | No formal education  | Local alcohol trader          | Ambo health center   |
+| P11    | 36 years | Male   | Married          | No formal education  | Farmer                        | Ginchi health center |
+| P13    | 62 years | Male   | Married          | Secondary            | Farmer                        | Ginchi health center |
+| P14    | 42 years | Male   | Married          | Primary              | Building worker               | Ginchi health center |
+| P15    | 56 years | Male   | Married          | Primary              | Carpenter                     | Ambo health center   |
+| P16    | 34 years | Female | Widowed          | No formal education  | Unemployed                    | Ginchi health center |
+| P18    | 43 years | Male   | Married          | Diploma              | Health professional           | Ambo health center   |
+
+P8 42 years Female Married No formal education Housewives Ambo hospital P12 64 years Female Widowed No formal education Unemployed Jaji health center P17 22 years Female Single College student Unemployed Ambo hospital
+
+## Art Initiation
+
+Superordinate themes containing two themes and several sub-themes in respect of the experiences of HIV-positive adults who had initiated ART at one hospital and five health centers in West Shoa Zone, Ethiopia, emerged from the data analysis.
+
+## Theme 1. Factors That Caused Delayed Initiation Of Art
+
+This theme represents factors that contributed to delayed ART initiation among the study participants. The sub-themes include: (i) spousal influence, (ii) denial of status, (iii) inconsistent ART initiation protocol, (iv) poverty, (v) fear of side effects, (vi) religion and (vii) shortages of staff.
+
+## Spousal Influence
+
+The condition of poverty, unemployment and inequality would expose women to an increased risk of contracting HIV/ AIDS. It was observed that women faced the double problem of contracting the disease and being unable to access the care they needed. Their decision to initiate antiretroviral therapy was highly dependent on their partners' or husbands' permission.
+
+The following extract reflects the spousal influence experienced by one of the participants:
+While I was with my husband, he forbid me from taking the medication, then I left the house and went to Addis Ababa for a job then I started taking the treatment after six months. [P3]
+Despite the advancement of women's access to healthcare services, gender inequality has remained a social determinant of health. Women have less privileged access to resources, education and decision-making in low-income countries. Likewise, women who are living with HIV face multiple personal, economic and social challenges. This study revealed that spousal influence affects early engagement to HIV care. One participant shared her experience in this regard as follows:
+When I told my husband I wanted to start the treatment, he did not allow me to do so. He said it needs a lot of money for the medication bill. He refused to give me money. Later on, I found out that HIV medication is free of charge. Then I started to take my treatment after a long time. My husband upset me. For this reason, I could not start the medication immediately. I started taking the treatment after six months of following the HIV result. [P1]
+
+## Denial Of Status
+
+The study found that the participants were confused, distressed and in disbelief over their HIV serostatus would result in difficulty initiating antiretroviral therapy immediately after their HIV-positive diagnosis. In this study, participants shared various accounts of coping with the emotional distress they experienced upon learning they were HIV positive. One participant indicated that the perception that he was at low risk of contracting HIV and coupled with his partner's HIVnegative status contributed to his denial of being infected with HIV.
+
+The participant remarked as follows:
+I did not start the treatment immediately. One day after I knew myself (HIV positive), I refused the diagnosis of how this happened to me. I work at the health center in a rural area. I'm a health professional. My wife and my children are HIVnegative. I'm only positive from my family. I was in a dilemma for a longer time. I could not accept the result for one year.
+
+I could not immediately start the treatment. [P18]
+A similar opinion was expressed by another participant regarding difficulty in accepting a positive diagnosis, quoted below:
+You know it is not an easy disease like other diseases you can cure. It took me time to accept my positive result. Then on another day, I retest at a private clinic to be sure. [P1]
+
+## Inconsistent Art Initiation Protocol
+
+The study showed that variable ART initiation protocol at the health facilities would contribute for late ART initiation among asymptomatic HIV-positive people. In addition, participants indicated that they had encountered a barrier to early treatment initiation because their CD4 counts did not meet the existing ART guidelines.
+
+I wanted to start the treatment earlier. But, because my CD4 four was high above 350, I was not allowed to start. I only started very late when my CD4 count was below 200, and I was already lost so much weight. [P5]
+
+## Poverty
+
+The study revealed that unemployment and financial dependency could constrain women in respect of pursuing an advised clinical schedule. The influence of poverty, such as transportation costs and hospital costs, impeded participants' readiness to initiate antiretroviral treatment. A woman described how poverty limited her from accessing antiretroviral treatment:
+I did not have any money in my hand to go to the clinic. I worked being a housemaid in Addis Ababa. Meanwhile, I became sick badly, weakened, I could not work. [P1]
+According to the study findings, a lack of money for transportation appeared to be a barrier to participants' HIV care and treatment. The study participants expressed that they experienced financial pressure, which hindered their ability to access healthcare services and to go for clinical follow-up visits.
+
+The other participant remarked as follows:
+I sometimes miss my doctor's appointment because I did not have money for transportation. I had to wait for my husband to give me transport money. [P8]
+
+## Fear Of Side Effects
+
+The study revealed that the anticipation of drug side effects would hinder participants from initiating antiretroviral therapy early. One participant remarked as follows:
+Because my CD4 four was high above 350. They said it was good. I was healthy; I did not want to face the treatment side effects. You know I heard from my friends how the drugs did to them, so when I see myself I was healthy, I could work like before. [P5]
+
+## Getting Advice From Religious People
+
+Some participants reported that they had received advice from religious people, which delayed their commencement of ART. Participants used religious belief as a coping mechanism to deal with and accept their HIV diagnosis. The belief in life after death also served as a form of healing. One participant commented as follows:
+One day, by hiding my HIV-positive status, I started to ask people living with HIV what does the virus does to them and how do they live with it. I thought that it good to talk to other people about their personal experiences regarding HIV problems. If they give me a little from their experience, it will help me to talk to other people about their personal experiences regarding HIV problems. I deal with the new diseases I encountered. People talk about holy water, but I am a Protestant believer, I said to myself if I die, I will go to God, and I should not worry. I started to build faith. I can live as long as God let me live. [P3]
+Some participants in this study favored holy water as an alternative to seeking a complete cure for HIV/AIDS. A participant remarked as follows:
+Some clients said 'what does the treatment help? Since we no longer cured, why would we swallow it?' Others believed by holy water and others by prayer. This holy water is very powerful, you know, so you have to believe you know. [P4]
+
+## Shortages Of Staff
+
+The study established that the quality of health services plays a pivotal role in attracting patients to care provision. The participants mentioned that shortages of healthcare providers had delayed the timely initiation of their antiretroviral treatment. One participant stated the following:
+I was appointed before I started the treatment after I was diagnosed with HIV. When I went to the hospital, I had to wait for a long time. I left the clinic because I was afraid someone would see me. The hospital was crowded. I remember I came back after a year when I felt sick. I believe if I get medication in time, I mightn't be ill. I know the nurses do what they could, but it is better to have more examination rooms and doctors. [P7]
+Patients would feel uncomfortable going to health facilities due to the long waiting times. Long-waiting times related to the shortage of staff at the health facility would expose the participants to the likelihood of being seen by others. The participants mentioned that they feared being seen by people they know and they preferred receiving healthcare services without delay. Moreover, long waiting times caused patients to lose interest in healthcare services. One participant made the following remark in this regard:
+When I came to the hospital for pre-HIV treatment during my appointment, I prefer not to wait long in the corridor because I felt worried and guilty about what if somebody saw me. I wish I could go out without delay. I have a complaint about doctors; they usually come only they get a phone call. Usually, they are not available in the hospital. We have to wait for him [the doctor] for long hours until he arrives. [P10]
+
+## Theme 2. Factors That Contributed To The Initiation Of Art
+
+This theme focuses on factors that promoted ART initiation among the study participants. It is composed of the following sub-themes: (i) low CD4 count, (ii) having opportunistic infections and (iii) the prevention of future illness.
+
+## Low Cd4 Count
+
+Some participants started with ART during hospitalization when they had a decreased CD4 count. One participant commented as follows:
+The diseases weaken my body. I remained in bed also. My neighbor who works here in this health center explained to me the situation. They said, 'now a day no more dying' why don't you go and check your blood, get to know yourself and use medications like other person and able to live for your children.' Then I said, Oh, is there such thing? Yes, they said. Okay then. I travelled to another city and reached Ambo hospital, and gave my blood for an HIV test. Then I started the treatment quickly as soon as HIV was diagnosed because my CD4 was lowered 120 cells/μL. [P4]
+
+## Having Opportunistic Infections
+
+The study established that the participants had opted to receive HIV care after they had been exposed to opportunistic infections. The participants indicated that they had been impelled by illness to start with antiretroviral therapy. One participant made the following comment:
+I was tested for HIV in 2005 because I often get tired and had rash developed on my body. The results were positive and I started the treatment immediately without even arguing with anyone. [P12]
+
+## The Prevention Of Future Illness
+
+The study found that some participants had started with ART rapidly without having experienced manifestations of illness. One participant described being determined to initiate ART to prevent future illness:
+When I started the medication, I was healthy and in good CD4 condition. I started with health status to prevent future illness. At that time, my CD4 level was once up and down, it was a dilemma. Sometimes 300, other time 400. When I started ART, my CD4 was 438. [P17]
+
+## Discussion
+
+The study found that spousal influence had been a significant barrier to the early initiation of ART among the participants. Women's decision-making on ART initiation was shown to be highly dominated by their husbands. This finding is consistent with the findings of a study carried out in Swaziland,21 which also reported that women's decision to start with ART had been greatly influenced by their male partners. Similar findings were made in studies conducted in Zambia and South Africa, which established that men in the household determined whether women could start with ART
+or not.22 What drove the participants the most to decline ART was the issue of denial of their HIV diagnosis. Some participants explained that their late initiation of antiretroviral therapy had been due to ambiguity over their HIV-positive diagnosis. In line with these findings, a study in Kenya demonstrated that denial of HIV-positive serostatus was the reason why individuals had declined to start with ART following their HIV diagnosis.16 Similarly, a study in Rwanda found that perceptions of being at a low risk of HIV infection among PLHIV were likely to delay ART initiation.18 Likewise, a study in South Africa found that individuals' inability to adjust to an HIV-positive diagnosis had caused them to delay treatment initiation.17 A study in Swaziland found that the shock and surprise of being diagnosed with HIV had caused the participants to defer treatment initiation.41 This study found that there were variable ART initiation guidelines in the research settings. Despite the national guideline, some participants reported being advised to delay ART initiation until their CD4 count was below 350 cells/mm.3 This finding concurs with that of a previous study in Ethiopia, which reported that the implementation of the national Test and Treat strategy in accordance with updated treatment guidelines across the regions and districts was sup-optimal.27 With regard to ART initiation, studies conducted in Malawi, Zimbabwe, South Africa, Tanzania, and Uganda reported that contradictory government protocols impacted the immediate initiation of ART.11 Deferring ART initiation until clients' CD4 counts declined put them at risk of progressing to AIDS-defining illnesses and increased the risk of HIV transmission to sexual partners.1 Besides government policies and guidelines, some clients deferred ART initiation owing to fear of side effects of the treatment. The study revealed that unemployment and financial dependency would constrain women in pursuing an advised clinical schedule. These results are consistent with the findings of a study done in Ghana. According to the study, financial challenges related to food insecurity prevented patients from initiating antiretroviral therapy.23 Another study conducted in Kenya found a significant link between lack of access to treatment and poverty.24 The author argues that the correlation between treatment access and poverty considerably affects these countries' HIV/AIDS response. Likewise, a previously reported study in India ascertained that patients tended to postpone engaging in medical care until their CD4 counts became lower owing to economic limitations.42 Apart from poverty, fear of adverse effects of ART would also potentially contribute to the non-initiation of ART among PLHIV. This study revealed that the anticipation of drug side effects could discouraged the participants from initiating antiretroviral therapy early. A study done in Kenya found that the estimated side effects of antiretroviral drugs had caused the participants to avoid ART.19 Similarly, a study in Swaziland found that the participants' preconceptions of potential side effects of ART had made them wary of ART
+initiation.20 The study revealed that advice from religious leaders would prevent the participants from starting with ART.
+
+Some participants indicated that they chose holy water over ART in their search for a complete cure for HIV/AIDS. These findings are consistent with a study conducted in Botswana, which found that certain religious leaders had forbidden individuals from going to hospital to start with treatment.26 Shortages of staff also could late ART initiation among the study participants. The study revealed that the non-availability of physicians, coupled with late arrivals and long waiting times, would cause the involuntary disclosure of patients' HIV status and led to their dissatisfaction with the health services delivered. This finding is consistent with a previous study in Ethiopia, which reported that inadequate staff contributed to poor linkage to care.28 In addition, the issue of long waiting times related to shortages of staff was a commonly reported barrier to access to ART uptake among people living with HIV.29 This study found that most participants had started with ART at a later stage of HIV infection and of being immune compromised. The findings of this study concur with a study in Uganda, which found that the majority of PLHIV who participated in the study had started with ART at a declined CD4 count and at an advanced stage of disease.43 Similarly, most studies conducted in Ethiopia have shown that people with HIV sought treatment at health facilities after their CD4 count had already diminished.13–15 Other participants initiated treatment after they had developed opportunistic infections. This study revealed that HIV-positive adults in the research settings had started with ART when they were at an advanced stage of disease. These would expose PLHIV to opportunistic infections. This finding is consistent with a study in South Africa, which found that patients who had presented with higher CD4 counts at baseline were unlikely to start with ART within the first month of engaging in medical care.44 Conversely, other participants were inclined to start with ART to prevent future illness. A study in Swaziland found that an understanding of treatment as prevention among asymptomatic HIV-positive people had motivated them to start with ART immediately.45
+
+## Limitations Of The Study
+
+The study has the following limitations that should be taken into consideration. The study only focused on the patients who are already initiated and on ART. As only participants were recruited at the clinic, there is a possibility that, some participants who are still reluctant to initiate's view were missed. Data was collected during COVID-19 restrictions, which made some of the participants to be reluctant to participate due to fear of contracting the infection. As the participants were only people on ART, the views we have is only from their side. Therefore, study did not incorporate the health care providers' view and opinion regarding ART initiation. Time of ART initiation was determined and used selfreported measures, which are often imprecise and unreliable. The researcher also involved participants from different health care facilities of West Shoa Zone, to maximise data sources.
+
+## Conclusion
+
+The study found that the majority of the participants had started with ART during a later stage of HIV infection after their CD4 count had dropped and they had developed opportunistic infections. The study revealed that this late initiation of HIV care among the participants could be attributed to poverty, spousal influence, late HIV testing, inconsistent ART initiation protocol, misconceptions and misperceptions, fear of side effects and denial of HIV status.
+
+## Abbreviations
+
+AIDS, acquired immune deficiency syndrome; ART, antiretroviral therapy; FMOH, Federal Ministry of Health; HIV, human immunodeficiency virus; HSTP, health sector transformational plan; MOH, Ministry of Health; PLHIV, people living with HIV and AIDS; SDG, sustainable development goal; UNAIDS, Joint United Nations Program on HIV/AIDS; WFP, World Food Program; WHO, World Health Organization.
+
+## Ethics Approval And Informed Consent
+
+In line with ethical considerations in research, the study complies with the declaration of Helsinki. Permission to conduct the study was obtained from the Research Ethics Committee of the University of South Africa, Department of Health Studies (HSHDC/778/2017). Permission was also obtained from the Oromia Regional Health Bureau's Research Ethics Review Board (ref. no. BEFO/UBTFU/1016/1260). Verbal and or written informed consent was obtained from each participant before data collection commenced. The ethics committee approved this consent process. The participants were assured that their informed consent included publication of anonymised responses. Furthermore, the study participants were informed that their identity remains unknown to any other person except the researcher. Therefore, the researcher used code numbers (P1-P18 for participants) of records, transcripts, and reports.
+
+## Acknowledgments
+
+The authors would like to thank the University of South Africa and the West Shoa Zone Health Bureau for their support and the study participants for their cooperation in the study.
+
+## Author Contributions
+
+All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.
+
+## Funding
+
+The authors declare funding from the University of South Africa and Ambo University. The funds were mainly utilized for data collection and analysis.
+
+## Disclosure
+
+The authors declare that there is no competing interests in this work.
+
+## References
+
+8. Leveson N, Samost A, Dekker S, Finkelstein S, Raman J. A Systems approach to analyzing and preventing hospital adverse events. *J Patient Saf*.
+
+2020;16(2):162–167. doi:10.1097/PTS.0000000000000263 9. DeClercq J, Rutsaert S, De Scheerder M-A, Verhofstede C, Callens S, Vandekerckhove L. Benefits of antiretroviral therapy initiation during acute HIV infection. *Acta Clin Belg*. 2020;77:1–9.
+
+10. Kawuma R, Seeley J, Mupambireyi Z, Cowan F, Bernays S. The REALITY trial team. "Treatment is not yet necessary": delays in seeking access to HIV treatment in Uganda and Zimbabwe. *African J AIDS Res*. 2018;17(3):217–225. doi:10.2989/16085906.2018.1490785 11. Bukenya D, Wringe A, Moshabela M, et al. Where are we now? A multicountry qualitative study to explore access to pre-antiretroviral care services: a precursor to antiretroviral therapy initiation. *Sex Transm Infect*. 2017;93(3):e052970. doi:10.1136/sextrans-2016-052970 12. Belay GM, Endalamaw A, Ayele AD. Late presentation of HIV positive adults and its predictors to HIV/AIDS care in Ethiopia: a systematic review and meta-analysis. *BMC Infect Dis*. 2019;19(1):534. doi:10.1186/s12879-019-4156-3 13. Bayisa L, Tadesse A, Reta MM, Gebeye E. Prevalence and factors associated with delayed Initiation of antiretroviral therapy among people living with HIV in Nekemte Referral Hospital, Western Ethiopia. *HIV/AIDS*. 2020;12:457–465.
+
+14. Gebru T, Lentiro K, Jemal A. Perceived behavioural predictors of late initiation to HIV/AIDS care in Gurage zone public health facilities: a cohort study using health belief model. *BMC Res Notes*. 2018;11(1):336. doi:10.1186/s13104-018-3408-4 15. Nash D, Tymejczyk O, Gadisa T, Kulkarni SG. Factors associated with initiation of antiretroviral therapy in the advanced stages of HIV infection in six Ethiopian HIV clinics, 2012 to 2013. *J Int AIDS Soc*. 2016;19(1):20637. doi:10.7448/IAS.19.1.20637 16. Palella FJJ, Armon C, Chmiel JS, et al. CD4 cell count at initiation of ART, long-term likelihood of achieving CD4 >750 cells/mm3 and mortality risk. *J Antimicrob Chemother*. 2016;71(9):2654–2662. doi:10.1093/jac/dkw196 17. Earnshaw VA, Bogart LM, Courtney I, et al. Exploring treatment needs and expectations for people living with HIV in South Africa: a qualitative study. *AIDS Behav*. 2018;22(8):2543–2552. doi:10.1007/s10461-018-2101-x 18. Franse CB, Kayigamba FR, Bakker MI, et al. Linkage to HIV care before and after the introduction of provider-initiated testing and counselling in six Rwandan health facilities. *AIDS Care*. 2017;29(3):326–334. doi:10.1080/09540121.2016.1220475 19. Patel RC, Odoyo J, Anand K, et al. Facilitators and barriers of antiretroviral therapy initiation among HIV discordant couples in Kenya: qualitative insights from a pre-exposure prophylaxis implementation study. *PLoS One*. 2016;11(12):e0168057–e0168057. doi:10.1371/journal.pone.0168057 20. Adams AK, Zamberia AM. "I will take ARVs once my body deteriorates": an analysis of Swazi men's perceptions and acceptability of test and start. *African J AIDS Res*. 2017;16(4):295–303. doi:10.2989/16085906.2017.1362015 21. Pell C, Reis R, Dlamini N, Moyer E, Vernooij E. "Then her neighbour will not know her status": how health providers advocate antiretroviral therapy under universal test and treat. *Int Health*. 2019;11(1):36–41. doi:10.1093/inthealth/ihy058 22. Seeley J, Bond V, Yang B, et al. Understanding the time needed to link to care and start ART in seven HPTN 071 (PopART) study communities in Zambia and South Africa. *AIDS Behav*. 2019;23(4):929–946. doi:10.1007/s10461-018-2335-7 23. Poku RA, Owusu AY, Mullen PD, Markham C, McCurdy SA. Antiretroviral therapy maintenance among HIV-positive women in Ghana: the influence of poverty. *AIDS Care*. 2020;32(6):779–784. doi:10.1080/09540121.2019.1653434 24. Haacker M, Birungi C. Poverty as a barrier to antiretroviral therapy access for people living with HIV/AIDS in Kenya. *African J AIDS Res*. 2018;17
+(2):145–152. doi:10.2989/16085906.2018.1475401 25. Assen A, Molla F, Wondimu A, et al. Late presentation for diagnosis of HIV infection among HIV positive patients in South Tigray Zone, Ethiopia.
+
+BMC Public Health. 2016;16(1):558. doi:10.1186/s12889-016-3263-y 26. Kebaabetswe P, Manyake K, Kadima E, et al. Barriers and facilitators to linkage to care and ART initiation in the setting of high ART coverage in Botswana. *AIDS Care*. 2020;32(6):722–728. doi:10.1080/09540121.2019.1640843 27. Manyazewal TM. Using the World Health Organization health system building blocks through survey of healthcare professionals to determine the performance of public healthcare facilities; 2017:75. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5651704/. Accessed May 17, 2022.
+
+28. Fuge TG, Tsourtos G, Miller ER. Various structural factors influenced early antiretroviral therapy initiation amongst HIV infected prisoners:
+a qualitative exploration in South Ethiopia. *BMC Public Health*. 2021;21(1):1463. doi:10.1186/s12889-021-11499-w 29. Asghari S, Hurd J, Marshall Z, et al. Challenges with access to healthcare from the perspective of patients living with HIV: a scoping review &
+framework synthesis. *AIDS Care*. 2018;30(8):963–972. doi:10.1080/09540121.2018.1435848 30. World Health Organization. *Consolidated Guidelines on the Use of Antiretroviral Drugs for Treating and Preventing HIV Infection*. 2nd ed.
+
+Geneva, Switzerland: World Health Organization; 2016.
+
+31. Federal Ministry Of Health. *National Consolidated Guidelines for Comprehensive HIV Prevention, Care and Treatment*. 5th ed. Addis Ababa, Ethiopia: Federal Ministry of Health; 2018.
+
+32. Given LM. *The SAGE Encyclopedia of Qualitative Research Methods*. Vol. 2. Thousand Oaks: SAGE Publications, Inc.; 2008. 33. Gerrish K, Lacey A, eds. *The Research Process in Nursing*. 7th ed. Chichester: Blackwell; 2017. 34. Polit DF, Beck CT. *Essential of Nursing Research: Appraising Evidence for Nursing Practice*. 9th ed. Philadelphia: Wolters Kluwer Health; 2018. 35. Latunde YC, ed. *Qualitative Research Methods BT. Research in Parental Involvement Methods and Strategies for Education and Psychology*.
+
+New York: Palgrave Macmillan US; 2017:97–112.
+
+36. West Shoa city administration. *Health Management Information System Third Quarter Report*. Vol. 24. Ambo, Ethiopia: National Health Mission; 2019.
+
+37. World Health Organization. Antiretroviral Drugs for Treating Pregnant Women and Preventing HIV Infection in Infants: Recommendations for a Public Health Approach. Geneva, Switzerland: World Health Organization; 2010.
+
+38. Creswell JW, Creswell JD. *Research Design: Qualitative, Quantitative and Mixed Approaches*. 5th ed. California: Sage Publications, Inc.; 2018. 39. Colaizzi PF. *Psychological Research as a Phenomenologist Views It. Existential Phenomenological Alternatives for Psychology*. New York: Oxford University Press; 1978.
+
+40. Lincoln YS, Guba EG. *Naturalistic Inquiry*. Beverly Hills: Sage; 1985. 41. Pell C, Vernooij E, Masilela N, Simelane N, Shabalala F, Reis R. False starts in 'test and start': a qualitative study of reasons for delayed antiretroviral therapy in Swaziland. *Int Health*. 2018;10(2):78–83. doi:10.1093/inthealth/ihx065 42. Perlo J, Colocci I, Rajagopal SS, et al. The convergence of disclosure concerns and poverty contributes to loss to HIV care in India: a qualitative study. *J Int Assoc Provid AIDS Care*. 2020;19:2325958220934606.
+
+43. Ingabire PM, Semitala F, Kamya MR, Nakanjako D. Delayed antiretroviral therapy initiation among hospitalized adults in a resource-limited settings: challenge to the global target of ART for 90% of HIV-infected individuals. *AIDS Res Treat*. 2019;2019:1–8.
+
+44. Boyer S, Iwuji C, Gosset A, et al. Factors associated with antiretroviral treatment initiation amongst HIV-positive individuals linked to care within a universal test and treat programme: early findings of the ANRS 12249 TasP trial in rural South Africa. *AIDS Care*. 2016;28(3):39–51. doi:10.1080/09540121.2016.1164808 45. Vernooij E, Mehlo M, Hardon A, Reis R. Access for all: contextualising HIV treatment as prevention in Swaziland. *AIDS Care*. 2016;28(3):7–13.
+
+doi:10.1080/09540121.2016.1178954 HIV/AIDS - Research and Palliative Care **Dovepress** Publish your work in this journal HIV/AIDS - Research and Palliative Care is an international, peer-reviewed open-access journal focusing on advances in research in HIV, its clinical progression and management options including antiviral treatment, palliative care and public healthcare policies to control viral spread. The manuscript management system is completely online and includes a very quick and fair peer-review system, which is all easy to use. Visit http://www.dovepress.com/testimonials.php to read real quotes from published authors.
+
+Submit your manuscript here: https://www.dovepress.com/hivaids—research-and-palliative-care-journal

medical/md/PMC9340093.md

@@ -0,0 +1,85 @@
+
+
+![0_image_0.png](0_image_0.png)
+
+# Recommendations For A Voluntary Long Covid Registry
+
+Fern Davies1 , Ilora Finlay2, Helen Howson2 and Nicholas Rich1 1Swansea University School of Management, Swansea SA1 8EN, UK 2Bevan Commission, Swansea University School of Management, Swansea, SA1 8EN, UK
+Corresponding author: Fern Davies. Email: f.b.davies@swansea.ac.uk Long COVID has had a profound impact on the lives and health of many people around the globe.1 Estimates of the number of people affected vary, but on the 6th May 2022, the Office of National Statistics (ONS) identified that there were 1.8 million (2.8%) people living in private households in the UK alone who were experiencing self-reported long COVID symptoms.2 The same data identified that symptoms adversely affect the day-to-day activities of 1.2 million people in the UK.2 However, the long-term consequences of SARS-CoV-2 infection and the subsequent impact on public health are still largely unknown and present a major challenge to health and care systems moving forward. A mechanism to facilitate long-term monitoring of long COVID is therefore essential to support research, service improvement and enhance understanding of the disease as it evolves. In response to this, the aim of this commentary is to outline key recommendations for a voluntary Long COVID Registry in Wales. In this paper, five key recommendations are highlighted that should be considered in the development of a Long COVID Registry. These include: 1) a dual purpose of research and service improvement; 2) experiential co-design with end-users; 3) recruitment of a self-referred population and inclusion of a control group; 4) utilisation of digital infrastructures and 6) a prudent and integrated approach.
+
+## Long Covid
+
+Long COVID can affect those with very mild acute disease to those with the most severe form.1 Symptoms are known to range between mild and disabling, can involve multiple organs and systems, and have differing manifestations. The diversity in presentation and severity of symptoms makes long COVID difficult to define, but the current clinical definitions developed by the National Institute for Health and Care Excellence (NICE) broadly identify it as signs and symptoms that develop after acute COVID-19 infection, which cannot be explained by an alternative diagnosis. This definition includes ongoing symptomatic COVID-19 from 4 to 12 weeks and post-COVID-19 syndrome lasting longer than 12 weeks.3 The prevalence of long COVID remains highly uncertain,1 but modelling suggests a significant increase.4 Managing the long-term sequelae of all variants of SARS-CoV-2 infection in the population will therefore remain a major challenge for health and care services during the next stage of the pandemic.
+
+## Long Covid Registry
+
+Despite not knowing the extent of the resultant public health burden, it is undeniable that long COVID has long-term population health and socioeconomic implications.5 The Minister for Health and Social Services in Wales recognised this and asked the leading independent think tank for health and care in Wales, the Bevan Commission, to make recommendations on 'how to set about establishing a voluntary registry for Long COVID in Wales in order to undertake long term monitoring of the condition'. Through exploratory desktop research and co-production with an expert advisory board, inclusive of patient representatives, the main recommendations of a Long COVID Registry in Wales are identified below. These recommendations have informed health policy decisions related to long COVID and provide insights for other voluntary patient registries.
+
+## Key Recommendations For A Voluntary Long Covid Registry Dual Purpose
+
+The majority of registries are traditionally observational and research focused, but insufficient understanding of long COVID currently, makes the ability to respond to changing needs and information essential. Therefore, this work concluded that a Long COVID Registry should be agile and responsive, with a dual purpose of both research and service improvement. This should accommodate both longitudinal and comparative research. It should also encompass a communication strategy to facilitate service improvement and positively influence the patient journey. Two-way exchanges with end-users will ensure that views and experiences are properly addressed, allow identification of local and national services for care and treatment, and provide rapid feedback for patients, clinicians and policymakers. It will further help recruitment into clinical trials of interventions that could improve outcomes for patients.
+
+## Co-Production With End-Users
+
+A key recommendation in the development of a long COVID patient registry is co-production, particularly with the end-users such as patients, healthcare professionals and other collaborators. In this instance, patient groups such as LongCovidWales and the Long COVID Doctors' group should be involved through experience-based co-design,6 which is an important element of prudent healthcare.7 Co-production improves healthcare quality through appropriate representation of the perceptions of individuals and networks,8 encompassing a full range of patient perspectives and ensuring rigorous evaluation in the short, medium and long term.
+
+Co-production with patient groups also promotes shared responsibility for equity of access to healthcare.
+
+## Recruitment Of Self-Referred Population And Control Group
+
+Both the expert panel and patient representatives deemed the potential for self-referral into a voluntary Long COVID Registry to be essential for two reasons. First, the lack of testing for COVID-19 during the first wave means no confirmation of infection exists. Second, the poor understanding of mechanisms underpinning long COVID makes objective inclusion criteria difficult. Self-referral promotes equity of access, overcomes patient consent challenges in relation to personally identifiable information and allows sufferers to access support regardless of testing or diagnosis.
+
+The inclusion of a control group was also deemed essential by the advisory group, as recommended in The Academy of Royal Medical Sciences Report.5 Many symptoms of long COVID align with other diseases in the general population and therefore a control group is necessary to enable analysis and comparison of data. Furthermore, motivation from the self-referred population will help to support longterm observational studies that are needed to understand the evolution and prognosis of the pathophysiology of long COVID-19, its symptom clusters, syndromes and long-term sequelae.9
+
+## Digital Infrastructure And Linkages
+
+Digital infrastructure and database linkages are needed to harness the capabilities of technology and optimise the success of a registry,7 but this is hampered by current disconnects in technology.
+
+The consolidation of existing technology and databases could enhance the coordination and interoperability of such resources within and across different organisations. A unified approach would allow access to data retrospectively and prospectively, to inform understanding of long COVID as the disease evolves. This coordination needs a lead digital agency to provide greater clarity of purpose and initiate collaboration across organisations. Collaborative effort and large-scale electronic data collection is required in order to realise the full potential of a registry and to inform research, service improvement and patient care.
+
+## A Prudent And Integrated Approach
+
+The concept of prudent healthcare provides principles that can ensure the best value from a Long COVID Registry.7 The approach considers how to collaborate with others, make effective use of the available resources and to ensure high-quality and consistent care for long COVID within Wales. This is particularly relevant considering resource challenges within the health and care context and the need for services to meet changing needs as understanding of long COVID develops. Collaboration between key stakeholders is inherent in a prudent approach and an integrated healthcare perspective is necessary to address the multidisciplinary demands of long COVID.1 Prudent healthcare promotes innovation and transformative change. This is of relevance in the establishment of any comprehensive registry to optimise opportunities, technological advancements and new ways of working to ensure that it is fit for purpose.
+
+## Conclusions
+
+The aim of this paper was to provide valuable recommendations and insight to inform both health policy decisions and patient registries in alternative contexts. Despite the uncertainties of long COVID,
+the need for long-term monitoring is essential to support research, service improvement and patient engagement. This work proposes co-production with end-users, consolidation of digital infrastructures, inclusion of self-referred populations and control groups, and an integrated and prudent approach as key recommendations in the development of a comprehensive Long COVID Registry. These factors also provide valuable considerations for other voluntary patient registries in the future.
+
+## Declarations Competing Interests: None Declared.
+
+Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The Bevan Commission gratefully acknowledge the support of Welsh Government funding for the research activity presented in this paper.
+
+Ethics approval: Not applicable.
+
+## Guarantor: Fd.
+
+Contributorship: IF, HH and NR were responsible for the concept and design of the work. IF, HH and FD implemented the Advisory Board and engaged in the data acquisition. FD interpreted the findings and wrote the first draft. All authors contributed to subsequent drafts and have approved the final published version.
+
+Acknowledgements: The Bevan Commission would like to thank all collaborators involved in this work and acknowledge the invaluable contribution and guidance of the Wales Long COVID Registry Advisory Board.
+
+Provenance: Not commissioned; editorial review. ORCID iD: Fern Davies https://orcid.org/0000-0002-9681912X
+
+References 1. Crook H, Raza S, Nowell J, Young M and Edison P.
+
+Long covid - mechanisms, risk factors, and management. BMJ 2021; 26: 374.
+
+2. ONS. Prevalence of ongoing symptoms following coronavirus (COVID-19) infection in the UK - Office for National Statistics. See ons.gov.uk (last checked 25 May 2022).
+
+3. NICE. How do I manage someone with the long term effects of COVID-19? Scenario: managing long-term effects | management | coronavirus - COVID 19 | CKS | NICE. See https://cks.nice.org.uk/topics/coronavirus-covid-19/management/managing-long-termeffects/\#managing-the-long-term-effects (last checked 30 March 2022).
+
+4. Academy of Medical Sciences. COVID-19: preparing for the future. Looking ahead to winter 2021/2022 and beyond. See www.gov.uk (last checked 30 March 2022).
+
+5. Whitaker M, Elliott J, Chadeau-Hyam M, Riley S,
+Darzi A, Cooke G, et al. Persistent symptoms following SARS-CoV-2 infection in a random community sample of 508,707 people. Nat Commun 2022; 13: 1–10.
+
+6. Farrington C. Co-designing healthcare systems: between transformation and tokenism. J R Soc Med 2016; 10:
+368–371.
+
+7. Bevan Commission. Prudent Health Principles. Report, Welsh Government, UK, January 2015.
+
+8. Vankatesan P. NICE guideline on long COVID. Lancet Respir Med 2021; 9: 129.
+
+9. Aiyegbusi OL, Hughes SE, Turner G, Cruz Rivera S,
+McMullan C, Singh Chandan J, et al. Symptoms, complications and management of long COVID: a review. J
+R Soc Med 2021; 9: 428–442.

medical/md_images/PMC10036883/PMC10036883_meta.json

@@ -0,0 +1,236 @@
+{
+    "languages": [
+        "en"
+    ],
+    "filetype": "pdf",
+    "toc": [
+        {
+            "title": "Head injury of two-wheeler cyclist based on fluid\u2013solid coupling head model",
+            "level": 0,
+            "is_closed": false,
+            "n_kids": 15,
+            "page_index": 0,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                581.1229858398438,
+                0.0
+            ]
+        },
+        {
+            "title": "1 Introduction",
+            "level": 1,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 0,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                303.3699645996094,
+                0.0
+            ]
+        },
+        {
+            "title": "2 Materials and method",
+            "level": 1,
+            "is_closed": false,
+            "n_kids": 5,
+            "page_index": 2,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                658.3429565429688,
+                0.0
+            ]
+        },
+        {
+            "title": "2.1 Information of traffic accident",
+            "level": 2,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 2,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                637.4219970703125,
+                0.0
+            ]
+        },
+        {
+            "title": "2.2 Modelling",
+            "level": 2,
+            "is_closed": false,
+            "n_kids": 3,
+            "page_index": 2,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                535.0770263671875,
+                0.0
+            ]
+        },
+        {
+            "title": "2.2.1 Combined numerical dummy model for the driver of an electric two-wheeler",
+            "level": 3,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 2,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                514.1559448242188,
+                0.0
+            ]
+        },
+        {
+            "title": "2.2.2 Modelling of human\u2013vehicle\u2013road coupling system",
+            "level": 3,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 4,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                482.4559631347656,
+                0.0
+            ]
+        },
+        {
+            "title": "2.2.3 Model validation",
+            "level": 3,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 6,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                492.9159851074219,
+                0.0
+            ]
+        },
+        {
+            "title": "3 Results",
+            "level": 1,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 6,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                377.8489685058594,
+                0.0
+            ]
+        },
+        {
+            "title": "4 Discussion and conclusion",
+            "level": 1,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 8,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                290.0329895019531,
+                0.0
+            ]
+        },
+        {
+            "title": "Declarations",
+            "level": 1,
+            "is_closed": false,
+            "n_kids": 4,
+            "page_index": 9,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                428.6470031738281,
+                0.0
+            ]
+        },
+        {
+            "title": "Author contribution statement",
+            "level": 2,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 9,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                407.72601318359375,
+                0.0
+            ]
+        },
+        {
+            "title": "Funding statement",
+            "level": 2,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 9,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                349.07598876953125,
+                0.0
+            ]
+        },
+        {
+            "title": "Data availability statement",
+            "level": 2,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 9,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                300.8859558105469,
+                0.0
+            ]
+        },
+        {
+            "title": "Declaration of interest\u2019s statement",
+            "level": 2,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 9,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                252.69601440429688,
+                0.0
+            ]
+        },
+        {
+            "title": "References",
+            "level": 1,
+            "is_closed": null,
+            "n_kids": 0,
+            "page_index": 10,
+            "view_mode": "XYZ",
+            "view_pos": [
+                39.00019836425781,
+                526.865966796875,
+                0.0
+            ]
+        }
+    ],
+    "pages": 11,
+    "ocr_stats": {
+        "ocr_pages": 1,
+        "ocr_failed": 0,
+        "ocr_success": 1,
+        "ocr_engine": "surya"
+    },
+    "block_stats": {
+        "header_footer": 20,
+        "code": 0,
+        "table": 4,
+        "equations": {
+            "successful_ocr": 0,
+            "unsuccessful_ocr": 0,
+            "equations": 0
+        }
+    },
+    "postprocess_stats": {
+        "edit": {}
+    }
+}